ID: 1179277114

View in Genome Browser
Species Human (GRCh38)
Location 21:39902140-39902162
Sequence CTACATGTCTTGAAGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179277112_1179277114 1 Left 1179277112 21:39902116-39902138 CCTATTAATATCAAATGAAGCTG 0: 1
1: 0
2: 2
3: 14
4: 209
Right 1179277114 21:39902140-39902162 CTACATGTCTTGAAGGAGCAAGG 0: 1
1: 0
2: 1
3: 19
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179277114 Original CRISPR CTACATGTCTTGAAGGAGCA AGG Intronic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905719388 1:40184037-40184059 CTACATGGTTTCAAGGAGCTTGG - Intronic
908419561 1:63946770-63946792 CAACATGCCTTGAGGAAGCAAGG - Intronic
909226141 1:73025513-73025535 CTATATCTAATGAAGGAGCAAGG - Intergenic
909298903 1:73985669-73985691 CTACATGCTTTGAAGAAGTAAGG - Intergenic
910301120 1:85708465-85708487 CTACAAGTCGTGAAGGGGCGAGG - Intergenic
910350275 1:86288499-86288521 CTAGATGACTTTATGGAGCATGG + Intergenic
912967265 1:114247628-114247650 GTTCATGTCTTGCAGGAACATGG + Intergenic
916650257 1:166828625-166828647 CTCCATGACTTGAAGAAGCATGG - Intergenic
917250079 1:173049459-173049481 ATACATTTCTTGAGAGAGCAGGG + Intronic
917367885 1:174253829-174253851 CTATTTGGCTTCAAGGAGCAAGG + Intronic
918354145 1:183690031-183690053 CCACATGAGTTGAAGGAGCTTGG + Intronic
922016596 1:221654711-221654733 GAACATGTTTTGAAGGAGGAAGG - Intergenic
922273527 1:224056111-224056133 CTAGATGTCGTGTAGTAGCATGG - Intergenic
1063543338 10:6956460-6956482 CTACATTTCTTAAAGGAGCCAGG + Intergenic
1063732525 10:8714558-8714580 TTACAAGTCTTGAATTAGCAGGG + Intergenic
1072533705 10:96343606-96343628 CTACATGTCATGAAGGACCTTGG - Exonic
1073992001 10:109272103-109272125 CTACAGGTTTTGAAGGAGTGTGG - Intergenic
1074461573 10:113642822-113642844 CTATGTGTCTTGGAGAAGCATGG - Intronic
1076908484 10:133375281-133375303 CTACATTACTTGATGGAGGACGG - Intergenic
1086264158 11:84978058-84978080 CTAAATGTCTTGAAGGGGAAGGG + Intronic
1086280988 11:85188197-85188219 CTAAATATCTTGAATCAGCAAGG - Intronic
1094179091 12:27572025-27572047 GTACATTTCTTGAAGCATCAGGG - Intronic
1094335360 12:29344466-29344488 CAACATTTCTTTAAGGAGTAGGG - Intronic
1096148044 12:49292987-49293009 CTACATGCCTCGGAGGAGAAGGG - Intergenic
1096219660 12:49821104-49821126 CTACAGGCCTTGAAGGAGCAAGG - Intronic
1099617951 12:84962855-84962877 CTTGATGTTTTGAAGGAGAAAGG + Intergenic
1107590897 13:41903780-41903802 CTGCATGGCTTTAAGCAGCAAGG + Intronic
1109393786 13:61726740-61726762 CTCCATGTGTCGAAGGAGGAAGG - Intergenic
1110312403 13:74066031-74066053 CTAGAGGTCCTGCAGGAGCAGGG + Intronic
1111564556 13:89997783-89997805 CAGAATGTCTTGAATGAGCATGG - Intergenic
1117954874 14:61114987-61115009 TTTCATTACTTGAAGGAGCAAGG + Intergenic
1118596322 14:67438108-67438130 CAACATGGCTTGAAGGACCTTGG - Intergenic
1121319502 14:92982836-92982858 TTAGATGCCTTCAAGGAGCAGGG - Intronic
1121620901 14:95347684-95347706 CAAGATTTCTTCAAGGAGCAGGG + Intergenic
1122271279 14:100569340-100569362 CTCCTTGTCTTGCAGGAGGAGGG - Intronic
1128722000 15:69956952-69956974 CTCCATGTATTGTAGGAGAAAGG - Intergenic
1137934032 16:52616858-52616880 CTATATGTCTTGTAGGATAAGGG + Intergenic
1139512676 16:67436368-67436390 CCACCTGTCTTGAAGCAGCCAGG - Exonic
1140850053 16:78926735-78926757 CTACATTTCTAGAAAGACCATGG + Intronic
1141352154 16:83307922-83307944 ATACATATTTTGAATGAGCATGG - Intronic
1142899524 17:3003615-3003637 CTGCATGGCTGGAAGGAGGAAGG - Intronic
1143203792 17:5129633-5129655 CTAGATGTCCTCCAGGAGCAAGG + Intronic
1143636082 17:8164307-8164329 CTACATCCCTGGAAGGTGCAGGG + Intergenic
1144494675 17:15738715-15738737 CTACAGGTCATGAAGGAGAAGGG + Exonic
1144639323 17:16928863-16928885 CTACAAGTCATGAAGGAGAAGGG - Intergenic
1144875805 17:18396560-18396582 CTACAGATCATGAAGGAGAAGGG + Intergenic
1144905579 17:18637957-18637979 CTACAGGTCATGAAGGAGAAGGG - Exonic
1145156423 17:20547861-20547883 CTACAGATCATGAAGGAGAAGGG - Intergenic
1145760449 17:27422551-27422573 CTACAGGTCATGAAGGAGAAGGG + Intergenic
1145798598 17:27669747-27669769 CTACAGGTCATGAAGGAGAAGGG - Intergenic
1146160477 17:30556867-30556889 CTACAGGTCATGAAGGAGAAGGG + Intergenic
1146843919 17:36171948-36171970 CTACAGATCATGAAGGAGAAGGG - Exonic
1146856225 17:36259883-36259905 CTACAGATCATGAAGGAGAAGGG - Exonic
1146864394 17:36328492-36328514 CTACAGATCATGAAGGAGAAGGG + Exonic
1146872132 17:36383794-36383816 CTACAGATCATGAAGGAGAAGGG - Exonic
1146879494 17:36434879-36434901 CTACAGATCATGAAGGAGAAGGG - Exonic
1146883419 17:36456022-36456044 CTACAGATCATGAAGGAGAAGGG - Intergenic
1147067253 17:37929080-37929102 CTACAGATCATGAAGGAGAAGGG + Exonic
1147075018 17:37984418-37984440 CTACAGATCATGAAGGAGAAGGG - Intronic
1147078785 17:38008641-38008663 CTACAGATCATGAAGGAGAAGGG + Intronic
1147086543 17:38063964-38063986 CTACAGATCATGAAGGAGAAGGG - Exonic
1147094723 17:38132576-38132598 CTACAGATCATGAAGGAGAAGGG + Intergenic
1147102486 17:38187927-38187949 CTACAGATCATGAAGGAGAAGGG - Intergenic
1149847059 17:60014393-60014415 CTACAGATCATGAAGGAGAAGGG - Intergenic
1150085418 17:62271010-62271032 CTACAGATCATGAAGGAGAAGGG - Intergenic
1153145178 18:2023362-2023384 CTACTGGTCTTGCAGGAGAAAGG + Intergenic
1155426624 18:25714038-25714060 CTGCATTTCTTGCTGGAGCAAGG - Intergenic
1156969454 18:43137440-43137462 CTACATGTCATGGATGAACATGG + Intergenic
1157930942 18:51822646-51822668 ATAGATGTCTTGAAGGAGTATGG - Intergenic
1158652924 18:59303782-59303804 CTACATGTCTACAGGGAGCATGG - Intronic
1164454826 19:28398351-28398373 CTCCATGTCTCTGAGGAGCAAGG - Intergenic
1164477553 19:28586965-28586987 CTCCAGGTCATGCAGGAGCAGGG + Intergenic
1164638813 19:29810853-29810875 ATACAAGTCTTGAGGGAGAAAGG + Intergenic
1167264815 19:48478261-48478283 CTCCTTGTCCTGAAGAAGCAAGG - Exonic
927204437 2:20598329-20598351 CAAGATCTCTTGAATGAGCAAGG + Intronic
927311252 2:21634115-21634137 CAGCATGTCAGGAAGGAGCAAGG + Intergenic
928976877 2:37096882-37096904 CTTCTTGCTTTGAAGGAGCAAGG + Exonic
932673754 2:73760095-73760117 GTACATATCTTGAAGGGCCAGGG - Intergenic
934132976 2:88967348-88967370 CCACATGCATTGAAGAAGCACGG - Intergenic
935394186 2:102588157-102588179 CTAGATCACTTGAAGGAGAAAGG - Intergenic
935570517 2:104655352-104655374 CTACATGCCATGAAAGAGCCTGG + Intergenic
935946447 2:108290612-108290634 CACCATGTCTTGATGCAGCATGG - Intronic
938845859 2:135208195-135208217 CCACATATATTTAAGGAGCAGGG - Intronic
939522596 2:143249133-143249155 CAAAATCTCTTTAAGGAGCATGG + Intronic
942062470 2:172240488-172240510 CCACAAGACTTGAAGGAGCCTGG - Intergenic
944593037 2:201236196-201236218 CTAAATGCCTAAAAGGAGCAGGG - Intronic
948329620 2:237154809-237154831 CCAGATTTCTAGAAGGAGCAGGG + Intergenic
948362913 2:237435342-237435364 CTACAGGTCCTAAAGGGGCAAGG - Intergenic
1170223115 20:13962404-13962426 CACCATGTCCTGAAGAAGCAAGG + Intronic
1171230702 20:23481874-23481896 TGACCTGTTTTGAAGGAGCAGGG + Intergenic
1172799756 20:37567551-37567573 CTACATGGCTCGTAGGAGGAAGG - Intergenic
1173260217 20:41427985-41428007 CTACATGGCACGAAGGAACATGG - Intronic
1177171421 21:17660115-17660137 CTACAAGTGTAGAAAGAGCATGG - Intergenic
1179277114 21:39902140-39902162 CTACATGTCTTGAAGGAGCAAGG + Intronic
1183393092 22:37556874-37556896 CTCCCTGTCTTGAAGGAACCAGG - Intergenic
1184745463 22:46453137-46453159 TTCCATGTCTAGCAGGAGCATGG - Intronic
952865218 3:37850680-37850702 CTCCATCTCTTGAAGGGGCATGG - Intergenic
954134857 3:48577425-48577447 ATACATGTCTCCAAAGAGCATGG + Intronic
956099663 3:65754293-65754315 CTACATCACTTGAATGAGGATGG - Intronic
956853132 3:73249954-73249976 CTTCCTGTCTTCAAGAAGCAAGG + Intergenic
964474350 3:157085247-157085269 CTGACTGTCTTGCAGGAGCAGGG - Intergenic
964534146 3:157700960-157700982 GGACATGTCTTGAAGGAGGAGGG + Intergenic
967075988 3:186002647-186002669 CCCCATGTGTTGAAGGAGGAAGG + Intergenic
971973444 4:33651643-33651665 CTAGATGTTTGGAAAGAGCAAGG + Intergenic
973804391 4:54511793-54511815 CAACATGTGCTGCAGGAGCAAGG - Intergenic
975929761 4:79505761-79505783 CTATATGTCAGGAAGAAGCATGG + Intergenic
976648774 4:87412980-87413002 GTTCTTGTCTTGATGGAGCAAGG + Intergenic
978588314 4:110296518-110296540 CTAGAAGGCTTGAAGGGGCAGGG + Intergenic
979009232 4:115345605-115345627 CTCCATGTCATGAGTGAGCATGG + Intergenic
981603806 4:146521809-146521831 CTGCATGTCTGGAGGGACCAAGG - Exonic
985526616 5:406269-406291 CTGCATTTCTTGCAGGAACATGG + Intronic
987082590 5:14438914-14438936 CTACATGACTGGAAGGAGGGAGG + Intronic
987715150 5:21558759-21558781 ATACAAGTTTTGAAGGATCATGG + Intergenic
990855871 5:60265757-60265779 CAGCATTTTTTGAAGGAGCAAGG - Intronic
991706078 5:69360112-69360134 CTATATTTCCTGAAGGAGAATGG + Intronic
993035085 5:82747751-82747773 ATCCATGACTTGTAGGAGCAAGG + Intergenic
993606869 5:90001659-90001681 CTACATCTCTAGAAAGACCAGGG - Intergenic
994234014 5:97340301-97340323 CTACAGGTCTGCAAGAAGCATGG + Intergenic
998386847 5:141762153-141762175 CTACATGGCTTGAAGGGAGAGGG + Intergenic
998686405 5:144531896-144531918 CCACATGTGTTGAAGGAGGAAGG + Intergenic
999925608 5:156372834-156372856 ATACATGTCTTTCAGGATCAAGG + Intronic
1001851450 5:174970446-174970468 CTACATGTTTTCAAGGGGAAGGG - Intergenic
1002919142 6:1553944-1553966 CTTCATGTATTGTAGGAGCTGGG + Intergenic
1008690281 6:53971279-53971301 CTAAATGGCTTGAAAGAGCTAGG + Intronic
1009001569 6:57723290-57723312 ATACAAGTTTTGAAGGATCATGG - Intergenic
1012924976 6:105258514-105258536 CTACATGGTTCGCAGGAGCAAGG - Intergenic
1014373842 6:120646668-120646690 CTACATGTGTTACAGAAGCATGG - Intergenic
1014961222 6:127687631-127687653 GATCATGTTTTGAAGGAGCATGG - Intergenic
1017997594 6:159546339-159546361 CTACATGGCTGGAAGGTGGAAGG - Intergenic
1018964433 6:168473505-168473527 CTTATTCTCTTGAAGGAGCATGG + Intronic
1020287150 7:6692542-6692564 CTATTTTTCTTGAAGGAACAGGG + Exonic
1021140935 7:17023986-17024008 CTGGATATCTTGAAGGACCAGGG + Intergenic
1022690953 7:32653233-32653255 CAACATGTGTTGATGGTGCAGGG - Intergenic
1022918521 7:34987128-34987150 CAACATGTGTTGATGGTGCAGGG - Intronic
1022998242 7:35780783-35780805 ATATATTTGTTGAAGGAGCAAGG - Intergenic
1028048789 7:86157709-86157731 CTAAATGTTTTGTAGAAGCAAGG + Intergenic
1028752972 7:94403087-94403109 CTACATCTCAAGAAGAAGCAAGG + Intronic
1032470404 7:132174549-132174571 CTTCAGGTCTTGGAGGATCATGG - Intronic
1034002454 7:147430767-147430789 ATACATGGGTTGAAGGAGCCGGG + Intronic
1035654963 8:1298603-1298625 CCACATGTCCTGCAGAAGCATGG + Intergenic
1036396321 8:8374414-8374436 CTACAGGACATCAAGGAGCATGG - Intronic
1036404051 8:8439009-8439031 CTACATGCCTCGTAGGAGCCAGG - Intergenic
1036612987 8:10366012-10366034 CTATCTGTCCTGAAGGAGCAGGG - Intronic
1037883303 8:22583250-22583272 CTACTTGTCTGGAAGGAGGCAGG + Intronic
1040722594 8:50344490-50344512 CTCCATGTCTTGATGGGGAATGG + Intronic
1043762537 8:84085713-84085735 CTCCTTGGCCTGAAGGAGCAAGG - Intergenic
1045747040 8:105434807-105434829 CTACATGGATTAAAAGAGCAAGG + Intronic
1045984585 8:108234922-108234944 ATACATGTTTTGAAGAACCAAGG + Intronic
1047059595 8:121209647-121209669 CTACATGTACTGAAGGAGAGTGG + Intergenic
1053528763 9:38856652-38856674 CTACTTGTCTTGCAGGAGGAAGG + Intergenic
1054200990 9:62081085-62081107 CTACTTGTCTTGCAGGAGGAAGG + Intergenic
1054637369 9:67507278-67507300 CTACTTGTCTTGCAGGAGGAAGG - Intergenic
1054709302 9:68495196-68495218 CCACAAGTCTTGAAGAAACAAGG - Intronic
1057534766 9:95890051-95890073 GGAGATGTGTTGAAGGAGCATGG - Intronic
1059266282 9:113034459-113034481 CTACATCTTGTGAATGAGCAAGG + Intergenic
1062292982 9:135805688-135805710 CTTCCTCTATTGAAGGAGCAAGG + Intergenic
1189735065 X:44061744-44061766 CTACATTTGCTCAAGGAGCATGG + Intergenic
1192411025 X:70932196-70932218 CAAGATGTCTTGGTGGAGCAGGG - Intergenic
1193847814 X:86496768-86496790 CTAAATGGCTTGAAAGAGCTAGG + Intronic
1195381713 X:104277447-104277469 CTAAATGGTTTGAAGGAGCCAGG + Intergenic
1198479638 X:137029885-137029907 CTACATTTCTTAAAGCAACAAGG - Intergenic
1199739477 X:150719791-150719813 ATACATATTTTGAATGAGCAGGG + Intronic
1201453916 Y:14147374-14147396 CCACATGTCCTGGAGGAACATGG - Intergenic
1201683252 Y:16672174-16672196 CTACTTGTCTTGGATGGGCATGG - Intergenic