ID: 1179260881

View in Genome Browser
Species Human (GRCh38)
Location 21:39757364-39757386
Sequence GCATTTGGTCAGGCATTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179260881 Original CRISPR GCATTTGGTCAGGCATTCAG AGG Intronic
900819068 1:4872346-4872368 GCAGCTGGTCAGGCATTAAATGG - Intergenic
901377264 1:8848318-8848340 TCTTTTGTTCAGGCTTTCAGTGG - Intergenic
901912629 1:12472869-12472891 GCATCTGCTCAGGCAGTCTGTGG + Intronic
902732515 1:18378553-18378575 GCATTGGGACAGGCACTGAGAGG + Intergenic
907362451 1:53929556-53929578 GCATTTTCTCAGGAATTTAGGGG - Intronic
913366659 1:118047397-118047419 GCATTGGGGCAGGCATGGAGGGG - Intronic
915011080 1:152686929-152686951 GCACTGGGGCAGGCATTTAGGGG - Exonic
917906959 1:179594518-179594540 GCATTTGGGCAGAAATTCACTGG - Intronic
921009994 1:211132637-211132659 GGATTTAGTTAGGGATTCAGGGG - Intronic
923842156 1:237684631-237684653 ACATTTGGTCAGGTATTTATCGG + Intronic
1064095630 10:12422528-12422550 GCATTTGGCCAGGTGTTCAGGGG - Intronic
1064966760 10:21021978-21022000 GCATTTGTGCAAACATTCAGCGG + Intronic
1066396443 10:35028154-35028176 GCATTTGTGCAGACATTCATTGG - Intronic
1067936310 10:50615183-50615205 ACATGTCGGCAGGCATTCAGTGG - Intronic
1067978545 10:51055039-51055061 GAATATGGTCAGGGATACAGGGG - Intronic
1069289544 10:66760734-66760756 GCATTTGGTTAGGCTTTTAAAGG + Intronic
1070641733 10:78175296-78175318 GCATTTCCTCAGCCATGCAGGGG + Intergenic
1078989568 11:16632884-16632906 GCAGATCCTCAGGCATTCAGAGG - Intronic
1081886124 11:46498087-46498109 AAATTTGGTCAGGCAGGCAGAGG + Intronic
1086549833 11:88042806-88042828 GCCCTGGGTCAGGCATTCTGAGG - Intergenic
1087369619 11:97266415-97266437 GCATCTGGTGAGGGCTTCAGGGG + Intergenic
1088898691 11:114097981-114098003 GTATGTGGTCAGGTTTTCAGAGG + Intronic
1089806949 11:121098967-121098989 GGACTTGGTCAGGCACTCAAGGG - Intergenic
1091230520 11:133985113-133985135 GCGTGTGCTCAGGCACTCAGGGG - Intergenic
1091840353 12:3616121-3616143 GCATTTGCCCAGGGAGTCAGGGG + Intronic
1095154624 12:38837432-38837454 GCATTTGCTAAGGTATCCAGAGG + Intronic
1096218174 12:49809772-49809794 GCTTTGGGTCAGGGATTAAGTGG - Intronic
1099193560 12:79586800-79586822 GCATTTGGTCCAGGATTAAGAGG + Exonic
1103158004 12:118703503-118703525 GCATTGGGTCAGGCAAACAGTGG + Intergenic
1103509606 12:121465762-121465784 GCATTTGGTCATTCATTCGTAGG - Intronic
1104470791 12:129028157-129028179 GCAGTTTATCAGGCATTCACTGG - Intergenic
1106574264 13:30959807-30959829 TCGTTATGTCAGGCATTCAGGGG - Intronic
1108574707 13:51781392-51781414 GCACTGGGTCTGGCACTCAGTGG - Intronic
1112334934 13:98506937-98506959 TAATTTGCTCAGGCTTTCAGGGG + Intronic
1113232931 13:108235953-108235975 AAATTTGGTCAGGGACTCAGAGG - Intergenic
1114243635 14:20892438-20892460 GAATTTGGTCAGATATTGAGGGG - Intergenic
1115443186 14:33459538-33459560 TCATTTGGTCAGGCAATCTGAGG + Intronic
1118922805 14:70165543-70165565 GGATATGTTCAGTCATTCAGAGG + Intronic
1120637817 14:86973795-86973817 GGACTTGGGTAGGCATTCAGAGG - Intergenic
1122294591 14:100698135-100698157 GCATGTGGCCGGGCATTGAGGGG - Intergenic
1122892381 14:104738784-104738806 GCATCTGGCCAGGCACGCAGAGG + Intronic
1125383833 15:39115352-39115374 GCAGATCTTCAGGCATTCAGAGG + Intergenic
1126115923 15:45207477-45207499 GCTTTGTGTCAGGCATTGAGGGG + Intergenic
1129929268 15:79396107-79396129 GCATTTGTTCTGGAATTCAGAGG - Intronic
1130243378 15:82219722-82219744 GCATTTGCTCGGGTGTTCAGTGG - Exonic
1130457091 15:84121577-84121599 GCATTTGCTCGGGTGTTCAGTGG + Intergenic
1130876621 15:88020119-88020141 GCACATGGGCAGGCATACAGGGG + Intronic
1132573070 16:652399-652421 GGAGTTGGTCGGGCATTCTGGGG + Intronic
1136612006 16:31372049-31372071 GCTTTTTTTCAGGCATTCACTGG + Intronic
1143628158 17:8122556-8122578 GCATTTGGTCGCGCGTTCTGTGG - Intronic
1144076293 17:11722530-11722552 GAATATGGGCAGGCAGTCAGTGG + Intronic
1156556750 18:38076914-38076936 TCCTCTGGTGAGGCATTCAGAGG + Intergenic
1157379865 18:47203942-47203964 GCAATTACTCAGGCATTCTGAGG + Intergenic
1159245397 18:65798864-65798886 TCATTTGGTGAGGCACGCAGGGG + Intronic
1160252726 18:77217631-77217653 GCATTTGGCCAGGAGTTAAGAGG - Intergenic
1168314568 19:55478976-55478998 GCAGGTGGTGTGGCATTCAGAGG + Intronic
926116845 2:10218619-10218641 TCATTTGCTGAGGCCTTCAGAGG + Intergenic
929336061 2:40747106-40747128 GCATTTGGTAAGCTATTCAGAGG + Intergenic
929495944 2:42443931-42443953 GCATTAATTCAGGAATTCAGTGG + Exonic
929729703 2:44474712-44474734 GCATTTGGTCTGGCATAGTGAGG - Intronic
935254516 2:101297643-101297665 CCATTTGGTCAGGCATAGAGTGG - Intronic
943544783 2:189261468-189261490 ACATTTGGTCAGTCAGTCAGAGG + Intergenic
944189951 2:196992181-196992203 GCACTTGCTCAGTAATTCAGAGG + Intronic
945281788 2:208042255-208042277 GAATGGGATCAGGCATTCAGTGG + Intergenic
946609598 2:221442990-221443012 GAATTTGGTGAGGTATGCAGTGG - Exonic
947829770 2:233130726-233130748 GCATTTGTTCAGCCAGGCAGAGG - Intronic
948533413 2:238628624-238628646 CCATAGGGTCAGGCTTTCAGAGG - Intergenic
1173438935 20:43057921-43057943 GCACTGGGTTAGGCATTGAGTGG - Intronic
1175855366 20:62118192-62118214 GCATTTGATCCTGCATTCTGAGG + Intergenic
1178833232 21:36073758-36073780 GCCTGAGGTCAGGAATTCAGTGG - Intronic
1179260881 21:39757364-39757386 GCATTTGGTCAGGCATTCAGAGG + Intronic
950880565 3:16319640-16319662 GGATGTGGCCAGGCATCCAGGGG - Intronic
952960651 3:38587244-38587266 GCACTGGGCCAGGCATCCAGGGG + Intronic
956687165 3:71840734-71840756 GCTTTTGGCCAGGCTCTCAGAGG + Intergenic
959566482 3:107837771-107837793 TCATTAGGTCAGGCCTCCAGAGG - Intergenic
961052456 3:123758452-123758474 GCATTTGCTGAGCCATTGAGAGG - Intronic
962815444 3:138993195-138993217 GCATTTGTCCACGCATACAGTGG - Intergenic
967267061 3:187700215-187700237 TCATGTGATCAGGCTTTCAGGGG - Intronic
970209778 4:13697114-13697136 GCATTTTCTCAGGCTGTCAGTGG - Intergenic
971299026 4:25426703-25426725 CCATTGGGTAAAGCATTCAGGGG + Intergenic
971491429 4:27216066-27216088 ACATATGGTCAGGGATTTAGTGG - Intergenic
971606832 4:28668774-28668796 GCATTTGTAGTGGCATTCAGGGG - Intergenic
973322814 4:48827589-48827611 GCATTTGTGCTGGCATTTAGAGG - Intronic
976462125 4:85324300-85324322 GCAGATGGTCAGGAATGCAGAGG - Intergenic
976478021 4:85507006-85507028 CCAATTGTTCAGGAATTCAGTGG + Intronic
977722863 4:100261190-100261212 TCATTTGGTCAGGCTTTGGGAGG + Intergenic
977926484 4:102705780-102705802 CCATTTGCTCAGGCACTGAGTGG - Intronic
984480738 4:180297877-180297899 CCATTTGGTCTGTCAGTCAGTGG + Intergenic
985668352 5:1193394-1193416 GCATGTGGACAGGCATTCCTTGG + Intergenic
985853854 5:2410020-2410042 GCTTTTGGGCTGCCATTCAGGGG - Intergenic
988503278 5:31800782-31800804 GAATTTTGTCAAGCTTTCAGGGG + Intronic
989081730 5:37630147-37630169 GCATTTGTTCATGCACACAGTGG + Intronic
992971929 5:82070187-82070209 GCATTTTCTCAGGCATCCATCGG - Intronic
993217843 5:85048613-85048635 GCATATCCCCAGGCATTCAGAGG + Intergenic
994478883 5:100307796-100307818 TCTTTTAATCAGGCATTCAGAGG - Intergenic
996702814 5:126466733-126466755 GCATTAGGTGAGGCTTTGAGGGG - Intronic
998895015 5:146789888-146789910 GCAGATGGTCAGGCAGGCAGGGG + Intronic
1000083368 5:157868020-157868042 GCATTTGGGCAAGCATCCAGGGG - Intergenic
1001228698 5:169967393-169967415 GCATGTGGTCAGGCTGTCAGAGG + Intronic
1001458287 5:171885048-171885070 CCATTTGGTCACGCATAAAGGGG - Intronic
1002015571 5:176319235-176319257 CCATTGGGTTGGGCATTCAGTGG + Intronic
1002842814 6:921082-921104 GCATTTGGACAGGCAAGCTGTGG - Intergenic
1003877588 6:10452022-10452044 GCACTTGGCCTGGCTTTCAGAGG - Intergenic
1008849375 6:56006078-56006100 GCCTTTGGTCAGTAATTCAGGGG - Intergenic
1012464507 6:99502432-99502454 ACAGTTGGTCAGAAATTCAGTGG + Intronic
1013169445 6:107623167-107623189 GGATTTGGTCCGACAATCAGAGG + Intronic
1013929561 6:115514748-115514770 GCCTTTGGGCAGGCATTCTTGGG + Intergenic
1022059408 7:26776437-26776459 GAATTAGGTCAGTCATACAGAGG - Intronic
1024598496 7:50960088-50960110 TCACTTGCTCAGACATTCAGAGG + Intergenic
1029086100 7:98012910-98012932 GCACTGAGTCAAGCATTCAGAGG - Intergenic
1029642895 7:101832295-101832317 GCATTTCCACAGGCATCCAGAGG + Intronic
1031939560 7:127773570-127773592 GCATTTTGTCAGCCATTTTGAGG + Intronic
1037783367 8:21886455-21886477 GCCCTTGGACAGGCATTCAGTGG + Intergenic
1038937911 8:32272612-32272634 ACATTGGATCAGGCATTGAGAGG + Intronic
1045075211 8:98557922-98557944 GCATGTGGGCAGGACTTCAGAGG + Intronic
1045368862 8:101501157-101501179 GCATTTGAATGGGCATTCAGTGG + Intronic
1045524549 8:102930507-102930529 ACATTTGGTCAGGTATTCTGGGG + Intronic
1048670810 8:136717432-136717454 ACATTTGGTCATGAATTCATGGG + Intergenic
1051504318 9:17810924-17810946 GCATTTCGTCCAGCATGCAGGGG - Intergenic
1055801311 9:80039228-80039250 ACATTTGGACAGGGATTCTGGGG + Intergenic
1057624888 9:96668237-96668259 CCATTTGGGCAGGCATTCCTTGG - Intergenic
1058745823 9:107989640-107989662 GCATTTGGTCTGACTGTCAGAGG - Intergenic
1059880156 9:118679279-118679301 GCATTTAGACAAGCATTTAGTGG + Intergenic
1059913576 9:119074212-119074234 GCATTTGGTCACACATCAAGGGG - Intergenic
1062041603 9:134406939-134406961 GCATTTGGTGAGTCACACAGTGG + Intronic
1203490975 Un_GL000224v1:104246-104268 GGGTTTGGTCAGGCAGTGAGCGG - Intergenic
1203503599 Un_KI270741v1:46119-46141 GGGTTTGGTCAGGCAGTGAGCGG - Intergenic
1186506984 X:10101346-10101368 ACATTTGCTCAGCCAATCAGGGG - Intronic
1189003984 X:36976489-36976511 GCATTTGCTCATTCATTCAATGG + Intergenic
1189240849 X:39523210-39523232 GCCTTTGGTCAGGAATTGCGGGG - Intergenic
1190534231 X:51409384-51409406 GAAAATGGTCAGACATTCAGTGG + Intergenic
1191254159 X:58272664-58272686 ACATTTTGGCATGCATTCAGTGG + Intergenic
1191257156 X:58284518-58284540 GCAAGTGGCCAGGCTTTCAGGGG - Intergenic