ID: 1179281961

View in Genome Browser
Species Human (GRCh38)
Location 21:39941377-39941399
Sequence CCTGGGAAGCAGCTATCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179281961_1179281970 14 Left 1179281961 21:39941377-39941399 CCTTGGGATAGCTGCTTCCCAGG No data
Right 1179281970 21:39941414-39941436 CTTGTGCCAATGTTCTTTGGTGG No data
1179281961_1179281968 11 Left 1179281961 21:39941377-39941399 CCTTGGGATAGCTGCTTCCCAGG No data
Right 1179281968 21:39941411-39941433 TGCCTTGTGCCAATGTTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179281961 Original CRISPR CCTGGGAAGCAGCTATCCCA AGG (reversed) Intergenic
No off target data available for this crispr