ID: 1179261672

View in Genome Browser
Species Human (GRCh38)
Location 21:39763505-39763527
Sequence GGAGGCCACACGTGTCACTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 55}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179261672_1179261679 1 Left 1179261672 21:39763505-39763527 CCGTAGTGACACGTGTGGCCTCC 0: 1
1: 0
2: 0
3: 9
4: 55
Right 1179261679 21:39763529-39763551 GGGTACATAAAGACTGGCCTTGG 0: 1
1: 0
2: 0
3: 8
4: 106
1179261672_1179261677 -5 Left 1179261672 21:39763505-39763527 CCGTAGTGACACGTGTGGCCTCC 0: 1
1: 0
2: 0
3: 9
4: 55
Right 1179261677 21:39763523-39763545 CCTCCGGGGTACATAAAGACTGG 0: 1
1: 0
2: 0
3: 3
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179261672 Original CRISPR GGAGGCCACACGTGTCACTA CGG (reversed) Intronic
903261363 1:22133438-22133460 GGATGGCACACGTGTCTCTGGGG - Intronic
911063096 1:93764494-93764516 GGAGGCCACAGATATCACAAGGG - Intronic
1065281530 10:24143747-24143769 GGAGGCCAGATATGTCAATAAGG - Intronic
1069830254 10:71278637-71278659 GGAGGCCACATCTGGCTCTAGGG - Intronic
1078604451 11:12762869-12762891 GGTGGCCACACCTGGCACCAGGG - Intronic
1081727201 11:45338753-45338775 GGAGGCCACACGGGTGATGAGGG + Intergenic
1085540009 11:77258626-77258648 CAAGGTCACAAGTGTCACTAGGG + Intronic
1090007581 11:123016613-123016635 GGGGGCTACATGTGTCACTCAGG + Intergenic
1092022759 12:5215926-5215948 GGAGGGCAGACGTGCCACTGGGG + Intergenic
1096527430 12:52219558-52219580 GGAAGACACACTTCTCACTAAGG - Intergenic
1096726801 12:53570581-53570603 GGAGGCCAGAGGTGTTACCAGGG + Intronic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1111236123 13:85410612-85410634 GGAGGACACACGTGTAACTGGGG - Intergenic
1118773370 14:68957303-68957325 GGAGGTCACAGGTGTCTCTTGGG - Intronic
1119425022 14:74529439-74529461 GAAGGCCCCACGTGTCCCTAGGG + Intronic
1122752058 14:103943847-103943869 GGTGGCCACACACGTCACTCTGG - Intronic
1127305751 15:57704522-57704544 GTAGGCCACAGGTGTCCCCAAGG - Intronic
1128206479 15:65857064-65857086 CGAGGCTACAGGTGTCACTAAGG + Intronic
1131826374 15:96324783-96324805 GGAGGCCACTTGTGTAACTCGGG - Intergenic
1131881776 15:96869808-96869830 GGAGGCCACATGTATCAATCTGG - Intergenic
1134153284 16:11821931-11821953 GAAGGCCACACGCCTCACAACGG + Intergenic
1138836570 16:60443835-60443857 GGAAGCCATGCATGTCACTATGG - Intergenic
1139339677 16:66259790-66259812 GGAGACCCCATGTGTCTCTAAGG + Intergenic
1141679973 16:85538177-85538199 GGCGGCCACAGGTGGCTCTAGGG - Intergenic
1161054103 19:2181317-2181339 GGAGGCCACATGTGTCCATGTGG + Intronic
1168562963 19:57398539-57398561 GTGGGCCACATGTCTCACTAGGG - Exonic
927619977 2:24644953-24644975 GGAGGCGACAGTTGTCACTATGG + Intronic
948050355 2:234975247-234975269 GGACGACAGACGTGTCACTGAGG + Intronic
948062484 2:235052017-235052039 GGAGGCCACAGGTCTCAGTCAGG + Intronic
948080738 2:235203216-235203238 GGAGTCCTCGCCTGTCACTAAGG - Intergenic
1171014250 20:21525472-21525494 GGAGGCCACACGTGAGGCTAAGG - Intergenic
1175305520 20:57973290-57973312 GAAGGCCACACGTCTCTCCAGGG - Intergenic
1176003146 20:62843241-62843263 TGAGCCCACAGGTGTCTCTACGG - Intronic
1179034196 21:37745820-37745842 GGAGCACACACGTCCCACTAGGG + Intronic
1179261672 21:39763505-39763527 GGAGGCCACACGTGTCACTACGG - Intronic
1180176909 21:46095249-46095271 GGAGGCCAAAAGTGTCGCTGTGG - Intergenic
1182764471 22:32748816-32748838 AGAGGCCACAGGTGTTACTGGGG - Intronic
1184832362 22:46996781-46996803 GGAGCACACACATGACACTAGGG - Intronic
957505586 3:81116353-81116375 GGAGGCCACAGGTTTCCCTCAGG - Intergenic
958815793 3:98914094-98914116 GGAGGCCACAGGTGCTATTAGGG - Intergenic
967045462 3:185732589-185732611 GGAGGCCAGCCGTCTCCCTAGGG - Intronic
968568953 4:1329363-1329385 GGAGGCCCCGCGAGTCTCTAGGG - Intronic
987073671 5:14360654-14360676 GGAAGCCACACGGCCCACTATGG - Intronic
988959594 5:36356509-36356531 GGAGGACAGAGGTGTCCCTAAGG + Intergenic
994368734 5:98945882-98945904 GGAGGACACACCATTCACTAAGG - Intergenic
1000980394 5:167810737-167810759 AGAGGCCACACTTGTCACAATGG + Intronic
1002446142 5:179291224-179291246 GGAGCCCACAAGTGCCACTCAGG - Intronic
1007924576 6:45641004-45641026 GGAGGCCGCGCCTGTCACTTTGG - Intronic
1018914570 6:168125212-168125234 GGTGGCCAAACGTGACACTGGGG + Intergenic
1019823705 7:3266072-3266094 GGAGGCCACCTATGTCACCAGGG - Intergenic
1020278388 7:6637729-6637751 GGAGGCCACGCGTGACACCTCGG + Intronic
1027123077 7:75536255-75536277 GGAGGTCACACGTCTGAGTATGG + Exonic
1029402398 7:100354134-100354156 GGAAGCCACAGGTGTCCCTCAGG - Intronic
1032801029 7:135317442-135317464 GGTGACCACAGGTGACACTAAGG + Intergenic
1034073564 7:148210572-148210594 GTGGGCCACACGTGCCACTCAGG + Intronic
1034694213 7:153039661-153039683 GGAAGCCACAAATGTCACTATGG + Intergenic
1040577416 8:48666032-48666054 GGTGGCCACACGGGGCTCTAGGG + Intergenic
1049297792 8:141852385-141852407 GGAGGCCACAGGTGTGACCAGGG + Intergenic
1052103950 9:24488164-24488186 GGAGTCCACAGGTATCACAAGGG + Intergenic
1057562491 9:96139479-96139501 AGAGGACACACTTGTCACCATGG - Intergenic
1060805313 9:126571977-126571999 GGAGACCTCACATGTCACTGTGG - Intergenic
1061312184 9:129771023-129771045 GGAGACCTCACCTGTCACTGTGG - Intergenic
1062503167 9:136859856-136859878 GGAGGGCTCACATGTCCCTATGG + Intronic
1192183702 X:68931640-68931662 GGAAGCCACACGTGACACCATGG + Intergenic
1198751075 X:139936784-139936806 GTAGGCCACACCTGTGACGAAGG + Intronic