ID: 1179288307

View in Genome Browser
Species Human (GRCh38)
Location 21:39996840-39996862
Sequence CCTTCTCTGCAGGAGCACCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179288307_1179288313 16 Left 1179288307 21:39996840-39996862 CCACGGTGCTCCTGCAGAGAAGG No data
Right 1179288313 21:39996879-39996901 CTCTCCCTAATACCAGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179288307 Original CRISPR CCTTCTCTGCAGGAGCACCG TGG (reversed) Intergenic
No off target data available for this crispr