ID: 1179285351

View in Genome Browser
Species Human (GRCh38)
Location 21:39973200-39973222
Sequence CAGGGGAGACAGATGCAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179285351_1179285362 -3 Left 1179285351 21:39973200-39973222 CCGCCCTGCATCTGTCTCCCCTG No data
Right 1179285362 21:39973220-39973242 CTGGGGTGGCCTACAGAGGCAGG No data
1179285351_1179285363 3 Left 1179285351 21:39973200-39973222 CCGCCCTGCATCTGTCTCCCCTG No data
Right 1179285363 21:39973226-39973248 TGGCCTACAGAGGCAGGTAAAGG No data
1179285351_1179285366 23 Left 1179285351 21:39973200-39973222 CCGCCCTGCATCTGTCTCCCCTG No data
Right 1179285366 21:39973246-39973268 AGGAAACCGCTCTTGGTGCTTGG No data
1179285351_1179285358 -7 Left 1179285351 21:39973200-39973222 CCGCCCTGCATCTGTCTCCCCTG No data
Right 1179285358 21:39973216-39973238 TCCCCTGGGGTGGCCTACAGAGG No data
1179285351_1179285365 16 Left 1179285351 21:39973200-39973222 CCGCCCTGCATCTGTCTCCCCTG No data
Right 1179285365 21:39973239-39973261 CAGGTAAAGGAAACCGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179285351 Original CRISPR CAGGGGAGACAGATGCAGGG CGG (reversed) Intergenic
No off target data available for this crispr