ID: 1179281742

View in Genome Browser
Species Human (GRCh38)
Location 21:39939616-39939638
Sequence CAGCACCAGGAGAATTGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179281742_1179281747 1 Left 1179281742 21:39939616-39939638 CCTGTCCAATTCTCCTGGTGCTG No data
Right 1179281747 21:39939640-39939662 GTGGCCTGGAGACATGTGATTGG No data
1179281742_1179281750 16 Left 1179281742 21:39939616-39939638 CCTGTCCAATTCTCCTGGTGCTG No data
Right 1179281750 21:39939655-39939677 GTGATTGGAATGGCAGAAGATGG No data
1179281742_1179281749 6 Left 1179281742 21:39939616-39939638 CCTGTCCAATTCTCCTGGTGCTG No data
Right 1179281749 21:39939645-39939667 CTGGAGACATGTGATTGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179281742 Original CRISPR CAGCACCAGGAGAATTGGAC AGG (reversed) Intergenic
No off target data available for this crispr