ID: 1179292422

View in Genome Browser
Species Human (GRCh38)
Location 21:40030370-40030392
Sequence GTGGAGAAGCAAATCCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 325}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179292419_1179292422 -3 Left 1179292419 21:40030350-40030372 CCGACTGTGGTGAGTGCTGGGTG 0: 1
1: 0
2: 1
3: 19
4: 199
Right 1179292422 21:40030370-40030392 GTGGAGAAGCAAATCCAGGAAGG 0: 1
1: 0
2: 1
3: 26
4: 325
1179292418_1179292422 -2 Left 1179292418 21:40030349-40030371 CCCGACTGTGGTGAGTGCTGGGT 0: 1
1: 0
2: 2
3: 15
4: 206
Right 1179292422 21:40030370-40030392 GTGGAGAAGCAAATCCAGGAAGG 0: 1
1: 0
2: 1
3: 26
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179292422 Original CRISPR GTGGAGAAGCAAATCCAGGA AGG Intronic
900225244 1:1529915-1529937 CTGGAAAAGCAAAACCAGGTTGG + Intronic
900546440 1:3231825-3231847 GTGGAGAAGCTGAACCAGGAAGG - Intronic
900643390 1:3697876-3697898 GTGGAGAAGGCGGTCCAGGACGG - Intronic
901943626 1:12683416-12683438 GTGGAGAGGAAAAGGCAGGAGGG + Intergenic
903364255 1:22796235-22796257 GGGGAGAAACAAATCAGGGAAGG + Intronic
905186397 1:36200091-36200113 GTGAGGAGGCAAGTCCAGGAGGG - Intergenic
906299275 1:44670362-44670384 GTGCAGAAGTAAATCCCTGAAGG - Intronic
906777207 1:48540548-48540570 GAGGAGAAGAATATCCTGGAGGG - Intronic
907208305 1:52794941-52794963 GTTTAGAATCAACTCCAGGAGGG - Intronic
909949444 1:81702466-81702488 AGGAAGAAGAAAATCCAGGATGG + Intronic
910458929 1:87427253-87427275 CTGGAGAAGCAAATGCAACAAGG - Intergenic
913155453 1:116092642-116092664 GTGGAGGGGCAAAGCCAGGTTGG + Intergenic
913975483 1:143451459-143451481 GTGGAGAAGGAAACCAAGGCCGG - Intergenic
913984585 1:143553333-143553355 CTGGAGAAGCAAATAGAAGAAGG + Intergenic
914069876 1:144277075-144277097 GTGGAGAAGGAAACCAAGGCCGG - Intergenic
914109279 1:144689279-144689301 GTGGAGAAGGAAACCAAGGCCGG + Intergenic
914316211 1:146514152-146514174 CTGGAGAAGCAAATGCAACAAGG - Intergenic
914498144 1:148219209-148219231 CTGGAGAAGCAAATGCAACAAGG + Intergenic
915167578 1:153957128-153957150 GTGGGGAGGCAAATCTGGGAGGG - Intronic
915559933 1:156681272-156681294 GTGGAGTGGCCAGTCCAGGATGG + Intergenic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
915895369 1:159807748-159807770 GAGGAGAAGCCAATCTAGGCTGG + Intronic
916651234 1:166836476-166836498 GTGGACAAGGAAATCCTAGATGG - Intergenic
916821061 1:168399308-168399330 GTGGAGAAAGAAATGAAGGATGG - Intergenic
917332314 1:173894306-173894328 GTGAATCAGAAAATCCAGGAAGG + Exonic
917535065 1:175868458-175868480 GTGGAGAAGAAAATGGATGATGG - Intergenic
918308757 1:183270498-183270520 GTGGAAATGCATTTCCAGGATGG + Intronic
918753737 1:188308382-188308404 ATAAAGAAGCAAATCCAGAATGG - Intergenic
920893424 1:210018044-210018066 TAGGAGAGGCTAATCCAGGATGG + Intronic
921180372 1:212626945-212626967 CTGGCGAACCAAAGCCAGGAAGG - Intergenic
923352172 1:233119081-233119103 GTGCAAAAGCAATTCGAGGAAGG + Intronic
923415218 1:233749948-233749970 GTGGTGAGGCCAATCCTGGAAGG + Intergenic
1068856556 10:61803846-61803868 GTGGAGAAGAAAAGCCAGATTGG - Intergenic
1069595313 10:69666397-69666419 GTGGGGAAGGAAATCCAGAGGGG - Intergenic
1069649226 10:70031978-70032000 GTGTAGAAGAAAATACAGAAAGG + Intergenic
1069836463 10:71311620-71311642 AGGAAGAAGCAAATGCAGGAAGG + Intergenic
1069925196 10:71845303-71845325 GAGGAAAAACAAGTCCAGGAAGG + Intronic
1070092032 10:73296391-73296413 GTAGAGAAGAAAAACAAGGAAGG + Intronic
1071185510 10:83039625-83039647 GTGGAGAAGGAATTAAAGGAGGG - Intergenic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071964507 10:90838489-90838511 GTGGAGAATGAAATGGAGGAGGG - Intronic
1072807178 10:98430987-98431009 TTGGAGAATCAAATCTGGGAAGG + Intronic
1073445218 10:103576356-103576378 GTAGGGGAGCAGATCCAGGAGGG + Intronic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1073895240 10:108148672-108148694 ATGGGGAAGAACATCCAGGAAGG + Intergenic
1074180576 10:111059437-111059459 GTGGAGATGCATCTCCAGGAGGG + Intergenic
1074432949 10:113409018-113409040 GAGGACAGGCAACTCCAGGATGG - Intergenic
1074532241 10:114305639-114305661 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074532268 10:114305726-114305748 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074532292 10:114305816-114305838 GAGGGGAGGCAGATCCAGGAGGG + Intronic
1074532403 10:114306211-114306233 GAGGAGATGCAGATGCAGGAGGG + Intronic
1074532426 10:114306301-114306323 GAGGGGACGCAGATCCAGGAGGG + Intronic
1074599863 10:114902572-114902594 CTGGAGAAAAAAATCCAGGAAGG + Intergenic
1076939261 10:133590750-133590772 GTGGAGCAGAAGATGCAGGAAGG - Intergenic
1077677997 11:4214497-4214519 ATGTATAAGCAATTCCAGGAAGG - Intergenic
1077853269 11:6096231-6096253 GTGGAGAGGCAAAGCCAGGTGGG - Intergenic
1079091113 11:17480857-17480879 GTGGGGAAGGAAATCCAAGAAGG + Intergenic
1079689243 11:23401747-23401769 TAGGAGAAGCAAAACTAGGATGG - Intergenic
1080957087 11:37110766-37110788 GTGGAGAAATAATTTCAGGAGGG + Intergenic
1081623445 11:44632772-44632794 GTGGACAAGTAAATCTGGGAAGG + Intergenic
1082171693 11:49012575-49012597 GGGTAGAAGAAAATCCAGAATGG + Intergenic
1083049394 11:59763414-59763436 CTGGAGAAGCAAAAGCAGGTAGG + Intronic
1083574328 11:63778643-63778665 GTGGAGAAGGAAATGCAGAAAGG + Intergenic
1084532525 11:69736611-69736633 GTGGAAAAGCAGATCCATGCTGG + Intergenic
1084704601 11:70808772-70808794 GTGGAGACAGAAATCCAGGAAGG + Intronic
1084839617 11:71834583-71834605 CTGGAGAAGAAAACACAGGATGG + Intronic
1085015903 11:73173919-73173941 TAGGAGAATCAGATCCAGGATGG + Intergenic
1085176316 11:74491584-74491606 TTGGGGAATCAAACCCAGGAAGG + Intergenic
1085869107 11:80328397-80328419 GGGGAGAAAGGAATCCAGGAAGG - Intergenic
1086079757 11:82890865-82890887 TTGGAGGAGGAAAACCAGGAGGG - Intronic
1086694076 11:89823374-89823396 GGGTAGAAGAAAATCCAGAATGG - Intergenic
1086712071 11:90021195-90021217 GGGTAGAAGAAAATCCAGAATGG + Intergenic
1087881933 11:103426364-103426386 GTGGAGATCCTAATCCAGCAAGG - Intronic
1088011896 11:105013790-105013812 ATGGAGGAGCAAATGAAGGATGG - Intronic
1088510328 11:110566848-110566870 GTAGAGAAATAAAACCAGGAAGG - Intergenic
1089690424 11:120183711-120183733 GCGGGGTGGCAAATCCAGGAGGG - Intronic
1090049053 11:123361160-123361182 GTGGAAAAGCAAAGGCTGGAAGG - Intergenic
1090087485 11:123663388-123663410 ATGGATAACGAAATCCAGGATGG - Intergenic
1091779269 12:3203821-3203843 GTGGAGGAGCAGGTGCAGGAGGG + Intronic
1092542146 12:9426670-9426692 GGGGAGAAGGAAAGCAAGGAGGG + Intergenic
1092648032 12:10601048-10601070 TTGACGAAGCCAATCCAGGATGG - Intergenic
1094039586 12:26109171-26109193 TTGGAGGAGATAATCCAGGAGGG - Intergenic
1094510866 12:31095763-31095785 GGGGAGAAGGAAAGCAAGGAGGG - Intronic
1096933875 12:55247427-55247449 CTTGAGATGCAAATCCAGTAGGG - Exonic
1099424034 12:82501021-82501043 CTGGGGCAGAAAATCCAGGAAGG + Intergenic
1101720425 12:107345994-107346016 GTGAGGAAGCAGACCCAGGAAGG + Intronic
1104741270 12:131176573-131176595 GTGGAGGAGAAAAGCCAGGTAGG - Intergenic
1106218286 13:27722293-27722315 GGGGAGAAGCAAATGAAAGAAGG - Intergenic
1106233193 13:27838613-27838635 GTGCAGAAGCAATTCAATGAAGG - Intergenic
1107566959 13:41614721-41614743 CTGATGAAGCAACTCCAGGAGGG + Intronic
1108499942 13:51060675-51060697 GTGGGGACACAAATCCAGGTCGG - Intergenic
1109265774 13:60198638-60198660 ATGGAAAAACAAATCCTGGATGG - Intergenic
1109650507 13:65319013-65319035 TTGTAGAAACAAATACAGGAAGG - Intergenic
1114604881 14:23988617-23988639 GTGGACAAGCAGATGCAGAAGGG + Intronic
1115379232 14:32715382-32715404 GTGGAGAACCAAATAAAGGGAGG + Intronic
1118485425 14:66210210-66210232 GGGGAGCAGCAAATGCAGGGAGG + Intergenic
1120233871 14:81868547-81868569 GTGGAGAGGCAACTACATGAAGG + Intergenic
1122036308 14:98951557-98951579 GTGCAGAAGCAAGGCCAGGATGG + Intergenic
1122290665 14:100678758-100678780 CTGGAGCAGGAAAGCCAGGAGGG + Intergenic
1126341210 15:47642899-47642921 ATGGAGAAGGAAATGCGGGAAGG + Intronic
1127756544 15:62097821-62097843 GAGGACCAGCAAACCCAGGAGGG + Intergenic
1128810039 15:70564019-70564041 GGAGAGAAGCAAATGCAGCATGG + Intergenic
1128859382 15:71053087-71053109 GTAGAGAATCAACTTCAGGAGGG + Intronic
1130133426 15:81162057-81162079 GTGGAGAAGCAAATCTACCAGGG - Intronic
1130328517 15:82901262-82901284 GTGGAGAAGCAAAGCTGAGATGG + Intronic
1130632709 15:85584971-85584993 ATGGTCAAGCAAATACAGGAAGG - Intronic
1132725346 16:1335987-1336009 GTGGAGAGGAAAATGCAGGGAGG + Intronic
1133825652 16:9275854-9275876 GAGGAGAAGCATTTCCAGAAGGG + Intergenic
1134099090 16:11439108-11439130 GTGGAGAAAGACATCCAGGTGGG - Intronic
1135165385 16:20134477-20134499 GTGGAGCAGCAGATCCAGATTGG + Intergenic
1135462067 16:22653285-22653307 GAAGAGAAGAAAACCCAGGAGGG - Intergenic
1137028097 16:35498529-35498551 GGGGAGAAGCGAATCCAAAAAGG + Intergenic
1137547266 16:49413036-49413058 GTGGAGAAGTATCTCCAGGCAGG - Intergenic
1137778253 16:51074510-51074532 TTGGAGTATCAATTCCAGGAAGG + Intergenic
1140468466 16:75200891-75200913 GTGAAGTAGAAAATGCAGGAGGG + Intergenic
1140813637 16:78601138-78601160 ATGGAGAGGCAAACCCAGGTTGG + Intronic
1141518135 16:84559883-84559905 GGGGAGAAGCAACTGGAGGAGGG + Intergenic
1142648345 17:1329689-1329711 GAGGAGAAGCAACTCCGGCATGG + Intergenic
1142902885 17:3024221-3024243 GAGGAGGAGAAATTCCAGGAAGG + Intronic
1143121386 17:4609450-4609472 CATGAGAAGAAAATCCAGGAAGG + Intergenic
1143673710 17:8414993-8415015 GGGGAGAAACCAATCCAAGAGGG - Intronic
1143928776 17:10398481-10398503 GTGGAGAACCAAATACGAGACGG - Exonic
1143951381 17:10635404-10635426 GTGGAGAACCAAATACGAGACGG - Exonic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1145272342 17:21411422-21411444 GCAGTGAAGCAAACCCAGGAGGG - Intronic
1145283133 17:21482861-21482883 GTGGAGGAGCAAATGCAGGGAGG - Intergenic
1145310548 17:21698887-21698909 GCAGTGAAGCAAACCCAGGAGGG - Intronic
1145394349 17:22482939-22482961 GTGGAGGAGCAAATGCAGGGAGG + Intergenic
1147464905 17:40603444-40603466 GTGAAGAAGCCAAGCCAGAAGGG + Intergenic
1147488437 17:40841116-40841138 GTTGAGAAGCTGTTCCAGGAAGG + Intergenic
1147635361 17:41960692-41960714 CTGGAGTTGCCAATCCAGGAGGG - Intronic
1148588965 17:48801221-48801243 GTGGAGAAGGAAGTACAGGGCGG + Intronic
1149535299 17:57429107-57429129 GAGGACACGCAGATCCAGGAAGG - Intronic
1150727879 17:67666353-67666375 GGGGAGAAGGAACTTCAGGAAGG + Intronic
1150861083 17:68801851-68801873 GTTTAGCTGCAAATCCAGGAGGG - Intergenic
1151095307 17:71490736-71490758 ATGTAGAGGGAAATCCAGGAGGG - Intergenic
1152675376 17:81637411-81637433 GTAGAGAAACAATTTCAGGAAGG + Intronic
1152914163 17:83024328-83024350 GTGGAGCAGCACCTCTAGGAGGG - Intronic
1153162143 18:2218659-2218681 CTGGAGAAGCAAATGCTGAATGG - Intergenic
1153951014 18:10057706-10057728 GGGGAATAGCAAATGCAGGAAGG - Intergenic
1154382382 18:13864218-13864240 GTACAAAAGCAAGTCCAGGAAGG + Intergenic
1155043577 18:22085095-22085117 GGGCAGAAGCAAAGGCAGGAGGG + Intergenic
1155077224 18:22369644-22369666 TTGGAGAAGTGAATCGAGGAAGG - Intergenic
1155362534 18:25016691-25016713 GTGGAGAAGGGCAGCCAGGAGGG + Intergenic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1158419221 18:57278201-57278223 GTGTAGGATCAACTCCAGGAAGG - Intergenic
1159005171 18:63004663-63004685 GTGGAGACCCAGAGCCAGGAGGG + Intergenic
1161770698 19:6229187-6229209 GTGGAAAAGCGGAGCCAGGAGGG + Intronic
1164446399 19:28321267-28321289 GTGGAGATTCAAAAGCAGGAGGG + Intergenic
1165116760 19:33533387-33533409 GTGGAGAAGCTGCTCCAGGACGG + Intergenic
1165125752 19:33595860-33595882 GGGGAAGAGCAAATGCAGGAAGG + Intergenic
1165860124 19:38905050-38905072 GCCTAGAAGAAAATCCAGGAAGG - Exonic
1166524290 19:43501567-43501589 AGGGAGAAGGAAAACCAGGAGGG + Intronic
1167854422 19:52226289-52226311 GTGGAGAAGTAAATGGGGGAGGG - Exonic
1168291444 19:55359550-55359572 GGGGAGGAGCCAATCCAGGTGGG + Exonic
1168295520 19:55375721-55375743 ATGGGGAAACAAATCCAGGAGGG + Intergenic
925072851 2:984635-984657 GTGAAGGAGCAATTTCAGGACGG - Intronic
926362428 2:12102384-12102406 TTGGAAATGGAAATCCAGGAAGG - Intergenic
926371987 2:12188003-12188025 GTTGAGGACCACATCCAGGATGG + Intergenic
926964255 2:18392796-18392818 GCGGAGAAGCAACTTCAGCAAGG + Intergenic
927045438 2:19273475-19273497 GAGCAGAGGCAGATCCAGGATGG + Intergenic
927559668 2:24061071-24061093 GTGGGGACGCAAAGCCAGGAGGG - Intronic
928468742 2:31551920-31551942 GTGGAGAAGCAAATCAATGGAGG + Intronic
929624276 2:43390300-43390322 GTGGATAAACAAGGCCAGGAAGG - Intronic
932305632 2:70701162-70701184 CTGGAAAATCAAATCCAGAAGGG + Intronic
932566645 2:72915364-72915386 GTGTAGATGCAAGTCTAGGACGG + Intergenic
932699319 2:73982538-73982560 GTGGAGGAGCTCATCCAGGGTGG - Intergenic
932701931 2:73997997-73998019 GAGGAGAAGGACTTCCAGGAGGG + Intronic
934035655 2:88086643-88086665 GTGGAGAAGGCAATCTAGGCCGG - Intronic
934290475 2:91686692-91686714 GTGGAGAAGGAAACCAAGGCCGG - Intergenic
935899695 2:107778157-107778179 ATGGATGAGCAAATCCAGGCAGG + Intergenic
936916818 2:117648540-117648562 TGGCAGAAGCAACTCCAGGAGGG + Intergenic
937075748 2:119105143-119105165 GTGGAGAAGAACAATCAGGAGGG - Intergenic
938246871 2:129783962-129783984 GTGGAAAAGCAAATTAAGGGAGG + Intergenic
938393035 2:130919951-130919973 GTGCAGAAGCACATACTGGAAGG + Intronic
938397949 2:130964322-130964344 GAGGAGAAGGAAAGGCAGGAGGG - Intronic
939305149 2:140401557-140401579 GTGGAGATGCATAGCCAGGCAGG - Intronic
939427187 2:142054496-142054518 GTGGAGTACGAAATGCAGGAAGG - Intronic
939634118 2:144560473-144560495 GTAGGGGAGCTAATCCAGGAAGG - Intergenic
940131507 2:150387902-150387924 GTGGAGGGGCAAAGCCAGGTAGG + Intergenic
940973715 2:159921309-159921331 GAGGACAAGCAAATCCTGGAGGG - Intergenic
942970195 2:181949396-181949418 GTGGAGAAGCACATCTATGGAGG + Intergenic
943446621 2:187994822-187994844 GTGGAGGGGCAAAGCCAGGTGGG - Intergenic
945796328 2:214368971-214368993 GGTGAGAAGCAAATCCAAAAGGG - Intronic
947383884 2:229571349-229571371 GGGGAAAAGCAAATCCTAGAGGG - Intronic
947760414 2:232599956-232599978 GTGAAGAAGCAGAGCCCGGAAGG + Intergenic
948155549 2:235778271-235778293 GTGCAGAAGGAAACCCAGGCGGG - Intronic
948363398 2:237438293-237438315 AATGAGAAGCATATCCAGGAAGG + Intergenic
948386195 2:237582414-237582436 ATGGAGAGGCCACTCCAGGAAGG + Intronic
948746304 2:240096293-240096315 GTGGCGGGGCAAAGCCAGGAGGG - Intergenic
1169840163 20:9926818-9926840 GTGGAGAAGTAAGACAAGGAAGG - Intergenic
1170129644 20:13005342-13005364 ATGGATAAGTAAAACCAGGAAGG + Intergenic
1170922204 20:20689915-20689937 TTGAAGCAGAAAATCCAGGAAGG - Intronic
1171101400 20:22386798-22386820 GTGGAGAAGCAAATGCAGTGAGG - Intergenic
1172266427 20:33618967-33618989 GTGGTGAAGGGAATCAAGGAGGG + Intronic
1173360254 20:42337823-42337845 GAGGAAAAGCAAAGGCAGGACGG + Intronic
1174100793 20:48124797-48124819 GTGGAGCTGCAGATCCAGGGAGG - Intergenic
1174100967 20:48125901-48125923 GTGGAGCTGCAGATCCAGGGAGG - Intergenic
1174100999 20:48126093-48126115 GTGGAGCTGCAGATCCAGGGAGG - Intergenic
1174153680 20:48503324-48503346 GTGGAGATGCAGACCCAGGCAGG - Intergenic
1174187631 20:48717967-48717989 GTGGAAACGCAAGTCCAGGGTGG - Intronic
1175430564 20:58899562-58899584 GTGGATAAGGAAATTCATGATGG + Intronic
1177752772 21:25306381-25306403 GTGGAGAGGAAAATACAGCATGG + Intergenic
1177884574 21:26732855-26732877 GTGGAGAAGCAAAGCCCGGCGGG + Intergenic
1178128487 21:29543231-29543253 GTGTAGGAGCAAACCTAGGATGG + Intronic
1179292422 21:40030370-40030392 GTGGAGAAGCAAATCCAGGAAGG + Intronic
1179327477 21:40362317-40362339 ATGGACAAGCAAATTCAGCATGG - Intronic
1179332367 21:40416238-40416260 GGGGAGAAACCAATGCAGGATGG - Intronic
1180123393 21:45769109-45769131 GTGGAGAAACAAATGAAAGAGGG - Intronic
1181458973 22:23075140-23075162 GTGGAGAAGGAAGGCCTGGAGGG + Intronic
1181959497 22:26612738-26612760 GTGGAGAAGGCATTCCAGGCAGG - Intronic
1182066410 22:27434587-27434609 GTGGAAAAGGAAGTCCAGGGTGG - Intergenic
1185125258 22:49007012-49007034 GTGGAGAAGCCAGGCCAGGCAGG + Intergenic
1185141183 22:49102166-49102188 GAGGATAATCAAATCCGGGAAGG - Intergenic
949343885 3:3058704-3058726 GTGGAGAAGGCATTTCAGGAAGG - Intergenic
950104690 3:10380622-10380644 CTGGAGAAGCAATGGCAGGACGG - Intronic
950143762 3:10633362-10633384 AAGGAGCGGCAAATCCAGGATGG - Intronic
950159656 3:10750568-10750590 GTTGAGAAGAGACTCCAGGAGGG - Intergenic
953077967 3:39588188-39588210 CTGGAAAAGCACATACAGGATGG - Intergenic
953927594 3:46990239-46990261 TTGGGGCAGCAACTCCAGGAGGG + Intronic
954354713 3:50075303-50075325 CTGATGAAGCCAATCCAGGATGG - Exonic
956282500 3:67572378-67572400 GTGGAGGAACAAATACAAGAAGG + Intronic
959006574 3:101026790-101026812 GTGGAGGGGCAAAGCCAGGTGGG + Intergenic
960375007 3:116890076-116890098 GTGCAGAAACGGATCCAGGAAGG - Intronic
961206188 3:125083805-125083827 TTGGAGAAGCAGCTCCACGAAGG + Exonic
961832022 3:129627746-129627768 GTTGAGACTCAAATCCAAGAAGG + Intergenic
962737570 3:138339378-138339400 GTGGGGAAGCAAATGAAAGATGG - Intergenic
962979526 3:140474985-140475007 GAGGAAAAGCCAATCCAAGAGGG - Intronic
963558009 3:146820329-146820351 ATAGAGAAGCAATTCCATGAAGG + Intergenic
965545804 3:169915279-169915301 GTAGAAAAGCAAGACCAGGAAGG - Intronic
966779235 3:183569415-183569437 GTGCAGAAACAAACACAGGAGGG + Intergenic
969533185 4:7740686-7740708 GTGAAGAAGCAAAGTCAGGGAGG - Exonic
969829090 4:9781197-9781219 GTGGAGAAGGAAACCAAGGCCGG + Intronic
971607801 4:28680933-28680955 GGGGAGCAGCAAATGCAGGGAGG + Intergenic
971735660 4:30447116-30447138 GTGAAGAAGCATACACAGGAGGG + Intergenic
979156944 4:117406145-117406167 GTGGAGAAGAAAAATCAAGATGG + Intergenic
979443873 4:120787334-120787356 GAGGAGAAGCAAATCGTGTACGG + Intronic
979662282 4:123270998-123271020 ATGAAGAAGCAAAGCCATGAAGG + Intronic
980111217 4:128639040-128639062 GTTGAGAAGGGAATTCAGGAAGG + Intergenic
980990138 4:139732279-139732301 ATAGGGAATCAAATCCAGGACGG - Intronic
981421841 4:144559611-144559633 GTGGAGAAGTAAAAGCAAGATGG + Intergenic
982508726 4:156253049-156253071 CTGGAGTAGAAAATCAAGGACGG + Intergenic
982611502 4:157579775-157579797 AAAGAGAAGAAAATCCAGGAAGG + Intergenic
982729924 4:158944985-158945007 GAGGAGGAGGAAAGCCAGGAAGG - Intronic
984020026 4:174474563-174474585 GTGGAGGGGCAAAGCCAGGTGGG - Intergenic
985394841 4:189531238-189531260 GTGGAGAAGCAAAGGCAGGTGGG + Intergenic
985604681 5:852221-852243 CTGGAATATCAAATCCAGGAAGG + Intronic
987206164 5:15628323-15628345 GTGTAGGAGGATATCCAGGAGGG + Intronic
987226672 5:15848957-15848979 TTGGAAAAGTAAATCCAAGATGG + Intronic
988991879 5:36679602-36679624 GGGGAGAAGCAACACCAGCACGG - Intronic
989020686 5:37003297-37003319 TTGGAGAAGAATATTCAGGATGG + Exonic
990267109 5:54088859-54088881 TTGTAGCAGCAAATTCAGGATGG + Intronic
990943284 5:61225727-61225749 GAGAAGAAGCAACTCCAGGAAGG - Intergenic
992023977 5:72652777-72652799 CTGCAGAGGCATATCCAGGAGGG - Intergenic
993602819 5:89949746-89949768 GTTGAGAAGAAAATTCAAGAAGG + Intergenic
994450568 5:99936406-99936428 ATGGAGAAGGTAAACCAGGATGG + Intergenic
995017410 5:107326527-107326549 GTGAAGAAGGAAAGCCAGTAAGG + Intergenic
995232550 5:109785387-109785409 GCTGAGAAGCATAGCCAGGAAGG + Intronic
997480243 5:134179153-134179175 GTGGTGAAGCACTGCCAGGAAGG + Intronic
997870620 5:137502423-137502445 GGGGAGCAGGAAAGCCAGGAGGG - Intronic
998392927 5:141799028-141799050 TTAGAGAATCAAATCCATGAGGG + Intergenic
998544900 5:143019117-143019139 TTCTAGAAGCAAATCCAGGAAGG - Intronic
998816200 5:146016796-146016818 GTGGAGAAGAAAATGCTGGAAGG - Intronic
999475490 5:151894441-151894463 CTGGAGGAGCAAGTCTAGGAAGG - Intronic
1000616166 5:163429995-163430017 CTGGAGAAGTAATTCCAGAAGGG + Intergenic
1001942712 5:175751839-175751861 GGGGAAAAGCAAGGCCAGGAAGG + Intergenic
1003197324 6:3926293-3926315 GGGGAGGAGGAATTCCAGGAGGG + Intergenic
1003318492 6:5032856-5032878 GGGGAGGAGGAATTCCAGGAGGG - Intergenic
1003846136 6:10175245-10175267 ATGGAGAAGAAAAGGCAGGAAGG - Intronic
1003889706 6:10553239-10553261 GTGGAGGAGCACCTCCAGGCAGG - Intronic
1005913807 6:30334177-30334199 GTGGGGATGCAAAGCCAGGATGG - Intronic
1007358062 6:41335240-41335262 GTGGAGATTCAAAACCAGCAAGG - Intergenic
1007499000 6:42281072-42281094 GAGGAGGAGCAAACCCAGAAAGG - Intronic
1007951016 6:45872385-45872407 GTGGAGTTGCAATTCCTGGAGGG + Intergenic
1007983965 6:46188848-46188870 GGGAAGAAGCCAAGCCAGGAAGG - Intergenic
1008316112 6:50043336-50043358 GTGGAGAAGAAAATCCATGATGG - Intergenic
1008755114 6:54785832-54785854 GTGCAAAAGCAATTCCAAGAAGG + Intergenic
1012004809 6:93700030-93700052 GTGGAGAATGAAATGTAGGAGGG + Intergenic
1013494976 6:110689294-110689316 GTGGAGGGGCAAAGCCAGGTGGG - Intronic
1013656532 6:112252772-112252794 GGGGAGAAGCCAGACCAGGAGGG - Intronic
1014747865 6:125221005-125221027 GTGGAGAGGCCAAAGCAGGAAGG - Intronic
1015086622 6:129301642-129301664 GAGGAGGAGCAAGTTCAGGAAGG + Intronic
1016031637 6:139344202-139344224 GTGGTGGAGCAAAGCCAGGTGGG - Intergenic
1016498395 6:144690147-144690169 GTGAAGGGGCAAAACCAGGAGGG + Intronic
1017311269 6:152980564-152980586 GTGGAGAATGAATTGCAGGAAGG + Intronic
1017644625 6:156527526-156527548 GCAGAGAGACAAATCCAGGAGGG + Intergenic
1018832623 6:167456176-167456198 GTGGAGAAATAAAGCCAGAAGGG - Intergenic
1019276710 7:179677-179699 GAGGAGAAGCAAACCCATCAAGG + Intergenic
1019406389 7:886282-886304 GTGGAGCAGCCAAGCCAGGGGGG - Intronic
1019948882 7:4354728-4354750 GTGAAGAATAAACTCCAGGATGG + Intergenic
1020512182 7:9070953-9070975 GTAGAGAAACTAATCAAGGAAGG - Intergenic
1021775929 7:24055580-24055602 GTGGAGAAGTACGACCAGGAAGG + Intergenic
1022403984 7:30069330-30069352 GTAGAGAACCAAAGCCAGAAAGG - Intronic
1022495961 7:30853320-30853342 GAGCAGAAGCTAATTCAGGATGG + Intronic
1022812258 7:33881380-33881402 GTGTAGCAGCAGATGCAGGAAGG + Intergenic
1024953195 7:54886859-54886881 GTGGAGAAGTGAAGCCAGGCAGG - Intergenic
1025233463 7:57218260-57218282 GTGGAGCTGGAAATCCAGGGAGG + Intergenic
1026760621 7:73123244-73123266 GAGCAGAAGCAAATGCATGAAGG + Intergenic
1027036965 7:74932065-74932087 GAGCAGAAGCAAATGCATGAAGG + Intergenic
1027086599 7:75269394-75269416 GAGCAGAAGCAAATGCATGAAGG - Intergenic
1027448733 7:78304706-78304728 GTGAAAAATCAAAGCCAGGAAGG + Intronic
1027814394 7:82950603-82950625 GTGGAGAAGCAGTTCCAGAAGGG + Exonic
1028327907 7:89549670-89549692 GTGGAAGAGCAAAGCCAGGTGGG + Intergenic
1029392899 7:100287397-100287419 GAGCAGAAGCAAATGCATGAAGG - Intergenic
1030361494 7:108599758-108599780 GTTGAGAAGGAAATGCATGAAGG - Intergenic
1030639137 7:111984593-111984615 AAAGACAAGCAAATCCAGGAGGG + Intronic
1032252728 7:130271895-130271917 ATGGAGTAGCAGATGCAGGAAGG - Intronic
1033430117 7:141281578-141281600 GTGGAGAAGCAAATGCACCCTGG + Intronic
1033553228 7:142466346-142466368 TTGGAGGAGAAAAGCCAGGAAGG - Intergenic
1035403852 7:158586462-158586484 GTGCAGAAGCAAACGCAGGCGGG - Intronic
1036278134 8:7374528-7374550 CTGGAGAAGAAAACACAGGATGG + Intronic
1036343388 8:7937363-7937385 CTGGAGAAGAAAACACAGGATGG - Intronic
1036838727 8:12098125-12098147 CTGGAGAAGAAAACACAGGATGG - Intergenic
1036860515 8:12344369-12344391 CTGGAGAAGAAAACACAGGATGG - Intergenic
1037775825 8:21835003-21835025 ATGGAAAAGCACATCGAGGATGG - Intergenic
1038386013 8:27146064-27146086 CTGGAGAAGGAAATAAAGGATGG - Intergenic
1039398620 8:37248267-37248289 GTTTAGAAGAAAATCCAGGTGGG + Intergenic
1039516884 8:38141103-38141125 GTAGAGAGGTAAATGCAGGAGGG - Intronic
1039596036 8:38790476-38790498 GTGGAGAAGGGACTCTAGGATGG + Intronic
1039926779 8:41941089-41941111 GAGGAGCAGCCAAGCCAGGACGG - Exonic
1040581954 8:48705533-48705555 GTGGAGAAAAACAGCCAGGAGGG + Intergenic
1041803125 8:61821590-61821612 CTGGAGAAGTAACTGCAGGATGG + Intergenic
1042420187 8:68579436-68579458 GGGGAGCAGCAAAGCCAAGAGGG - Intronic
1042959466 8:74288192-74288214 GTGGAAAAGCAGCCCCAGGAGGG + Intronic
1042971718 8:74416221-74416243 GTGGAGGGGCAAAGCCAGGTTGG - Intronic
1044057079 8:87584675-87584697 GTGGAGAACTAAATCCAGTTTGG - Intronic
1044460910 8:92443074-92443096 CTAGAGAAGCTAATCCATGAGGG + Intergenic
1046724827 8:117663014-117663036 TTGGAGAAGCAAATAAAGGCAGG + Intergenic
1047344063 8:124010134-124010156 GTGGAGCTGCAGATCCAGGCAGG + Intronic
1050426827 9:5519764-5519786 GGGGAGAAGCAAATTAAGGAAGG - Intronic
1053044725 9:34906047-34906069 GTTGAGAAGGAAAGACAGGAAGG + Intergenic
1055407365 9:75988841-75988863 GTGGAGATGCCAATACAGGCAGG + Intronic
1055438673 9:76317892-76317914 GTGGGGAAGCAGATCTAGGCTGG - Intronic
1056854859 9:90117806-90117828 AGGCAGGAGCAAATCCAGGAGGG - Intergenic
1058076896 9:100660568-100660590 TTTGAGAAGCACATTCAGGAGGG + Intergenic
1058092448 9:100820311-100820333 ATGGAGAATCAAATACAGAAAGG + Intergenic
1060283642 9:122229645-122229667 GTGGTTAAGCAAATCCTGAAGGG - Intergenic
1062606522 9:137351066-137351088 GTGGAGAAGCAGATTCTGGGCGG - Exonic
1185591848 X:1282576-1282598 TTGGGGAAACAAACCCAGGATGG - Intronic
1186109057 X:6236751-6236773 GTGGAAAAGCATGACCAGGAAGG - Intergenic
1188618188 X:32185347-32185369 GTGAAGAAACAGATTCAGGAAGG - Intronic
1189902379 X:45719967-45719989 TGGGAGAAGCACATCAAGGAAGG - Intergenic
1190123168 X:47680245-47680267 GAAGAGAAGCGAATCTAGGAAGG + Intergenic
1190624586 X:52324673-52324695 GAGGAGAAGCCTATCCAGTAAGG - Intergenic
1192275302 X:69623769-69623791 GTGGAGAAGCAGACCCAGAGGGG + Intronic
1194355660 X:92881335-92881357 GTGGAGAAAGAAAACCAGGGTGG + Intergenic
1197371134 X:125627555-125627577 GTGGAGGGGCAAATCCAGGTGGG - Intergenic
1197839458 X:130730065-130730087 TTGGAGGAGCAAACACAGGAAGG - Intronic
1198122290 X:133606148-133606170 GTGAAGAAGCCGACCCAGGATGG + Intronic
1198216817 X:134562989-134563011 GTGGACTAGAAGATCCAGGAAGG - Intergenic
1198260161 X:134958706-134958728 GGGGAGAAGCAAATAAAGGGTGG - Intergenic
1198583723 X:138096326-138096348 GTGGTGAAGCCAGGCCAGGAAGG - Intergenic
1199964402 X:152807593-152807615 GTGGGGAAGCAAAGCCAGATAGG - Intergenic