ID: 1179273129

View in Genome Browser
Species Human (GRCh38)
Location 21:39866750-39866772
Sequence CAACCACAGTGGGGCCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179273129_1179273137 -1 Left 1179273129 21:39866750-39866772 CCTTCCTGGCCCCACTGTGGTTG No data
Right 1179273137 21:39866772-39866794 GTGAGGAGGGCACATCAGCAAGG No data
1179273129_1179273138 6 Left 1179273129 21:39866750-39866772 CCTTCCTGGCCCCACTGTGGTTG No data
Right 1179273138 21:39866779-39866801 GGGCACATCAGCAAGGCTGCTGG No data
1179273129_1179273139 30 Left 1179273129 21:39866750-39866772 CCTTCCTGGCCCCACTGTGGTTG No data
Right 1179273139 21:39866803-39866825 GCCGCTCGCCTCCTTTGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179273129 Original CRISPR CAACCACAGTGGGGCCAGGA AGG (reversed) Intergenic
No off target data available for this crispr