ID: 1179279900

View in Genome Browser
Species Human (GRCh38)
Location 21:39925298-39925320
Sequence CCTCACAGACTGAAGTTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 1, 2: 2, 3: 19, 4: 289}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179279890_1179279900 29 Left 1179279890 21:39925246-39925268 CCTTGAGGCCCTCCTCCATGACA 0: 1
1: 0
2: 0
3: 18
4: 237
Right 1179279900 21:39925298-39925320 CCTCACAGACTGAAGTTAAATGG 0: 1
1: 1
2: 2
3: 19
4: 289
1179279891_1179279900 21 Left 1179279891 21:39925254-39925276 CCCTCCTCCATGACAATGCTGCA 0: 1
1: 1
2: 1
3: 13
4: 204
Right 1179279900 21:39925298-39925320 CCTCACAGACTGAAGTTAAATGG 0: 1
1: 1
2: 2
3: 19
4: 289
1179279896_1179279900 14 Left 1179279896 21:39925261-39925283 CCATGACAATGCTGCAGGGAGTG 0: 1
1: 0
2: 1
3: 14
4: 211
Right 1179279900 21:39925298-39925320 CCTCACAGACTGAAGTTAAATGG 0: 1
1: 1
2: 2
3: 19
4: 289
1179279889_1179279900 30 Left 1179279889 21:39925245-39925267 CCCTTGAGGCCCTCCTCCATGAC 0: 1
1: 0
2: 1
3: 11
4: 151
Right 1179279900 21:39925298-39925320 CCTCACAGACTGAAGTTAAATGG 0: 1
1: 1
2: 2
3: 19
4: 289
1179279892_1179279900 20 Left 1179279892 21:39925255-39925277 CCTCCTCCATGACAATGCTGCAG 0: 1
1: 0
2: 0
3: 32
4: 193
Right 1179279900 21:39925298-39925320 CCTCACAGACTGAAGTTAAATGG 0: 1
1: 1
2: 2
3: 19
4: 289
1179279895_1179279900 17 Left 1179279895 21:39925258-39925280 CCTCCATGACAATGCTGCAGGGA 0: 1
1: 0
2: 2
3: 16
4: 213
Right 1179279900 21:39925298-39925320 CCTCACAGACTGAAGTTAAATGG 0: 1
1: 1
2: 2
3: 19
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179279900 Original CRISPR CCTCACAGACTGAAGTTAAA TGG Intronic
907349950 1:53820748-53820770 CCTCCCAGACTCAAGTGAAGTGG + Intronic
907423004 1:54359840-54359862 CCTGACAGGCTGAGGATAAATGG + Intronic
908968985 1:69802580-69802602 ACTTACAAACTGAAGGTAAAGGG - Intronic
909450665 1:75795118-75795140 GGTCACAGACTTAGGTTAAATGG + Intergenic
909528877 1:76659111-76659133 CCTCACAGTCAAAAGTTAAGTGG + Intergenic
909712756 1:78671736-78671758 TCTTACAGACTCAAGGTAAAGGG - Intergenic
909720646 1:78765602-78765624 ACACACAGACTGAAAATAAAGGG - Intergenic
910801076 1:91146933-91146955 ACACACAGACTGAAAATAAAGGG - Intergenic
911504654 1:98733669-98733691 CCTCACAGACTCATGCTAATGGG - Intronic
913465394 1:119136466-119136488 ACTCACCGACTGAGATTAAAAGG + Intronic
915789262 1:158650141-158650163 CTTCCCAAACTGATGTTAAAGGG + Intronic
915844116 1:159245449-159245471 ACACACAGACTGAAAGTAAAGGG - Intergenic
915907963 1:159893053-159893075 ACTCTCAGACTGAAGACAAAGGG - Intronic
915981292 1:160421429-160421451 CCTCACAGGCTGAAATCAAGAGG + Intronic
916593988 1:166224909-166224931 ACACATAGACTGAAATTAAAGGG - Intergenic
917058263 1:171007565-171007587 GCTCCCAAACTGAAGCTAAAAGG + Intronic
917583483 1:176400041-176400063 CCTAAAAAACTGAAGATAAAAGG - Intergenic
918867293 1:189919151-189919173 ACCCACAGGCTGAAGGTAAATGG - Intergenic
918914997 1:190623779-190623801 TCTCCCAGGCTGAAGTTCAACGG + Intergenic
919147120 1:193650360-193650382 ACTAACAGACTGAAAATAAAAGG - Intergenic
921002574 1:211058864-211058886 ACACACAGACTGAAAATAAAGGG + Intronic
1063550009 10:7022941-7022963 ACACACAGACTGAAGGTAAAGGG + Intergenic
1063854498 10:10233348-10233370 CATCACAGATGGAAGTTAAATGG - Intergenic
1065046054 10:21748338-21748360 CCTCACATTCTGGAGTGAAATGG - Intergenic
1066979281 10:42396697-42396719 GGTCACAGACTGAAGATGAATGG + Intergenic
1068326277 10:55491856-55491878 TCTCAAACACTGAAGTTGAATGG - Intronic
1069062809 10:63912101-63912123 CCTCACAGACATTTGTTAAAAGG + Intergenic
1069122868 10:64589452-64589474 GCTGCCAGGCTGAAGTTAAATGG - Intergenic
1073139504 10:101238095-101238117 CCACACAGTCTGACGTTAGACGG + Intergenic
1073900277 10:108213281-108213303 CCTCACAAACTTGAGGTAAAAGG - Intergenic
1074226671 10:111491222-111491244 ACACATAGACTGAAGATAAAGGG - Intergenic
1074492474 10:113951531-113951553 TCTCCCAGACTGAAGTACAATGG + Intergenic
1078165396 11:8878844-8878866 CCACAGAGACAGAAGATAAATGG + Intronic
1078876220 11:15401040-15401062 ACACACAGACTGGAGGTAAAGGG - Intergenic
1082970439 11:59015134-59015156 CCACATAGACTGAAAATAAAGGG + Intronic
1084235269 11:67784074-67784096 TCTCACAGACTGAGTTAAAAAGG - Intergenic
1085248202 11:75121582-75121604 ACACACAGACTGAAAATAAAGGG + Intronic
1085369550 11:75987774-75987796 TCTCCCAGACTGGAGTAAAATGG + Intronic
1085917359 11:80905285-80905307 CCACACAAACTTAAGGTAAAGGG + Intergenic
1086756377 11:90568299-90568321 TCTCACTCACAGAAGTTAAATGG - Intergenic
1086828481 11:91529259-91529281 ACACACAGACTGAAAATAAAGGG + Intergenic
1087434914 11:98102382-98102404 TCACACAGACTGGAGTGAAACGG - Intergenic
1087460735 11:98443330-98443352 ACACACAGACTGAACATAAAAGG - Intergenic
1087494343 11:98870736-98870758 CCACACAGAATGGATTTAAATGG - Intergenic
1087720650 11:101661698-101661720 ACACACAGACTGAAAATAAATGG - Intronic
1088182109 11:107124186-107124208 ACACACAGACTGAAAATAAAGGG + Intergenic
1092585744 12:9899452-9899474 GGGCACAGACTGAAGTTGAATGG + Intronic
1093437655 12:19154816-19154838 ACTCACAGACTGTAATTAGAAGG - Intronic
1093587522 12:20858483-20858505 CTACACAGACCGAAGTTAATTGG + Exonic
1093600766 12:21019292-21019314 CTACACAGACCGAAGTTAATTGG + Exonic
1093941041 12:25054803-25054825 TCTCAAAGATTGAATTTAAAGGG - Intronic
1096289151 12:50326211-50326233 CCTCACAGAAAAAGGTTAAAGGG - Intronic
1098142636 12:67466540-67466562 ACACACAGACTGAAAATAAATGG - Intergenic
1098319286 12:69224967-69224989 CCTCACTCACTGATGTCAAATGG + Intergenic
1098934955 12:76467950-76467972 CCTCACAGAAAGAAGTTAAGTGG - Intronic
1100631419 12:96393323-96393345 CCTCACAGGCTGGAGTACAATGG - Intronic
1101099337 12:101376684-101376706 TCACCCAGACTGGAGTTAAATGG + Intronic
1101747791 12:107556970-107556992 TCGCACAGACTGAAGTGCAATGG - Intronic
1101773319 12:107771612-107771634 CCTCAGAGACAGAATTTACAAGG + Intergenic
1103722742 12:122983295-122983317 CCTCACAGACCTCAGTGAAACGG - Intergenic
1104612062 12:130236990-130237012 CCAAACAGACTGAATTTGAATGG - Intergenic
1105709890 13:22997258-22997280 TCTGTCAGACTGAAATTAAAGGG + Intergenic
1106336726 13:28790146-28790168 ACATACAGGCTGAAGTTAAAGGG - Intergenic
1106814870 13:33396498-33396520 TGTAACAGACTGAAGTTTAAAGG - Intergenic
1107555980 13:41517142-41517164 CCAAACAGACTGAGGGTAAAAGG - Intergenic
1108858665 13:54826861-54826883 ACACACAGACTGAAAATAAAGGG + Intergenic
1110888016 13:80663119-80663141 CCTTACAGACTCAAGATAAAGGG - Intergenic
1111130657 13:83970816-83970838 ACTCATAGACTGAAAATAAAGGG + Intergenic
1111180238 13:84654083-84654105 CATCACAGACTGAAGTGCACTGG + Intergenic
1111745030 13:92257588-92257610 CCTCCCAGACTGGAGTGCAATGG + Intronic
1111752291 13:92348244-92348266 ACACACAGACTGAAAATAAAGGG + Intronic
1112065550 13:95788990-95789012 CCTCCCAGAATGAAGTAAACTGG + Intronic
1112141701 13:96650898-96650920 TATCACAGACTAAAGTTAAAAGG - Intronic
1112618581 13:101031807-101031829 ACACACAGACTGAAAATAAAGGG - Intergenic
1114783499 14:25567730-25567752 ACACACAGACTGAAAATAAAGGG - Intergenic
1114865518 14:26589963-26589985 CCTCAGAGACTGAAGTGTCATGG - Intronic
1115329333 14:32178219-32178241 AGACACAGACTGAAGGTAAAGGG - Intergenic
1117634543 14:57728248-57728270 ACACACAGACTGAAAATAAAGGG - Intronic
1118994640 14:70824569-70824591 CCTCAAAGACTGATGGTCAAGGG - Intergenic
1119078108 14:71664836-71664858 CATTACAGGCTGAAGTTATATGG + Intronic
1120677090 14:87433279-87433301 AGTCACAGACTGAAGGTTAATGG + Intergenic
1121130620 14:91442803-91442825 ACACACAGACTGAAAATAAAGGG + Intergenic
1126440848 15:48686480-48686502 ACACACAGACTGAAAATAAAGGG + Intergenic
1126667680 15:51089939-51089961 ACTGACAGATTGAAGATAAATGG - Intronic
1129434335 15:75525883-75525905 TCTCCCAGACTGAAGTGAAGTGG - Intronic
1129561996 15:76579797-76579819 ACACACAGACTGAAAATAAAGGG + Intronic
1131828512 15:96339461-96339483 TCTCACAGACTGAAGGTAAAGGG - Exonic
1132007917 15:98247499-98247521 ACTCACAGGCTCAAGGTAAAGGG - Intergenic
1137091576 16:36198259-36198281 CATCATAGAATGAAGTCAAAAGG - Intergenic
1137418572 16:48310164-48310186 ACACACAGACTGAAGGTAAAGGG - Intronic
1137451598 16:48579739-48579761 TCACACAGACTGAAGGTGAAGGG + Intronic
1138864887 16:60805367-60805389 ACACACAGACTGAAAATAAAGGG + Intergenic
1140417444 16:74786108-74786130 CCTCACAATCAGAAGGTAAAAGG + Intergenic
1140997372 16:80274281-80274303 ACTCACATACTGAAGCAAAAGGG + Intergenic
1141569866 16:84928049-84928071 CCTCACAGCCTGAAGGTCAATGG - Intergenic
1144292782 17:13842492-13842514 TCTCACAGACTGGAGTAAAGTGG - Intergenic
1146598519 17:34190280-34190302 CTTGACAGAATGAAGTTAATTGG + Intergenic
1147042149 17:37727345-37727367 CCTTCCAGGCTGAAGATAAATGG + Intronic
1147445123 17:40470526-40470548 CCTCACAGAATGAAGTTTGTGGG - Intergenic
1152840517 17:82564712-82564734 CCTCACATAATGTAGTCAAATGG + Intronic
1153339390 18:3958816-3958838 CACCACAGACTAAAGTCAAACGG - Intronic
1157628371 18:49071379-49071401 TTACACAGACTGAAGTTAAGTGG - Intronic
1158094559 18:53756032-53756054 CATCACAGACTGAGGTTAGAGGG - Intergenic
1158431586 18:57392523-57392545 TCTCATAGACTGAAAATAAAGGG + Intergenic
1158684153 18:59597959-59597981 ACTCACAGCCTGAATTTCAAGGG + Intronic
1159445284 18:68535031-68535053 CTTCCCAGTCTGAAGTAAAAAGG + Intergenic
1162219031 19:9160474-9160496 CCACACTGACTGCAGTCAAAGGG - Exonic
1162666471 19:12217448-12217470 ACACACAGACTGAAAATAAAGGG - Intergenic
1165017611 19:32893169-32893191 CCATACAGACTGAAAGTAAAGGG + Intronic
1165810928 19:38611249-38611271 CCTCCCCGACTGAAGGAAAAAGG - Exonic
1166408011 19:42536663-42536685 ACACATAGACTGAAATTAAAGGG - Intronic
1168250924 19:55141521-55141543 CCTCCCAGGCTGGAGTGAAATGG + Intronic
927190559 2:20514144-20514166 CCTCACAGTCAGAAGTCCAAAGG - Intergenic
930203600 2:48566887-48566909 CGTTACAGGCTGAAGTTGAAAGG + Intronic
930212131 2:48652146-48652168 CCTCACTGATTGAAGGAAAATGG + Intronic
931534917 2:63264248-63264270 ACACACAGACTGAAAGTAAATGG + Intronic
933137519 2:78756941-78756963 CCTCCCAGACAAAAGGTAAAAGG + Intergenic
933403714 2:81831061-81831083 ACTTACAGACTGAAGGTGAAGGG + Intergenic
934256276 2:91421440-91421462 CATCACAGAATGAAATGAAATGG - Intergenic
935336589 2:102022378-102022400 CCTCACACACTGGAGTTCTAAGG - Intronic
935393278 2:102577648-102577670 ACACACAGACTGAAAATAAAGGG - Intergenic
935929854 2:108112838-108112860 CCTCAAAGATTGAAGGTAGATGG - Intergenic
936714607 2:115171319-115171341 CCACCCAGACTGGAGTTAAGTGG - Intronic
937560824 2:123221907-123221929 ACACACAGACTGAAAATAAAGGG + Intergenic
938632550 2:133183610-133183632 CCTCACAAACTACAGATAAATGG + Intronic
940503499 2:154524632-154524654 ACACACAGACTGAAAATAAAGGG - Intergenic
941065762 2:160900776-160900798 CCTCACAGACAGAACTAGAAGGG + Intergenic
942750464 2:179280730-179280752 ACACACAGACTGAAAATAAAGGG + Intergenic
943957033 2:194205753-194205775 ACCCACAGACTCAAGATAAAGGG - Intergenic
945573931 2:211506058-211506080 CCTAACAGACTTAAAGTAAAGGG + Intronic
947510693 2:230751565-230751587 CCTAACAGGCTTAACTTAAATGG + Intronic
1169453095 20:5728965-5728987 TCACCCAGACTGAAGTTCAATGG + Intergenic
1170026647 20:11895798-11895820 GCTCAAAGACTGAGGGTAAAAGG - Intronic
1172259991 20:33555804-33555826 CATCACACACTGAATTTAACTGG + Intronic
1173203968 20:40977339-40977361 ACACACAGACTGAAAATAAAGGG - Intergenic
1177494408 21:21871028-21871050 ACACACAGACTGAAAATAAAGGG - Intergenic
1179279900 21:39925298-39925320 CCTCACAGACTGAAGTTAAATGG + Intronic
1180191494 21:46166556-46166578 TCACACAGACTGAAAATAAAGGG + Intronic
1180924570 22:19544733-19544755 CCCCACAGACTGAAGTGACAGGG + Intergenic
1182071196 22:27464977-27464999 CAGCACAGTCTGAAGATAAAGGG - Intergenic
1183262822 22:36806895-36806917 CCTCAAAGGTTGGAGTTAAATGG + Intronic
1183341439 22:37283954-37283976 CCTAACATACTGAGGTTACAGGG + Intronic
949448249 3:4158846-4158868 ACACACAGACTGAAAATAAAGGG - Intronic
951504584 3:23429270-23429292 CCTCACAGAATGAATTAAAATGG - Intronic
952066209 3:29574429-29574451 ACCCACAGACTGAAAATAAAGGG - Intronic
952190109 3:31014157-31014179 CCTCATGGACTGCAGTTAAATGG - Intergenic
952726045 3:36585661-36585683 ACACACAGACTGAAAATAAAGGG + Intergenic
954987468 3:54808434-54808456 CCTCACAGATTGTAGTCAAGAGG + Intronic
956286384 3:67614622-67614644 CTTCACAGGCTGAAGGTGAAGGG + Intronic
956303417 3:67797331-67797353 CATGAGAGAATGAAGTTAAAGGG + Intergenic
956519690 3:70090081-70090103 CCTCAAAGACAGATGTAAAAAGG + Intergenic
958635302 3:96736775-96736797 CCTCACAGGGTATAGTTAAATGG + Intergenic
958976757 3:100676957-100676979 ACACACAGACTGAAAATAAATGG - Intronic
959118260 3:102203578-102203600 ACACACAGACTGAAAATAAAGGG - Intronic
959746821 3:109785166-109785188 CATCACAGACAAAATTTAAAAGG + Intergenic
960542549 3:118877695-118877717 ACACACAGACTGAAAATAAAGGG + Intergenic
961839016 3:129692355-129692377 AATCACAGACTAATGTTAAATGG + Intronic
962326549 3:134438745-134438767 CATGACAACCTGAAGTTAAATGG - Intergenic
962615257 3:137120144-137120166 ACTAATAGACTGAAGGTAAAGGG - Intergenic
962863788 3:139429350-139429372 CCTCCCAGACTGGAGTGCAATGG - Intergenic
963007958 3:140743799-140743821 CCATAGAGACTGAAGGTAAAGGG + Intergenic
964001714 3:151782622-151782644 CTTCTCAGACCGAAGTTTAATGG - Intergenic
964804314 3:160590224-160590246 ACACACAGACTGAAAATAAATGG + Intergenic
965009954 3:163074404-163074426 ACACACAGACTGAAAATAAAGGG + Intergenic
965394527 3:168146081-168146103 ACTTACAGACTGAAGATAAAGGG - Intergenic
967508680 3:190284633-190284655 ATACACAGACTGAAGGTAAAGGG - Intergenic
967609408 3:191485239-191485261 CAAGACAGACTGAAGATAAAGGG + Intergenic
967656083 3:192051484-192051506 CCTCATATACTGAGGATAAAAGG + Intergenic
970208854 4:13685821-13685843 ACACACAGACTGAATGTAAAGGG - Intergenic
971797469 4:31246553-31246575 ACACATAGACTGAAGGTAAAGGG + Intergenic
972909808 4:43800497-43800519 ACGCACAGACTGAAAATAAAGGG + Intergenic
973579578 4:52329262-52329284 ACTCACAGACTGAAAGTGAAGGG - Intergenic
973954140 4:56046827-56046849 CCTCTCACACAGCAGTTAAATGG + Intergenic
974612149 4:64230672-64230694 CCTCAGAGACTGAGGGTCAAAGG + Intergenic
976364116 4:84214038-84214060 CCAGACAGACTGGAGTAAAATGG + Intergenic
977082853 4:92555200-92555222 CCTCACTGAGTGAATATAAAAGG + Intronic
977424677 4:96852864-96852886 TCTGACAGACTGCAGTTGAAAGG + Intergenic
978461293 4:108956443-108956465 CCTCCCAGACTGGAGTGCAATGG + Intronic
979413682 4:120409409-120409431 ACACACAGACTGAAAATAAAGGG + Intergenic
979914874 4:126418980-126419002 ACTTATAGACTGAAGGTAAAGGG - Intergenic
979927512 4:126585666-126585688 ACTTACAGACTCAAGATAAAAGG + Intergenic
980001023 4:127488263-127488285 CCTCTCAGACTAAAACTAAATGG + Intergenic
980028816 4:127800426-127800448 CCTCACAGGCTGAAGTGCAGTGG - Intronic
980028866 4:127801387-127801409 CCTCACAGGCTGAAGTGCAGTGG - Intronic
980694793 4:136340862-136340884 CCTCAGAGAATGAATTGAAAAGG - Intergenic
981297813 4:143153371-143153393 ACACACAGACTGAAAATAAAGGG - Intergenic
982119412 4:152127206-152127228 TCTCACAAACTTAAGGTAAAGGG - Intergenic
982264001 4:153521715-153521737 CCACAGAGACGGAAGTAAAAGGG - Intronic
982487156 4:155979767-155979789 TCCCACAGACTTAAGGTAAAGGG - Intergenic
982661775 4:158216009-158216031 CCTCAGAGACTCAAATTAAGTGG - Intronic
983050498 4:163040525-163040547 ATTCACAGACTGAAAATAAAGGG + Intergenic
983579831 4:169297309-169297331 ACTCAAAGACTGAAAATAAAGGG + Intergenic
984207144 4:176798913-176798935 CCTCACGGAATGAAACTAAAGGG + Intergenic
986637349 5:9836169-9836191 CCTCACAAGCAGAAGGTAAAAGG - Intergenic
988876095 5:35447622-35447644 TCTCCCAGACTGAAGTTCAGTGG + Intergenic
989074578 5:37550603-37550625 ACACACAGACTGAAAATAAAGGG - Intronic
989434443 5:41394589-41394611 CCACACAGACTGAAAATACAGGG + Intronic
989436614 5:41420886-41420908 CCTCACATAATGGAGTTATATGG - Intronic
989504691 5:42214506-42214528 CCTCACAAAATGAACTGAAAAGG - Intergenic
990259946 5:54011603-54011625 CCTAAGACACCGAAGTTAAAAGG + Intronic
990483548 5:56235428-56235450 CTTCTCAGACTGAGGTGAAAAGG - Intergenic
990853996 5:60242110-60242132 ACACACAGACTGAAACTAAAAGG + Intronic
991612023 5:68459338-68459360 CCTTACAGACTGAGGATTAAAGG - Intergenic
993268998 5:85768958-85768980 ACACATAGACTGAAATTAAAGGG - Intergenic
994309836 5:98256693-98256715 ACACACAGACTGAAAATAAAGGG - Intergenic
994685935 5:102952250-102952272 CCTCACAGACAGAACTCAAAAGG - Intronic
995730734 5:115238963-115238985 CCTCACAGAATGAATTTGAATGG + Intronic
996659631 5:125986284-125986306 ACACACAGACTGAAAATAAAGGG - Intergenic
997814693 5:137004770-137004792 CCACCCAGATGGAAGTTAAAAGG + Intronic
998986915 5:147769049-147769071 CCTCAAATACAGAAGTTAAAGGG + Intronic
999002232 5:147936909-147936931 ACACACAGACTGAAAATAAAGGG - Intergenic
1000721737 5:164716869-164716891 TCTCACAGACTGGAGTGCAATGG + Intergenic
1001253098 5:170163670-170163692 TCCCACAGAATGAAGTGAAAAGG + Intergenic
1002408444 5:179054483-179054505 CCTTACAGGCTGAAGTTACCAGG - Intergenic
1003139652 6:3459350-3459372 CCTCTAAAACTGAAGCTAAAAGG + Intergenic
1004544677 6:16586526-16586548 CCTCACAGACTGCAGTGGAGTGG - Intronic
1004858216 6:19773256-19773278 CTAGACAGATTGAAGTTAAATGG - Intergenic
1005754520 6:28914173-28914195 CCTCCCAGGCTGGAGTGAAATGG + Intronic
1006172352 6:32101036-32101058 CCTCTCAGGCTGAAGTGAAGTGG - Intronic
1008089478 6:47279017-47279039 CTTCACAGTCTGAAGGAAAAAGG + Intronic
1008707357 6:54179265-54179287 ACTCACAGAGTGAAAATAAAGGG - Intronic
1008751836 6:54744106-54744128 ACACACAGACTGAAAGTAAAGGG - Intergenic
1009282223 6:61767322-61767344 ACACACAGACTGAAAATAAAGGG - Intronic
1009603577 6:65836594-65836616 CCTTACAGAATGAAGATAATGGG + Intergenic
1009748348 6:67849300-67849322 ACACATAGACTGAAGATAAATGG + Intergenic
1010061910 6:71633073-71633095 ACACACAGACTGAAACTAAAGGG - Intergenic
1010393496 6:75363524-75363546 ACTGACAGTCTGATGTTAAAGGG - Intronic
1010456885 6:76066338-76066360 ACTCATAGACTGAAGCTAAAGGG + Intronic
1011486583 6:87848535-87848557 CCTCACAGAGTTAAGAGAAAAGG + Intergenic
1012521455 6:100126322-100126344 GCTTACAGCCTGAAGGTAAAAGG + Intergenic
1012536598 6:100305814-100305836 CCCCACAGACTGAAGGTCATAGG + Intergenic
1013934307 6:115574683-115574705 CATCACAGACTGGTGTTAGAAGG + Intergenic
1014022603 6:116608306-116608328 ACTCACAGGCTCAAGGTAAAGGG + Intergenic
1014118683 6:117697431-117697453 ACACACAGACTGAAAATAAAGGG + Intronic
1015126472 6:129760689-129760711 CCTCACAGACCCAAGTTTAATGG + Intergenic
1016544822 6:145209274-145209296 CCTTCAAGACTGAAGTCAAATGG + Intergenic
1017161635 6:151371109-151371131 TCTGACACACTGGAGTTAAAGGG + Intronic
1018489907 6:164280993-164281015 TCTCCCAGGCTGAAGTTCAATGG - Intergenic
1018654085 6:166016153-166016175 CATAAAAGACTGAAGATAAATGG + Intergenic
1020450123 7:8312180-8312202 TCTTACAGACTCAAGGTAAAGGG - Intergenic
1020462690 7:8442538-8442560 CCTCACACATTGACTTTAAAAGG + Intronic
1021587120 7:22221331-22221353 CCTCACAGATTGAAGTTAAATGG - Intronic
1021768726 7:23976828-23976850 ACACACAGACTGAAGGTGAAGGG - Intergenic
1022226220 7:28366411-28366433 CCTCACATACACAAGTTAAATGG - Intronic
1022960283 7:35419475-35419497 ACTCACTTACTGAAGCTAAAAGG + Intergenic
1023284026 7:38600744-38600766 ACTGACAAACTGAATTTAAAAGG - Intronic
1023947660 7:44816461-44816483 TCTCACAGGCTGAAGTACAATGG + Intronic
1024270601 7:47638618-47638640 ACTCTCAGACTGCTGTTAAAGGG - Intergenic
1026774706 7:73224060-73224082 CCTCCCAGACCACAGTTAAAGGG + Intergenic
1027015565 7:74777451-74777473 CCTCCCAGACCACAGTTAAAGGG + Intronic
1027072467 7:75168506-75168528 CCTCCCAGACCACAGTTAAAGGG - Intergenic
1027987010 7:85306103-85306125 AATCACAGAATGAACTTAAAGGG + Intergenic
1028033369 7:85947789-85947811 ACACACAGACTGAAAATAAAGGG - Intergenic
1028036997 7:85997036-85997058 GCACACAGACTGAAAATAAAGGG - Intergenic
1028339274 7:89697760-89697782 ACACACAGACTGAAAATAAAGGG + Intergenic
1029867137 7:103645405-103645427 ACTTACAGACTAAAGATAAAGGG + Intronic
1031426857 7:121615685-121615707 CTTTACAGACTGAAGGTTAAAGG + Intergenic
1033195459 7:139323627-139323649 CCACACAGACTGGAGTTCAGTGG + Intergenic
1035143962 7:156794384-156794406 CCTTACAGACTTAAGGTCAAAGG - Intronic
1036913615 8:12783130-12783152 ACACACAGACTGAAAGTAAAGGG - Intergenic
1038223076 8:25629127-25629149 CCACACAGACTGAAGTGCAGTGG - Intergenic
1038618143 8:29114940-29114962 CCTCACAGACTCATGAGAAAAGG + Intronic
1039420918 8:37439215-37439237 ACACACAGACTGAAAATAAAGGG - Intergenic
1039623241 8:39021320-39021342 TCTCCCAGACTGGAGTGAAATGG + Intronic
1039866494 8:41508884-41508906 CCTTGCAGACTGAAGAAAAATGG - Intronic
1040486039 8:47872563-47872585 CCACACAGATTGAAAATAAAGGG + Intronic
1041943682 8:63417999-63418021 CCTCAGAGACTGAATTTCTATGG + Intergenic
1042726586 8:71885498-71885520 ACTCATAGACTGAAAATAAAGGG - Intronic
1044244908 8:89931839-89931861 CCTCCCAGGCTGGAGTGAAATGG - Intergenic
1044564218 8:93646174-93646196 CCACACTGACTGCAGTCAAAGGG - Intergenic
1045590199 8:103585006-103585028 ACACACAGACTGAAAATAAAGGG + Intronic
1045945571 8:107791339-107791361 ACACAGAGACTGAAGGTAAAAGG + Intergenic
1046449607 8:114371100-114371122 TCACACAGGCTGGAGTTAAATGG - Intergenic
1049186695 8:141258849-141258871 TCTCGCAGACTGGAGTTCAATGG - Intronic
1051545953 9:18275194-18275216 CCTCTAATAATGAAGTTAAAAGG + Intergenic
1051857527 9:21586058-21586080 CCTCACAGACAGAAGTTTTGGGG - Intergenic
1053027522 9:34742287-34742309 CCTCACAAACTCAAGTTCAGAGG + Intergenic
1056920977 9:90789037-90789059 CCTGAGGCACTGAAGTTAAAGGG - Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1058030396 9:100190246-100190268 TCTTACAGACTCAAGGTAAAGGG - Intronic
1059926801 9:119217977-119217999 CCTCCCAGACCCAGGTTAAAAGG + Intronic
1060861212 9:126956319-126956341 CCTCAGGGACTGAAGTTGGATGG + Intronic
1185654992 X:1677486-1677508 CCTCCCAGGCTGGAGTTCAATGG + Intergenic
1186733251 X:12432899-12432921 CATAAAAGACTGTAGTTAAAAGG - Intronic
1187818929 X:23264611-23264633 CATAACAAACTGCAGTTAAAGGG - Intergenic
1188371671 X:29377223-29377245 CCCCACAGACTCAAAGTAAAGGG - Intronic
1188712531 X:33418172-33418194 ACTTATAGACTGAAGGTAAAGGG + Intergenic
1188733803 X:33686408-33686430 ACACACAGACTGAAATTAAAGGG - Intergenic
1188998864 X:36920995-36921017 ACACACAGACTGAAAATAAAAGG - Intergenic
1189018978 X:37314931-37314953 CCTCCCACACTGAAGTGGAAAGG - Intergenic
1189505546 X:41609960-41609982 GCTTACAGACTGCAGTGAAAAGG - Exonic
1191115235 X:56845283-56845305 CCTCTGAGACTGAAATTAAGTGG - Intergenic
1192300131 X:69892126-69892148 CTTCACAGTCTGGAGTTATAAGG + Intronic
1192406341 X:70890058-70890080 ACACACAGACTGAAAATAAAGGG + Intronic
1193254461 X:79330560-79330582 CCTCATAGAATGAATTTGAAAGG + Intergenic
1193428237 X:81367611-81367633 TCTCCCAGGCTGAAGTTAAGTGG + Intergenic
1193471149 X:81906203-81906225 TCTCACAGACTGAAGGTAAAGGG - Intergenic
1193665657 X:84312633-84312655 CCACATAGACTGAAAATAAAGGG + Intergenic
1193699833 X:84747233-84747255 GGGCACAGACTGAAGATAAATGG - Intergenic
1193721778 X:84995417-84995439 ACACATAGACTGAAGGTAAAAGG + Intergenic
1193821266 X:86168401-86168423 ACACAAAGACTGAAGCTAAAGGG - Intronic
1194147128 X:90278726-90278748 CCTCACAGACAGAGGGTACAAGG - Intergenic
1194218561 X:91163942-91163964 ACACACAGACTGAAAATAAAGGG - Intergenic
1197310836 X:124903310-124903332 CATCCCAGAATGCAGTTAAAAGG + Intronic
1197527398 X:127579115-127579137 ACACACAGACTGAAATGAAAAGG - Intergenic
1198127080 X:133656041-133656063 CTTCATAGAATGATGTTAAATGG - Intronic
1199095964 X:143738963-143738985 ACACATAGACTGAAATTAAAGGG + Intergenic
1199415335 X:147575642-147575664 ACACACAGACTGAAGACAAAGGG + Intergenic
1199442761 X:147887222-147887244 ACACACAGACTGAAAATAAAGGG - Intergenic
1200379762 X:155822507-155822529 ACACACAGACTGAAAATAAAGGG + Intergenic
1200493531 Y:3855494-3855516 CCTCACAGACAGAGGGTACAAGG - Intergenic
1200555074 Y:4627699-4627721 ACACACAGACTGAAAATAAAGGG - Intergenic