ID: 1179279476

View in Genome Browser
Species Human (GRCh38)
Location 21:39922265-39922287
Sequence AAAATCTACTTGAGTATATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 339}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179279475_1179279476 -2 Left 1179279475 21:39922244-39922266 CCATCAAATGATCTGTAAAATAA 0: 1
1: 0
2: 1
3: 34
4: 478
Right 1179279476 21:39922265-39922287 AAAATCTACTTGAGTATATGAGG 0: 1
1: 0
2: 4
3: 17
4: 339
1179279474_1179279476 -1 Left 1179279474 21:39922243-39922265 CCCATCAAATGATCTGTAAAATA 0: 1
1: 0
2: 5
3: 24
4: 383
Right 1179279476 21:39922265-39922287 AAAATCTACTTGAGTATATGAGG 0: 1
1: 0
2: 4
3: 17
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179279476 Original CRISPR AAAATCTACTTGAGTATATG AGG Intronic
901912885 1:12474933-12474955 AAAATCTGCATTAGTATATTGGG - Intronic
907694259 1:56705876-56705898 AAAAGCTACTTGAATAAATTTGG - Intronic
907731975 1:57075646-57075668 AAATTCTACTTGAAGACATGGGG - Intronic
909394662 1:75156172-75156194 AAAATCTAATGGAGTTTTTGGGG + Intronic
910404372 1:86871165-86871187 ATAAGCTACATGAGAATATGAGG + Intronic
910850452 1:91645199-91645221 AAATTCTACTGGAGTCGATGGGG - Intergenic
911291465 1:96061084-96061106 AAAAACTACTTGTGTGTTTGAGG + Intergenic
913930630 1:124959484-124959506 AGAATCTACATGTGTATATTTGG - Intergenic
913930698 1:124961016-124961038 AGAATCTCCTTGTGTATATTTGG - Intergenic
913931602 1:124972845-124972867 AAAATCTGCTTGTGGATATTTGG - Intergenic
913931793 1:124977106-124977128 AGAATCTACTTGAGGATATTTGG - Intergenic
913931821 1:124977788-124977810 AGAATCTGCTTGTGTATATTTGG - Intergenic
913931986 1:124981782-124981804 AGAATCTACTTCAGGATATTTGG + Intergenic
913932019 1:124982463-124982485 AGAATCTGCTTGAGGATATTTGG + Intergenic
913932311 1:124988697-124988719 AAAATCTACTTGTGGATATTTGG - Intergenic
913932861 1:125000167-125000189 AGAATCTACTTGTGGATATTTGG + Intergenic
913933266 1:125007653-125007675 AAAATCTGCTTGTGGATATTTGG + Intergenic
913936610 1:125059884-125059906 AGAATCTGCTTGTGTATATTTGG + Intergenic
915002989 1:152610539-152610561 TAAGTTTACTTTAGTATATGGGG + Intergenic
916927363 1:169536617-169536639 AAAAACTACTTTCTTATATGTGG + Exonic
919225554 1:194695178-194695200 AATAACTTCTTGAATATATGAGG - Intergenic
919948253 1:202338625-202338647 GAAATAAACTTGATTATATGTGG - Intronic
920894604 1:210033501-210033523 AAAATTACCTTGAGAATATGAGG + Intronic
921098292 1:211905999-211906021 AATATCTACTAGTGTATATATGG - Intergenic
921655090 1:217725253-217725275 GAAATATACTTGAGAACATGTGG - Intronic
922461949 1:225820068-225820090 AAAATATACTTGGGAATGTGAGG - Intronic
1068638428 10:59374062-59374084 AAAAACTGCTTATGTATATGGGG + Intergenic
1077875912 11:6305482-6305504 TAATTCTATTTGAATATATGTGG + Intergenic
1078333413 11:10444742-10444764 AAACTCTACTTGTGTAGCTGAGG + Intronic
1078514742 11:12012048-12012070 AAAGTCTACTTGACTACAAGAGG - Intergenic
1078587188 11:12602373-12602395 AAGATCTACATAAGTATAAGGGG - Intergenic
1079597866 11:22273807-22273829 AAAATTTATTGGAGTAAATGAGG - Intronic
1079819884 11:25112941-25112963 AGAATATACTTGAAGATATGTGG + Intergenic
1083450286 11:62739610-62739632 AAAAGTTACTTTAGTATATTTGG - Intronic
1084486726 11:69452511-69452533 AAAATCTACATGAGAAACTGAGG + Intergenic
1086613926 11:88791659-88791681 AATATATACTGAAGTATATGGGG + Intronic
1087908992 11:103730940-103730962 ATTATCTACTGGAGTATATTGGG - Intergenic
1088614413 11:111610113-111610135 AAAAGCAACTTTTGTATATGTGG + Intronic
1088866586 11:113853500-113853522 AATATCTACGAGAGTATAGGAGG - Intronic
1089982240 11:122781726-122781748 TAAATCTACTTGATGATATCTGG - Intronic
1092596202 12:10007451-10007473 AACAGCTACATCAGTATATGAGG - Intronic
1094679309 12:32653634-32653656 GAAATCTATCTGAGTATTTGGGG + Intergenic
1095030979 12:37278075-37278097 AGAATCTACTTGGGGATATTTGG + Intergenic
1095031692 12:37293392-37293414 AGAATCTACTTGTGGATATTTGG + Intergenic
1095031877 12:37297143-37297165 AAAATCTGCTTGTGGATATTTGG + Intergenic
1095032434 12:37308860-37308882 AGAATCTACTTGTGGATATTTGG + Intergenic
1095032448 12:37309201-37309223 AGAATCTACTTGTGGATATTTGG + Intergenic
1095032466 12:37309711-37309733 AGAATCTACTTGTGGATATTTGG + Intergenic
1095032572 12:37311747-37311769 AAAATCTGCTTGTGGATATTTGG + Intergenic
1095033547 12:37324947-37324969 AGAATCTACTTGTGGATATTTGG + Intergenic
1095034865 12:37350258-37350280 ATAATCTGCTTGAGGATATTTGG - Intergenic
1095036045 12:37373854-37373876 AGAATCTGCTTGAGGATATTTGG - Intergenic
1095036282 12:37378939-37378961 AAAATCTGCTTGTGGATATTTGG - Intergenic
1095037070 12:37396207-37396229 AGAATCTACTTGTGAATATTTGG + Intergenic
1095037270 12:37400272-37400294 AGAATCTGCTTGTGGATATGTGG + Intergenic
1095056155 12:37603909-37603931 AGAATCCACTTGTGTATATTGGG + Intergenic
1095608517 12:44099440-44099462 TAAAAATACTTGGGTATATGTGG + Intronic
1095621189 12:44255993-44256015 AAAATCTGCTTGAGGATATGAGG - Intronic
1098355991 12:69613078-69613100 AAAATCTACCTGAGGGTTTGTGG + Intergenic
1098486493 12:71027729-71027751 AAAATCTGCTTAAGTATATCTGG + Intergenic
1099411994 12:82342323-82342345 AAATTCTACTTGAGTCACTGTGG - Intronic
1099555247 12:84102132-84102154 AGAACCTACTTGAGTATCGGGGG + Intergenic
1099629443 12:85122829-85122851 AATATTTACTTGTATATATGTGG + Intronic
1099980627 12:89597507-89597529 AAAATATACTTAAGTAAATACGG + Intronic
1100093137 12:90996906-90996928 AAAATCTACATAAGTAGTTGAGG + Intronic
1101450936 12:104778238-104778260 ATAATGTACTTGAGTATCTCTGG - Intergenic
1103842727 12:123878352-123878374 AATGTCTACTTTAGTCTATGTGG + Intronic
1105075656 13:16016647-16016669 AAAATCTACAAGTGTATATTGGG + Intergenic
1105642053 13:22275717-22275739 AAAATCTCCTTGATGATAAGAGG - Intergenic
1105875042 13:24544299-24544321 AAGATGTACTTTGGTATATGAGG + Intergenic
1106358955 13:29012348-29012370 AAAATCCACCTGAGTAGGTGGGG - Intronic
1108723335 13:53154667-53154689 GAAATTTTCTTGAGTTTATGTGG - Intergenic
1108776577 13:53772241-53772263 AAACTCTACTGGAGTCTTTGTGG + Intergenic
1109040356 13:57327396-57327418 AAAATGCACTGCAGTATATGGGG - Intergenic
1109157880 13:58934250-58934272 TAAATCCACTTGAGTTCATGAGG - Intergenic
1109936827 13:69298090-69298112 AAAATCTACTTCTATATAGGAGG + Intergenic
1111205564 13:85005232-85005254 TAAATCTATCTGAGTATATCTGG + Intergenic
1111533715 13:89574330-89574352 AAAATCCACTTGACTTTAAGTGG - Intergenic
1112316319 13:98365283-98365305 AAAATATTTTTGAGGATATGAGG - Intronic
1112602614 13:100871491-100871513 AAAATGTACATGTGTATAAGTGG + Intergenic
1113168880 13:107475502-107475524 AAAATGTACTGGATTATTTGAGG + Intronic
1113264351 13:108600931-108600953 AAAATCTTCATGAGGATAAGTGG - Intronic
1113860527 13:113482327-113482349 AAAAAATACTTGTGTATAAGTGG - Intronic
1114001717 14:18259250-18259272 AGAATCTGCTTGTGTATATTTGG - Intergenic
1114787929 14:25622373-25622395 AAAATATAATTGACTATTTGGGG - Intergenic
1115837526 14:37425383-37425405 AAAATCTACATGAGTCTAGTAGG + Intronic
1116333484 14:43625842-43625864 AAAATTTACATGAATATATGGGG - Intergenic
1117137275 14:52748437-52748459 AAGATATACTTAAGTAAATGTGG - Intronic
1118406244 14:65426513-65426535 AAAATAAACTGGATTATATGGGG + Intronic
1119596605 14:75940493-75940515 ATAACCTACTTGAGTATATCTGG - Intronic
1120100444 14:80438727-80438749 AAAATATACTTGATTGTATTAGG - Intergenic
1120317738 14:82917551-82917573 TGACCCTACTTGAGTATATGTGG + Intergenic
1120782363 14:88496780-88496802 AAAATGTCTTTGAGTATATTTGG - Intronic
1121364587 14:93297018-93297040 AAAATCTATCTGACTAAATGGGG + Intronic
1121375791 14:93409872-93409894 AAAATTTACATGAGTAGAAGGGG + Intronic
1124086907 15:26559551-26559573 AATATATACTTGAGGATTTGAGG + Intronic
1127336719 15:57993672-57993694 AACATTTACATGAGTAGATGAGG + Intronic
1127458088 15:59172796-59172818 GAAATCTACTTGGGAATTTGTGG + Intronic
1128674882 15:69601212-69601234 AAAATCTACTTGGAAATATGAGG - Intergenic
1131349458 15:91684315-91684337 AATGTTCACTTGAGTATATGGGG + Intergenic
1137095989 16:36257700-36257722 AAAATCTACAAGAGGATATTTGG - Intergenic
1139533418 16:67555830-67555852 AAAGTCTACAAGAGTATTTGGGG - Intergenic
1140101777 16:71924181-71924203 AAAATCTTCATCAGTATTTGAGG + Intronic
1141374977 16:83522366-83522388 AAAATTAACATGAGTATATGAGG + Intronic
1148429351 17:47629350-47629372 AAAATACACTTGGATATATGAGG - Intergenic
1153475703 18:5496361-5496383 AAAATGTATTTGGGTACATGTGG - Intronic
1157969844 18:52254006-52254028 AAATTATACTGGTGTATATGTGG + Intergenic
1158343496 18:56490962-56490984 TCAATCTACTTGACTACATGTGG + Intergenic
1162004994 19:7772215-7772237 AAAATCTATTTGTGAATAGGTGG + Intergenic
1164162850 19:22640497-22640519 AAACTCTACTTGATTATAGTTGG + Intronic
925866003 2:8226463-8226485 AAAATCAACATGTATATATGAGG - Intergenic
926373973 2:12208729-12208751 AAAACCTAGTTGAGTACCTGAGG + Intergenic
927020543 2:19012322-19012344 AAAATCTGCTTTAGTGTTTGAGG - Intergenic
927532917 2:23825942-23825964 AAAATCTACTTCATTAAATGGGG - Intronic
929375676 2:41283892-41283914 CAAATGTACATGATTATATGAGG - Intergenic
931082458 2:58790165-58790187 AAAATCTACATGAATGCATGTGG + Intergenic
934349517 2:92401194-92401216 AAAATCTGCTAGAGGATATTTGG + Intergenic
934352577 2:92449114-92449136 AAAATCTGCTAGAGGATATTTGG + Intergenic
934360514 2:92574846-92574868 AAAATCTGCTAGAGGATATTTGG + Intergenic
934369037 2:92711457-92711479 AAAATCTGCTAGAGGATATTTGG + Intergenic
934369316 2:92715880-92715902 AAAATCTGCTAGAGTATATTTGG + Intergenic
934375326 2:92812535-92812557 AAAATCTGCTAGAGGATATTTGG + Intergenic
934378310 2:92860114-92860136 AAAATCTGCTAGAGGATATTTGG + Intergenic
934386081 2:92985026-92985048 AAAATCTGCAAGAGTATATTTGG + Intergenic
934392965 2:93096228-93096250 AAAATCTGCTAGAGGATATTTGG + Intergenic
934398316 2:93183007-93183029 AAAATCTGCTAGAGGATATTTGG + Intergenic
934402575 2:93252632-93252654 AAAATCTGCAAGAGTATATTTGG + Intergenic
934407042 2:93324133-93324155 AAAATCTGCTAGAGGATATTTGG + Intergenic
934407464 2:93330766-93330788 AAAATCTGCTAGAGGATATTTGG + Intergenic
934408494 2:93347241-93347263 AAAATCTGCTAGAGGATATTTGG + Intergenic
934414421 2:93442362-93442384 AAAATCTGCAAGAGTATATTTGG + Intergenic
934414452 2:93442871-93442893 AAAATCTGCTAGAGGATATTTGG + Intergenic
934429352 2:93682018-93682040 AAAATCTGCTAGAGAATATTTGG + Intergenic
934431870 2:93722545-93722567 AAAATCTGCTAGAGGATATTTGG + Intergenic
934433511 2:93749374-93749396 AAAATCTGCAAGAGTATATTTGG + Intergenic
934439519 2:93846679-93846701 AAAATCTGCTAGAGGATATTTGG + Intergenic
934441950 2:93885574-93885596 AAAATCTGCTAGAGGATATTTGG + Intergenic
934446686 2:93962326-93962348 AAAATCTGCTAGAGGATATTTGG + Intergenic
934454736 2:94141958-94141980 AAAATCTGCAAGAGTATATTTGG + Intergenic
934945002 2:98534455-98534477 AAATTCTACTTCAGTATGTCTGG + Intronic
935464445 2:103379989-103380011 AAAATCTACCCAAGTATTTGAGG + Intergenic
935496739 2:103791788-103791810 AAATTATATTTGAGTAAATGGGG - Intergenic
938713272 2:133993814-133993836 AAAATCTAGTTGTGTGTCTGAGG - Intergenic
938870267 2:135468224-135468246 AACATCTTCTGGAATATATGTGG + Intronic
939414647 2:141879277-141879299 AAAATATACTTGGGTAAATAAGG + Intronic
939698670 2:145361392-145361414 AAAATGTACTTGAGACTCTGGGG - Intergenic
941465842 2:165825952-165825974 AAAATCTACTTTTGTTTCTGGGG + Intergenic
941745487 2:169082221-169082243 AAAATGTACAGGAGAATATGGGG + Intronic
942720140 2:178942084-178942106 GAAAACTACTTGAGTACATGGGG + Intronic
942843635 2:180396270-180396292 AAAATGGACCTAAGTATATGTGG + Intergenic
942900395 2:181109977-181109999 GAAATCTAATTTAGGATATGGGG + Intergenic
943355688 2:186852336-186852358 AAAAGATACATGAGTGTATGAGG - Intergenic
943570785 2:189572343-189572365 TGAATCTTCTTGTGTATATGTGG - Intronic
945331038 2:208539361-208539383 AACATATACTTTGGTATATGTGG - Intronic
945827507 2:214741995-214742017 AAATTCTACTTGAATCTATTTGG + Intronic
946127385 2:217575167-217575189 AAAATCTAATTAAATATATATGG + Intronic
946648480 2:221866378-221866400 AATATCAACTTCAGTATATAAGG + Intergenic
1169731573 20:8791802-8791824 AAAATCAACCTCAGTAAATGTGG + Intronic
1169766984 20:9157257-9157279 AAAATCTGCTTGAATATAAAAGG - Intronic
1171141093 20:22743388-22743410 AAAATCTCCTTGTGTCTCTGTGG - Intergenic
1171602775 20:26778390-26778412 AAAATCTGCTAGAGTATATTTGG + Intergenic
1171605691 20:26822237-26822259 AAAATCTGCTAGAGGATATTTGG + Intergenic
1171669881 20:27784709-27784731 AAAATCTGCTAGAGGATATTTGG + Intergenic
1171672727 20:27827191-27827213 AAAATCTGCATGAGGATATTGGG + Intergenic
1171675498 20:27868847-27868869 AAAATCTGCTAGAGGATATTTGG + Intergenic
1177152769 21:17471039-17471061 AAAAACTACATGAGAATATGAGG - Intergenic
1179279476 21:39922265-39922287 AAAATCTACTTGAGTATATGAGG + Intronic
1183233517 22:36598315-36598337 AAAACCTACTTGACTATACCTGG + Intronic
1184808226 22:46810327-46810349 TAAATCTACTCGAATATGTGTGG - Intronic
1202731828 2_KI270716v1_random:85066-85088 AAAATCTACAAGAGGATATTTGG + Intergenic
1202733738 2_KI270716v1_random:115830-115852 AAAATCTGCAAGAGTATATTTGG + Intergenic
1202734284 2_KI270716v1_random:124666-124688 AAAATCTGCAAGAGTATATTTGG + Intergenic
949126936 3:457337-457359 ATAATCTACCTTAGAATATGTGG + Intergenic
949456127 3:4240982-4241004 AAAATCTACTTCATAATATTAGG - Intronic
949722084 3:7001171-7001193 AAAATCTTTTTGTGGATATGGGG - Intronic
949737330 3:7188612-7188634 AGGATCTACTTGAGTGTATAAGG + Intronic
949793587 3:7821312-7821334 AAAATCTTTTTGAGTTTAAGAGG - Intergenic
949839697 3:8306371-8306393 AAAATCCAGTTGAGTACATTAGG - Intergenic
950768643 3:15292963-15292985 AAAATCTACTTGTGTGTGTCAGG + Intronic
951145830 3:19226042-19226064 AAATTCTTCTTGACCATATGGGG + Intronic
951431566 3:22614002-22614024 AAAATATACATGAGTATACTTGG - Intergenic
952785882 3:37154556-37154578 AAAATCAACTTGACACTATGTGG - Intronic
954471177 3:50696740-50696762 AAATTTTACTTGTGCATATGCGG - Intronic
954849444 3:53587972-53587994 AAGATCTAATTGAGTAAATTTGG - Intronic
955133849 3:56196603-56196625 AAAATCTATTTGTGTCTTTGTGG - Intronic
955313356 3:57913035-57913057 AAAATCTACTTGCTTTTAAGGGG + Intronic
955718646 3:61858221-61858243 AAAATGTACTTCTGTATTTGTGG - Intronic
955783863 3:62515389-62515411 AAACTCTACTTGAGAAGATATGG - Intronic
957258105 3:77864742-77864764 AAAATTTACTTGAATATTTTGGG + Intergenic
957499228 3:81032316-81032338 AAAATTGACTTTAGTTTATGTGG - Intergenic
957769133 3:84665666-84665688 AAAATCTACTTTTGTATGTGTGG - Intergenic
957851691 3:85815996-85816018 AAAAACTACTTGTGTATAACAGG + Intronic
958477716 3:94605908-94605930 AAAACCTCCTTGACAATATGGGG - Intergenic
958593854 3:96196605-96196627 AAAATCAACATCAGTACATGTGG + Intergenic
959296226 3:104537827-104537849 AAAATTTACTTTAGGACATGTGG - Intergenic
960651410 3:119955265-119955287 AAAATATACTTGTGCAAATGGGG - Intronic
962698223 3:137971889-137971911 AAAAATTACTTGAGTTTATCTGG - Intergenic
963664435 3:148165046-148165068 AGAATCGACTTGATTAGATGCGG - Intergenic
964489536 3:157220674-157220696 ATATTCTAATTGAGAATATGTGG - Intergenic
966138240 3:176725692-176725714 AAAAACTACGTGAGTATTTCTGG - Intergenic
966595500 3:181721664-181721686 AAAATAAACTTGAGCATATGGGG + Intergenic
966954224 3:184857199-184857221 AAAATATAATTGAATAGATGGGG + Intronic
970977808 4:22060973-22060995 AGAATCTATTAGAGTATTTGGGG + Intergenic
971164695 4:24171028-24171050 GAAAGCTATGTGAGTATATGGGG - Intergenic
971669669 4:29541600-29541622 AAAAACTACTTGGGTATTTTTGG + Intergenic
972043722 4:34638009-34638031 AAAATCTTCAAGAGGATATGAGG + Intergenic
972841736 4:42938604-42938626 AAATTCTACAAGAATATATGGGG - Intronic
973085802 4:46058588-46058610 AAAATGAAATTGAGTATAAGTGG - Exonic
973527760 4:51795590-51795612 AGAATCTGCTTGAGGATATTTGG - Intergenic
973527815 4:51796434-51796456 AGAATCTGCTTGAGGATATTTGG - Intergenic
973527896 4:51797800-51797822 AGAATCTGCTTGAGGATATTTGG - Intergenic
973527927 4:51798308-51798330 AGAATCTGCTTGAGGATATTTGG - Intergenic
973527953 4:51798645-51798667 AGAATCTGCTTGAGGATATTTGG - Intergenic
973528035 4:51800011-51800033 AGAATCTGCTTGAGGATATTTGG - Intergenic
973528066 4:51800519-51800541 AGAATCTGCTTGAGGATATTTGG - Intergenic
973528092 4:51800856-51800878 AGAATCTGCTTGAGGATATTTGG - Intergenic
973528173 4:51802222-51802244 AGAATCTGCTTGAGGATATTTGG - Intergenic
973528201 4:51802730-51802752 AGAATCTGCTTGAGGATATTTGG - Intergenic
973528223 4:51803067-51803089 AGAATCTGCTTGAGGATATTTGG - Intergenic
973528301 4:51804431-51804453 AGAATCTGCTTGAGGATATTTGG - Intergenic
973528331 4:51804939-51804961 AGAATCTGCTTGAGGATATTTGG - Intergenic
973528357 4:51805276-51805298 AGAATCTGCTTGAGGATATTTGG - Intergenic
973528436 4:51806640-51806662 AGAATCTGCTTGAGGATATTTGG - Intergenic
973528465 4:51807148-51807170 AGAATCTGCTTGAGGATATTTGG - Intergenic
973528488 4:51807485-51807507 AGAATCTGCTTGAGGATATTTGG - Intergenic
973528567 4:51808850-51808872 AGAATCTGCTTGAGGATATTTGG - Intergenic
973528597 4:51809358-51809380 AGAATCTGCTTGAGGATATTTGG - Intergenic
973528623 4:51809695-51809717 AGAATCTGCTTGAGGATATTTGG - Intergenic
973528714 4:51811228-51811250 AGAATCTGCTTGAGGATATTTGG - Intergenic
973528793 4:51812593-51812615 AGAATCTGCTTGAGGATATTTGG - Intergenic
973528823 4:51813101-51813123 AGAATCTGCTTGAGGATATTTGG - Intergenic
973528877 4:51813946-51813968 AGAATCTGCTTGAGGATATTTGG - Intergenic
973528903 4:51814283-51814305 AGAATCTGCTTGAGGATATTTGG - Intergenic
973528927 4:51814964-51814986 AGGATCTACTTGAGGATATTTGG - Intergenic
973528943 4:51815303-51815325 AGAATCTGCTTGAGGATATTTGG - Intergenic
973528959 4:51815640-51815662 AGAATCTGCTTGAGGATATTTGG - Intergenic
973528967 4:51815810-51815832 AGAATCTGCTTGAGGATATTTGG - Intergenic
973528983 4:51816150-51816172 AGAATCTGCTTGAGGATATTTGG - Intergenic
973528992 4:51816318-51816340 AGAATCTGCTTGAGGATATTTGG - Intergenic
973529001 4:51816487-51816509 AGAATCTGCTTGAGGATATTTGG - Intergenic
973529009 4:51816657-51816679 AGAATCTGCTTGAGGATATTTGG - Intergenic
973529019 4:51816822-51816844 ACAATCTGCTTGAGGATATTTGG - Intergenic
974232009 4:59128492-59128514 AAATTGTATTTGAGTATATATGG + Intergenic
974288969 4:59906454-59906476 AAAGTGTACTTGAGTATACTTGG - Intergenic
974761270 4:66277106-66277128 AAAGTCTTCTTAAGTATATTTGG - Intergenic
975071314 4:70142637-70142659 AACTTCTACTTGAGTTTATTGGG - Intronic
975148763 4:70998542-70998564 ATAAAGGACTTGAGTATATGTGG + Intronic
976077524 4:81316467-81316489 AAAGCTTACTTGAATATATGTGG - Intergenic
976199489 4:82564093-82564115 AAAACCAACTTGAGTTTGTGAGG + Intergenic
976397938 4:84577103-84577125 AAAATTTCCTAGACTATATGAGG - Intergenic
978039577 4:104042633-104042655 AAAGTTCACTTGAGTATAGGAGG + Intergenic
978045257 4:104117745-104117767 AATATCACCTTGAGTATTTGAGG + Intergenic
978305609 4:107324654-107324676 ATAAGGTACTTGAGTATCTGTGG - Intergenic
980544982 4:134247913-134247935 AAAATGTACTACAGCATATGTGG - Intergenic
980696773 4:136367171-136367193 AAAATCAACTTAAGTATACACGG + Intergenic
981733223 4:147921844-147921866 TAAAGCTACTTGAGAATAAGGGG - Intronic
982171942 4:152670751-152670773 AAGATTTACTTGTATATATGAGG - Intronic
983867921 4:172790215-172790237 AAAATATATTTGTGAATATGGGG - Intronic
988198625 5:28042248-28042270 AAAGTCTATTTGAATAAATGAGG + Intergenic
989076712 5:37571590-37571612 AAAATCCACTGGAGTGTATTAGG + Intronic
989567374 5:42914787-42914809 ATAATCTAATTGAGTTTATTGGG + Intergenic
989866450 5:46516403-46516425 AGAATCTACTTGTGGATATTTGG + Intergenic
989882086 5:46804757-46804779 AGAATCTACTTGTGGATATTTGG + Intergenic
989882924 5:46821288-46821310 AGAATCTACTTGTGGATATTTGG + Intergenic
989887895 5:46918789-46918811 AGAATCTACTTGTGGATATTTGG + Intergenic
989888785 5:46936348-46936370 AGAATCTACTTGTGGATATTTGG + Intergenic
989891356 5:46987140-46987162 AGAATCTACTTGTGGATATTTGG + Intergenic
989891589 5:46991742-46991764 AGAATCTACTTGTGGATATTTGG + Intergenic
989897459 5:47110495-47110517 AGAATCTACTTGTGGATATTTGG + Intergenic
989899299 5:47144571-47144593 AGAATCTACTTGTGGATATTTGG + Intergenic
991344195 5:65645325-65645347 AATACCTACTTCAGGATATGGGG + Intronic
991634249 5:68687535-68687557 AAAATCTGCTTGTGAAAATGGGG - Intergenic
993025052 5:82635775-82635797 ACAATCTGCTTGAGGGTATGTGG - Intergenic
993377353 5:87164873-87164895 CATATTTACTTGAATATATGAGG - Intergenic
996615093 5:125431926-125431948 AAAGTCTACTTGAGCAAAAGAGG + Intergenic
997562606 5:134861491-134861513 ATGATCTGCTTGAGAATATGGGG - Intergenic
998245262 5:140496248-140496270 AAAATCTACTTTAGGATAGGAGG - Intronic
998607935 5:143654998-143655020 AATATCTACATGAGTCTATTTGG - Intergenic
999045643 5:148466287-148466309 AAAATATAGTTGAATATATATGG + Intronic
999937630 5:156504359-156504381 TATATGTACATGAGTATATGTGG + Intronic
1000258398 5:159562397-159562419 AAAATCAACTTAAGTAAAAGAGG - Intergenic
1000787867 5:165568966-165568988 AGGATCTACTTGAATATATTGGG - Intergenic
1000940982 5:167359408-167359430 AAAAACTACTTAAGTAAATTGGG - Intronic
1202771343 5_GL000208v1_random:1039-1061 AGAATCTGCTTGTGTATATTTGG - Intergenic
1004474648 6:15960011-15960033 AAATTCTATTTGAGAATTTGGGG + Intergenic
1004781989 6:18919609-18919631 AAAATCAATTTGTGTATAGGTGG + Intergenic
1004853944 6:19730195-19730217 GAAATCTACTTGTGCAAATGTGG + Intergenic
1005704346 6:28436586-28436608 CAAATCAGCTTGAGTATATTGGG + Intronic
1005850282 6:29815678-29815700 ATAATCTAGTTGCCTATATGGGG + Intergenic
1008573909 6:52840881-52840903 AAAATGTACTTTAGGATGTGTGG + Intronic
1009414461 6:63399962-63399984 AAAAACTAATTTAGTATATTGGG - Intergenic
1009988842 6:70815739-70815761 AAAAACACCTTGAGTGTATGGGG - Intronic
1011612035 6:89161738-89161760 AAAGTCTATTTAAGTATATGTGG - Intronic
1012083543 6:94792552-94792574 AAACTCTAGTTGAGTTTCTGAGG - Intergenic
1014114243 6:117654554-117654576 ATATTCTACTTAAGTATAAGTGG - Intergenic
1014870539 6:126590730-126590752 AAAATCTACTTGTGTAAAATTGG - Intergenic
1015023316 6:128503301-128503323 AAAATGTACTTGGGAAAATGAGG - Intronic
1015027094 6:128548044-128548066 AAAAGGGACTTGAGTATCTGTGG + Intergenic
1015449436 6:133348244-133348266 AAAAACTACTTGAAGAGATGAGG - Intronic
1016397917 6:143646438-143646460 AAAATCTAATTGACTTTATTTGG + Intronic
1017478623 6:154826466-154826488 AAAATCTACTTTGGTATTCGAGG - Intronic
1020783648 7:12546867-12546889 AAAGTCTTCTTGAGGAAATGTGG + Intergenic
1020907504 7:14082126-14082148 AGAATCTACTTTAATTTATGAGG - Intergenic
1021057680 7:16070620-16070642 AAAATGTACTTTAATATATAAGG + Intergenic
1024314187 7:47999337-47999359 AAAATCTACCAGAGTAAGTGAGG - Intronic
1024692072 7:51813957-51813979 ACAATCATGTTGAGTATATGTGG - Intergenic
1029779989 7:102722121-102722143 AAAAACTACTTTAATTTATGTGG - Intergenic
1030475478 7:110027525-110027547 AAAAACTACTTTATGATATGTGG - Intergenic
1030846292 7:114416746-114416768 AAAGTATACTTGAGAATATGTGG + Intronic
1030907272 7:115201885-115201907 AAAAACTACTTGAATATATGAGG - Intergenic
1032139979 7:129319574-129319596 AAACTCTATTAGAGAATATGTGG + Intronic
1032261800 7:130344035-130344057 AAACTCTCCTTCAGTCTATGTGG + Intergenic
1033480972 7:141740030-141740052 AAAATCTACTGGAGAAGATTAGG - Intronic
1033919679 7:146374770-146374792 AAATAGTACTTGAATATATGTGG + Intronic
1033997978 7:147375683-147375705 AAAAACTACTTTAGTACTTGTGG - Intronic
1034917716 7:155054704-155054726 AAAATATACTTTAATATATTTGG - Intergenic
1035820893 8:2590235-2590257 AAAAACCACTTGAGTATATGTGG - Intergenic
1040619782 8:49078612-49078634 AAAATCTAATTGAGTCAAGGAGG - Intergenic
1047333187 8:123911105-123911127 ACAATATAGTTAAGTATATGAGG - Intronic
1050060835 9:1708147-1708169 AAAATGTATTTGAATCTATGAGG + Intergenic
1051837159 9:21353029-21353051 AAAATCAACATGTCTATATGAGG + Intergenic
1051846890 9:21462043-21462065 AAAATCAACATGTCTATATGAGG - Intergenic
1052238577 9:26244505-26244527 AAAATCTTCTTAAGTAAATTTGG - Intergenic
1052503249 9:29319742-29319764 AAATTCTGATTGAGTATATCTGG - Intergenic
1055004951 9:71495999-71496021 AAATTCAACTGGAGTATCTGAGG + Intergenic
1057193776 9:93103271-93103293 AAAATGTCCTTCAATATATGAGG + Intronic
1058272705 9:102993663-102993685 AAAGTCTACTATAGAATATGAGG - Intergenic
1058277996 9:103070893-103070915 GAAATATACTGGGGTATATGAGG + Intergenic
1059141205 9:111855056-111855078 AAGAACTAATTGATTATATGTGG - Intergenic
1059263267 9:112999998-113000020 AAATCATACTTGAGTTTATGTGG - Intergenic
1203416979 Un_KI270334v1:289-311 AGAATCTGCTTGAGGATATTTGG + Intergenic
1203417005 Un_KI270334v1:626-648 AGAATCTGCTTGAGGATATTTGG + Intergenic
1203417035 Un_KI270334v1:1134-1156 AGAATCTGCTTGAGGATATTTGG + Intergenic
1203417187 Un_KI270335v1:463-485 AGAATCTGCTTGAGGATATTTGG + Intergenic
1203417241 Un_KI270338v1:265-287 AGAATCTGCTTGAGGATATTTGG + Intergenic
1203417296 Un_KI270338v1:1109-1131 AGAATCTGCTTGAGGATATTTGG + Intergenic
1203417322 Un_KI270340v1:36-58 AGAATCTGCTTGAGGATATTTGG + Intergenic
1203417401 Un_KI270340v1:1401-1423 AGAATCTGCTTGAGGATATTTGG + Intergenic
1203407422 Un_KI270538v1:54582-54604 AGAATCTGCTTGAGGATATTTGG - Intergenic
1203409345 Un_KI270538v1:88536-88558 AGAATCTACTTGTGGATATTTGG - Intergenic
1186163081 X:6798558-6798580 AAAATATACTTTAATATCTGTGG - Intergenic
1188332082 X:28886543-28886565 AAAATGTCCTTAAGTATACGTGG + Intronic
1190035111 X:47015633-47015655 AAAATGTACTTGAAAATATTTGG + Intronic
1190040912 X:47071377-47071399 AAAAACTACTTGAGTCTCCGTGG + Intergenic
1193076080 X:77357205-77357227 AAAAAATACCTGACTATATGGGG - Intergenic
1193935033 X:87608268-87608290 AAAATCTCCTGGCGTTTATGAGG - Intronic
1194074917 X:89378998-89379020 AAAAACGTCTTGACTATATGTGG - Intergenic
1194198942 X:90931911-90931933 AATATTTACATGAGTATATTGGG + Intergenic
1194552641 X:95320450-95320472 AAAATCTGCTTAAATAAATGTGG + Intergenic
1194913991 X:99682564-99682586 AAAATCTAATTGAATAATTGGGG - Intergenic
1195550420 X:106163117-106163139 AAAATATACTTAGGTATATTTGG - Intergenic
1195914345 X:109921361-109921383 AAAATCTTCATGACTCTATGAGG + Intergenic
1197012046 X:121577114-121577136 AAAAAATACTTGAATAAATGTGG + Intergenic
1198081777 X:133246981-133247003 AAAATCTGCTTAAGTGTGTGGGG + Intergenic
1199101474 X:143805687-143805709 AAAGTGTCCTTGTGTATATGAGG + Intergenic
1200544936 Y:4508343-4508365 AATATTTACATGAGTATATTGGG + Intergenic
1200730516 Y:6733169-6733191 AAAAACGTCTTGACTATATGTGG - Intergenic
1201557532 Y:15279737-15279759 AAAATATACTTTAATATCTGAGG - Intergenic
1201614395 Y:15881321-15881343 TAAATTTCATTGAGTATATGTGG + Intergenic
1201615973 Y:15898454-15898476 TAAATTTCATTGAGTATATGTGG - Intergenic
1201736025 Y:17262519-17262541 AAAATGTATTTGAGTATATGTGG + Intergenic