ID: 1179284989

View in Genome Browser
Species Human (GRCh38)
Location 21:39969646-39969668
Sequence GGGCCTCGTTGTTGGCACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179284983_1179284989 -5 Left 1179284983 21:39969628-39969650 CCCAGAACCTGCCAGCCTGGGCC No data
Right 1179284989 21:39969646-39969668 GGGCCTCGTTGTTGGCACTGTGG No data
1179284984_1179284989 -6 Left 1179284984 21:39969629-39969651 CCAGAACCTGCCAGCCTGGGCCT No data
Right 1179284989 21:39969646-39969668 GGGCCTCGTTGTTGGCACTGTGG No data
1179284980_1179284989 23 Left 1179284980 21:39969600-39969622 CCAAGGCAGGTGTAGCACAGCGA No data
Right 1179284989 21:39969646-39969668 GGGCCTCGTTGTTGGCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179284989 Original CRISPR GGGCCTCGTTGTTGGCACTG TGG Intergenic
No off target data available for this crispr