ID: 1179282076

View in Genome Browser
Species Human (GRCh38)
Location 21:39942314-39942336
Sequence CCCTTGGATGACTATGTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179282072_1179282076 8 Left 1179282072 21:39942283-39942305 CCAGGCAGTGACTCAGGGATGCA No data
Right 1179282076 21:39942314-39942336 CCCTTGGATGACTATGTCTTTGG No data
1179282071_1179282076 12 Left 1179282071 21:39942279-39942301 CCATCCAGGCAGTGACTCAGGGA No data
Right 1179282076 21:39942314-39942336 CCCTTGGATGACTATGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179282076 Original CRISPR CCCTTGGATGACTATGTCTT TGG Intergenic
No off target data available for this crispr