ID: 1179260576

View in Genome Browser
Species Human (GRCh38)
Location 21:39755081-39755103
Sequence ACTTCTAGTCCCCGACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 41}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179260576_1179260580 28 Left 1179260576 21:39755081-39755103 CCTGCTTGTCGGGGACTAGAAGT 0: 1
1: 0
2: 1
3: 2
4: 41
Right 1179260580 21:39755132-39755154 GTGTCGTTTTCTGTAACACTGGG 0: 1
1: 0
2: 0
3: 6
4: 161
1179260576_1179260579 27 Left 1179260576 21:39755081-39755103 CCTGCTTGTCGGGGACTAGAAGT 0: 1
1: 0
2: 1
3: 2
4: 41
Right 1179260579 21:39755131-39755153 TGTGTCGTTTTCTGTAACACTGG 0: 1
1: 0
2: 0
3: 18
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179260576 Original CRISPR ACTTCTAGTCCCCGACAAGC AGG (reversed) Intronic
901473761 1:9475177-9475199 ACTTCTGGTCCCCAGCAGGCTGG - Intergenic
901569678 1:10149893-10149915 GCTTGTAGTCCCAGACATGCAGG + Intronic
906466109 1:46081219-46081241 AATTCTAGTCCAAGACAAGGGGG - Intronic
920656722 1:207882050-207882072 ACTTCCAGTTCCAGACAAGATGG + Intergenic
1068094153 10:52469347-52469369 ACTTCTAGTCCCAGCTACGCGGG + Intergenic
1072976365 10:100062376-100062398 ACTGCCAGGCCCCCACAAGCAGG - Intronic
1073150521 10:101308331-101308353 ACCTTTAGTCCCAGAGAAGCTGG - Intergenic
1075411465 10:122231647-122231669 AGTTCTAGTCCCCAACAGGCTGG - Intronic
1076242388 10:128918502-128918524 ACTTCTGGTTCCAGACAAGATGG + Intergenic
1078840273 11:15071636-15071658 ACTTCGAGTCCGCCACAGGCCGG + Intronic
1088628551 11:111751607-111751629 ACTTCTGGTCCCAAACATGCTGG + Intronic
1088972800 11:114788311-114788333 AATTCCAGTCACTGACAAGCAGG + Intergenic
1096972715 12:55680940-55680962 ACTTGTAGTCCCAGAAAATCAGG + Intergenic
1105380210 13:19880167-19880189 ACTTCTTGGCCCCCATAAGCAGG + Intergenic
1115584503 14:34797432-34797454 ACTTCTAGTCCCAGCCACTCGGG + Intronic
1122378617 14:101286059-101286081 ACTTCTGGTTCCTGACAAGATGG + Intergenic
1127347853 15:58118914-58118936 ACTTCCATTCCCCCACTAGCAGG - Intronic
1148105386 17:45116077-45116099 ACTTCCAATCCCCAACATGCAGG - Intronic
1149283278 17:55131885-55131907 ACTTATAGTCCCAGACACTCAGG - Intronic
1158958824 18:62570171-62570193 CCATCTAGTCCCCGACATGATGG + Exonic
1159195357 18:65107130-65107152 AATTCTTGTCCCAGTCAAGCTGG - Intergenic
1160052143 18:75443860-75443882 ACTTGTAGTCCCAGACACTCTGG + Intergenic
931783106 2:65596847-65596869 ACTTCTAGTGCCAGCCAAGATGG - Intergenic
934058036 2:88269003-88269025 ACTTGTAGTCCCCGATACTCAGG - Intergenic
946288522 2:218725012-218725034 ACTTCAGCTCCCCGACTAGCTGG + Intronic
1169387163 20:5160331-5160353 ACTTCTAGTCCTCAACAGCCAGG - Intronic
1170327007 20:15167668-15167690 ACTTCTAGTCCGTGAAGAGCTGG - Intronic
1171197313 20:23210070-23210092 CCTTCTAGACCCCTACTAGCAGG - Intergenic
1174413721 20:50353254-50353276 ACTTCTAGCCCCAGACAAGAAGG + Intergenic
1179260576 21:39755081-39755103 ACTTCTAGTCCCCGACAAGCAGG - Intronic
949141279 3:636342-636364 ACTTCTAGTCCCCTTCAAGCTGG - Intergenic
956700032 3:71950884-71950906 ACTTCTAGTCCCTGAGATCCTGG - Intergenic
964351989 3:155812112-155812134 ACTTCTGCTCCCTGACAAGGGGG - Intergenic
974375176 4:61066813-61066835 AATTCTAATCCCAGTCAAGCAGG + Intergenic
988670504 5:33376171-33376193 ACTTCTAGTACCAGAGCAGCTGG - Intergenic
1001301904 5:170539670-170539692 ACTTCAAGCCCCCGAAGAGCAGG + Intronic
1025256808 7:57389320-57389342 ACTTCTAGCCCCAAACAAGAAGG - Intergenic
1026348029 7:69491848-69491870 ACTTGTAGTCCCAGACACTCAGG + Intergenic
1029881129 7:103811213-103811235 GCTTCTATTGCCCCACAAGCAGG - Intronic
1033989370 7:147265116-147265138 AATTCTAGCTCCTGACAAGCAGG + Intronic
1035673035 8:1434589-1434611 ACTTCAAGTTCCCGAGTAGCTGG + Intergenic
1036633859 8:10534161-10534183 ACTTCTGGTTCCAGACAAGACGG + Intronic
1046366984 8:113246974-113246996 ACTTCTGGTCCTCCACCAGCAGG - Intronic
1051241825 9:15065006-15065028 ACCTGTAGTCCCAGACAATCAGG + Intergenic
1202594261 Y:26520710-26520732 ACTCCTAGTCCAGGACATGCAGG - Intergenic