ID: 1179285904

View in Genome Browser
Species Human (GRCh38)
Location 21:39977134-39977156
Sequence CCTTCTCTGCAGGAGCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179285896_1179285904 8 Left 1179285896 21:39977103-39977125 CCTTGATAAGGAGGGTTGCTTGG No data
Right 1179285904 21:39977134-39977156 CCTTCTCTGCAGGAGCAGACTGG No data
1179285895_1179285904 9 Left 1179285895 21:39977102-39977124 CCCTTGATAAGGAGGGTTGCTTG No data
Right 1179285904 21:39977134-39977156 CCTTCTCTGCAGGAGCAGACTGG No data
1179285894_1179285904 15 Left 1179285894 21:39977096-39977118 CCTGGTCCCTTGATAAGGAGGGT No data
Right 1179285904 21:39977134-39977156 CCTTCTCTGCAGGAGCAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179285904 Original CRISPR CCTTCTCTGCAGGAGCAGAC TGG Intergenic
No off target data available for this crispr