ID: 1179297305

View in Genome Browser
Species Human (GRCh38)
Location 21:40074901-40074923
Sequence ACCAGGCAGTGGAGGGACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 363}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179297297_1179297305 16 Left 1179297297 21:40074862-40074884 CCCTGAGGCTCTGCAGTCTCGCT 0: 1
1: 0
2: 0
3: 13
4: 192
Right 1179297305 21:40074901-40074923 ACCAGGCAGTGGAGGGACCTGGG 0: 1
1: 0
2: 0
3: 36
4: 363
1179297298_1179297305 15 Left 1179297298 21:40074863-40074885 CCTGAGGCTCTGCAGTCTCGCTG 0: 1
1: 0
2: 2
3: 22
4: 182
Right 1179297305 21:40074901-40074923 ACCAGGCAGTGGAGGGACCTGGG 0: 1
1: 0
2: 0
3: 36
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179297305 Original CRISPR ACCAGGCAGTGGAGGGACCT GGG Intronic
900118397 1:1038327-1038349 GCAGGGCAGTGGAGAGACCTTGG - Intronic
900133643 1:1103676-1103698 AGCAGGCAGGGGAAGGAGCTAGG - Intronic
900606129 1:3524334-3524356 TCGAGGCACGGGAGGGACCTGGG - Intronic
900750853 1:4396344-4396366 AGGAGGCGGTGAAGGGACCTTGG + Intergenic
900779752 1:4610431-4610453 ACCAGACAGTGGAGTTAACTGGG - Intergenic
900965188 1:5952641-5952663 GCCAGGCAGGGGTGGGACCCGGG - Intronic
901089138 1:6629835-6629857 ACCAGGCACTGGAAGCACCGAGG - Intronic
901144294 1:7054649-7054671 AACAGGCAGTAGCGTGACCTTGG + Intronic
902448845 1:16484295-16484317 AGCAGGCCGGGGAGGGGCCTCGG + Intergenic
902455922 1:16534196-16534218 ACCTGGCAGGGGAGAGACCGTGG - Intergenic
902496248 1:16873714-16873736 ACCTGGCAGGGGAGAGACCGTGG + Intronic
902505924 1:16939058-16939080 AGCAGGCCGGGGAGGGGCCTCGG - Exonic
902627934 1:17687800-17687822 GCCAGGTAGTGGTGTGACCTGGG + Intronic
902990961 1:20186592-20186614 AAGAGGCAGAGGAGGGATCTGGG - Intronic
903029085 1:20449809-20449831 ACAAGGATGTGGAGGGAACTTGG + Intergenic
903154913 1:21436725-21436747 AGCAGGCCGGGGAGGGGCCTCGG - Intergenic
903461057 1:23521339-23521361 ACCAGGCAGGGGAGGGAGTCAGG - Intronic
904061928 1:27718241-27718263 ACAAGGCAGTGGTGTGATCTTGG + Intergenic
904303556 1:29571986-29572008 AGCAGGAAGAGAAGGGACCTGGG + Intergenic
904754326 1:32759794-32759816 ACCAGGGAGTGGTTGAACCTGGG - Intronic
904988535 1:34572862-34572884 GGCAGGCAGTGGAGGCATCTGGG - Intergenic
905649674 1:39647779-39647801 AACAGGCAGAGGAAGGAGCTTGG + Intergenic
906240611 1:44240015-44240037 ACCAGGCAGGGCTGGGAGCTGGG - Intronic
906460895 1:46034615-46034637 GCCAGACCGTGGAGGGAGCTGGG - Exonic
906746437 1:48225182-48225204 ACCAGACAGTGGAGTCAGCTAGG + Intronic
907332255 1:53678984-53679006 CCCAGGCTGTGGAGGGTCATAGG - Intronic
909981897 1:82113059-82113081 ACTTGGCAGTTGTGGGACCTTGG + Intergenic
910216270 1:84847916-84847938 ACAAGGAAGGGGTGGGACCTAGG - Intronic
911700019 1:100941817-100941839 ACCAGGCACTCCAGGGGCCTTGG - Intronic
912421119 1:109543088-109543110 CACTGGCAGTAGAGGGACCTGGG - Exonic
912502522 1:110131470-110131492 AGCAGGCAGTGGAGGGGGTTAGG + Intergenic
912557775 1:110528626-110528648 CCCAGGTTGTGGTGGGACCTTGG + Intergenic
913240590 1:116826275-116826297 ACCAGGATGTGTAGGGACCTGGG - Intergenic
913240601 1:116826316-116826338 GCCAGGGTGTGTAGGGACCTGGG - Intergenic
914898900 1:151701379-151701401 TCTAGGAAGTGGAGGGACTTAGG + Intergenic
915990716 1:160512700-160512722 ACCAGGGTGGGGAGGGACCCAGG + Intronic
916230605 1:162537458-162537480 ACCAGGCAAAGGAGGCAGCTTGG + Intergenic
917384611 1:174457551-174457573 CCCAGGCAGTGGAGTGATCTTGG + Intronic
917482510 1:175424325-175424347 GCCAGGCAGTGGTGGGAGCTGGG + Intronic
918043940 1:180929850-180929872 ACGTGGCAGTGGAGGGAGCAGGG + Intronic
919526512 1:198659419-198659441 CCCATGCAGTGGAGGGACAGAGG + Intronic
919640194 1:200039083-200039105 ACCAGGCAGGAGAGGGAGGTTGG + Intronic
919822488 1:201481988-201482010 ACCAGGCAGGGGAGGCACTTGGG - Intergenic
919868807 1:201804647-201804669 ACCATGCAGTGGAGTGAGTTAGG - Intronic
921835075 1:219770149-219770171 ACCAGGCAGAGAAAGGACCTTGG - Intronic
922582543 1:226709534-226709556 AGCAGGCTGTGGAGGGGACTAGG + Intronic
923039557 1:230309874-230309896 ACCAGACTGTGGTGGGTCCTCGG + Intergenic
923155966 1:231279685-231279707 ACCAGGCAGTGGCGCTATCTTGG - Intergenic
923641305 1:235764027-235764049 ACAAGGCTTGGGAGGGACCTAGG - Intronic
923706988 1:236352032-236352054 ACATGGCACTGGAGTGACCTAGG - Intronic
924145737 1:241072858-241072880 ACCAGACAGTGGCAAGACCTGGG - Intronic
924577180 1:245291463-245291485 ACAAAGCAGTGGAGGGATCAGGG - Intronic
1063188576 10:3671749-3671771 AAGAGGTGGTGGAGGGACCTCGG + Intergenic
1064275831 10:13904097-13904119 ACCAGGCACTGGTGGGGGCTGGG + Intronic
1066163698 10:32762213-32762235 TTCAGGGAGTGGAGGGAACTTGG + Intronic
1067730347 10:48806075-48806097 ACCAGGCAGGGAAGGGTCCAGGG - Exonic
1067759782 10:49035987-49036009 GGCAGGCAGTAGAGGGGCCTTGG + Intronic
1067941672 10:50661750-50661772 ACCAGGCATTGGAAGGACACAGG + Intergenic
1069513066 10:69056547-69056569 TCCCGCCAGAGGAGGGACCTGGG + Intergenic
1069716830 10:70526527-70526549 ACCAGGCTGTTGAAGGGCCTTGG + Intronic
1070008874 10:72453020-72453042 ACGAGGCAGAGGAGGCTCCTGGG + Intronic
1070596176 10:77834634-77834656 ACCTGGCTGTGGAGGGGCCTGGG + Intronic
1070799026 10:79234154-79234176 AGCAGGTAGAGGAGGGACTTGGG + Intronic
1070862911 10:79686708-79686730 ACCAGGCATTGGAAGGACACAGG + Intergenic
1071592634 10:86889577-86889599 ACCTGGCAGGGGAGAGACCACGG + Intronic
1072728651 10:97829975-97829997 ACCTGGGAGGGGTGGGACCTGGG - Intergenic
1073068961 10:100781484-100781506 GCAGGGCAGTGGGGGGACCTGGG - Intronic
1073985969 10:109209570-109209592 ACCTGGTAGTTGAGTGACCTTGG - Intergenic
1074208090 10:111301947-111301969 ACCAGGGAGTGGCAGGGCCTTGG - Intergenic
1075646845 10:124102430-124102452 ACCAGGGTATGGAGGGCCCTTGG - Intergenic
1075649562 10:124118839-124118861 CCCAGGCAGTGCAGGGAGCTGGG - Intergenic
1076139267 10:128066458-128066480 ACCAGTCATTGGAGGGGCCTGGG + Intronic
1076693685 10:132236869-132236891 AGCAGGGAGTGCAGGGACCCTGG - Intronic
1078995345 11:16692122-16692144 CCCAGGCAGTGGCGTGATCTCGG + Intronic
1080060559 11:27952243-27952265 ACAATGCTGTGGAGGGACATAGG + Intergenic
1080694302 11:34587851-34587873 AACAGGCAGTGCTGGGACCGAGG + Intergenic
1083198730 11:61106514-61106536 AGCAGGGAATGAAGGGACCTGGG + Intronic
1083626854 11:64076265-64076287 CCCATGCAGTGGAGGGTCATGGG - Intronic
1084443119 11:69187302-69187324 GTCAGACACTGGAGGGACCTGGG - Intergenic
1084536129 11:69758315-69758337 CCCAGGCAGCTGAGGGTCCTTGG + Intergenic
1084601358 11:70147663-70147685 CCCAGGAAGTGGAGGGAGATGGG - Intronic
1084723801 11:70927363-70927385 ACCAGGCAGTGAAATGACCCTGG - Intronic
1089100450 11:115958436-115958458 CCCAGGGAGGGGAGGGACATCGG - Intergenic
1089280923 11:117373811-117373833 ACCAGGCCATGGAAGGACTTGGG - Exonic
1092773692 12:11922308-11922330 AGCAGGCACTGGAGGGACAACGG + Intergenic
1092784900 12:12018006-12018028 ACCTCACAGTGGAGGGACCCTGG + Intergenic
1094443070 12:30500783-30500805 AGCAGGCAGTGGGGTTACCTAGG - Intergenic
1094842336 12:34347344-34347366 GCAAGGCAGAGGAGGGATCTTGG - Intergenic
1095926809 12:47586672-47586694 CCCAGGCAGTGGCGTGATCTCGG - Intergenic
1095933997 12:47657204-47657226 TGCAGGCAGTGGAGGTACTTGGG - Intergenic
1096514400 12:52148186-52148208 CAGAGGCAGTGGAGGGGCCTGGG - Intergenic
1096542479 12:52315724-52315746 ACCAGGCAGGGTATGGATCTTGG + Intronic
1096585808 12:52618853-52618875 CCCAGGGAGTGGTGGGGCCTGGG + Intergenic
1097275042 12:57807427-57807449 ACCAGGCAGTGGAGGTGGATCGG - Exonic
1101441271 12:104705867-104705889 CCCAGGCAGTGGTGCGATCTTGG - Intronic
1101874930 12:108591715-108591737 ACCAGGAAGTCCAGGGACATGGG - Exonic
1102034916 12:109765624-109765646 AACAGGCGGTGGCGGGACATGGG - Intronic
1102635099 12:114316525-114316547 ACCTGGCAGTGAAGGAACCAGGG + Intergenic
1103162768 12:118743930-118743952 ACCAGGTGAGGGAGGGACCTAGG + Intergenic
1103712643 12:122924187-122924209 AGCAGGGAGTGTGGGGACCTGGG + Intronic
1103723494 12:122986812-122986834 CCCAGGCACTGGCAGGACCTGGG - Exonic
1104170188 12:126273251-126273273 AGAAGGCACTGGCGGGACCTGGG - Intergenic
1104483738 12:129130969-129130991 ACCGGGCAGTGGTGGGACCGAGG + Intronic
1104631313 12:130405301-130405323 ACCAGGCAGAGGAGAGAGCCTGG + Intronic
1105578423 13:21673681-21673703 AACAGGCAGTGGGCGGCCCTGGG + Intronic
1108734567 13:53269184-53269206 ACAAGGAAGTGGAGGGAAGTTGG + Intergenic
1113274997 13:108718645-108718667 AACAGGCAATGGAGGGGCCACGG + Intronic
1113948763 13:114059648-114059670 GCCAGGCAGTGGTGTGTCCTGGG - Intronic
1115283832 14:31695498-31695520 ACCAGGCAGTGTTGGGAGGTGGG + Intronic
1116484230 14:45427651-45427673 ACCAGGGAAAAGAGGGACCTGGG + Intergenic
1117057457 14:51927648-51927670 ACCAGGCAGTGCTTGGAGCTAGG - Intronic
1118437733 14:65786796-65786818 ACCAGGCAGGGGCTGGATCTGGG + Intergenic
1118930376 14:70234885-70234907 GCCAGGCAGTGGAGGGGCCCAGG - Intergenic
1123113754 14:105884614-105884636 AGCTGGCAGTGAAGGGACCAGGG + Intergenic
1123116188 14:105895144-105895166 GCCAGGCAGGCGAGGGACCATGG + Intergenic
1124355314 15:28991163-28991185 GACAGGCAGAGGAGGGCCCTTGG - Intronic
1124651182 15:31475140-31475162 CCCAGGCAGTGGCGTGATCTTGG - Intergenic
1124837324 15:33207932-33207954 AACAGGAAGTGGAGGGACTATGG - Intergenic
1126554631 15:49972108-49972130 ACCAGGGAGTGTTGGGACGTGGG + Intronic
1127146895 15:56034080-56034102 CCCAGGCAATGGTGGGATCTCGG - Intergenic
1127299623 15:57639884-57639906 TGGAGGCAGTGCAGGGACCTGGG - Intronic
1128552889 15:68609624-68609646 GCCTGGCAGTGGAAGGAGCTGGG - Intronic
1128591976 15:68906216-68906238 CCCAGGGAGTGGAGGGAGATGGG - Intronic
1129801771 15:78420364-78420386 TCCATGCGGTGGAGAGACCTAGG - Intergenic
1131058717 15:89391461-89391483 GCCAGGCAGGGGAGAGACCCTGG + Intergenic
1131774877 15:95784155-95784177 CTCAGGCAGAGGAGGGAACTTGG - Intergenic
1132299038 15:100765248-100765270 CCAAGGCAGTGGAGAGATCTGGG - Intergenic
1132406431 15:101544127-101544149 GCCAGGCAGCGGAGGGCTCTGGG - Intergenic
1134112732 16:11525226-11525248 ACCAGGCAGTGGTGCGATCTCGG - Intergenic
1135277213 16:21123841-21123863 GCCAGGCAGTGGCGTGATCTCGG + Intronic
1137964863 16:52920652-52920674 AAGAGGCAGTGTTGGGACCTTGG + Intergenic
1138246610 16:55471274-55471296 ACCAAGGAGGGCAGGGACCTCGG + Intronic
1138471562 16:57242373-57242395 ACCAAGCATTAGTGGGACCTGGG - Intergenic
1138526199 16:57608815-57608837 AATAGGGAGTGGGGGGACCTGGG - Intergenic
1139638458 16:68273813-68273835 GCCAGGCAGTGGCGTGATCTTGG + Exonic
1140020652 16:71235214-71235236 CCCAGGCAGAGGACGGTCCTGGG + Intergenic
1141163319 16:81643739-81643761 CCCAGGCAGTGGCATGACCTCGG - Intronic
1141790022 16:86228033-86228055 ATCAGCCAGAGGAGGGGCCTTGG + Intergenic
1142124587 16:88403851-88403873 ACCAGGCTGAGGAGTGTCCTGGG - Intergenic
1142196583 16:88741976-88741998 CCCAGGAAGTGGGGGGACCCAGG - Intronic
1142761281 17:2043172-2043194 AGCAGTGAGTGGAGGGTCCTGGG - Exonic
1143374864 17:6461539-6461561 ACCAGGCACTGGCAGGACTTGGG - Exonic
1143532367 17:7512841-7512863 ACCAGGCAGGGGAGTAACCTGGG - Exonic
1144021973 17:11245692-11245714 TGCAGGCAGTGGAAGGACCCAGG - Intronic
1144500988 17:15786574-15786596 GCCAGGCTCTGGAGGGACCCTGG + Intergenic
1144518670 17:15939500-15939522 AACAGGCAGTGGAGACAACTTGG - Intergenic
1144674535 17:17153442-17153464 ACCAGGCAGGGGAGGGCCAGTGG - Intronic
1145163156 17:20589249-20589271 GCCAGGCTCTGGAGGGACCCTGG + Intergenic
1146201131 17:30859772-30859794 CCCAGGCAGTGGTGTGATCTCGG + Intronic
1147159911 17:38563734-38563756 TCCAGGCAGTTGAAGGAACTTGG + Intronic
1147199256 17:38788900-38788922 CCCAGGCAGTGGCGCGATCTCGG - Intronic
1148688203 17:49512541-49512563 ACCAGGAAGTGAAGGCACCTGGG - Intronic
1149219260 17:54397129-54397151 ACCAAGCAATTGAGGGAGCTGGG - Intergenic
1149641223 17:58204197-58204219 ACCAGGCAGTCGAGAGATGTGGG - Intronic
1150705722 17:67485413-67485435 CCCAGGCAGTGGTGTGATCTTGG + Intronic
1151557890 17:74855802-74855824 ACCATGCAGAGGAGGGCCCTTGG - Intronic
1151630008 17:75304144-75304166 AGCAGGCAGTGGAAGAGCCTTGG + Intergenic
1151884875 17:76917690-76917712 ACCAACCTGTGCAGGGACCTTGG - Intronic
1152445006 17:80337346-80337368 ACCAGGCACTGGAGGAAACGTGG + Intronic
1152908497 17:82983729-82983751 ACCAGGCAGGGCAGGGGCCCCGG + Intronic
1153220195 18:2854278-2854300 ACCAGTCGGGGGAGGGATCTGGG + Intronic
1154213697 18:12400173-12400195 ACCAGGGAGTGGAGGGAGCATGG - Intergenic
1155076048 18:22356467-22356489 ACCAGGCAGTGGGAAGGCCTGGG - Intergenic
1155401845 18:25447936-25447958 ACCACGCATGTGAGGGACCTAGG + Intergenic
1155600195 18:27537208-27537230 GCAGGGCAGTTGAGGGACCTGGG - Intergenic
1156848538 18:41698672-41698694 CCCAGGGAGTGGAGGGAGATAGG + Intergenic
1160218810 18:76957416-76957438 ACCAGCCCCTGGAGGGACCTGGG - Intronic
1160834067 19:1116426-1116448 CCCAGGCAATGGGGGGATCTAGG + Intronic
1161021390 19:2013296-2013318 ACCGGGGAGTGGAGGGAACCTGG + Intronic
1161279337 19:3436824-3436846 TTCAGGCATTGGAGAGACCTGGG + Intronic
1162143463 19:8598503-8598525 GCCAGGCTGTGCAGGGATCTTGG + Intronic
1162447147 19:10730541-10730563 ACCAGGCAGAGGACAGCCCTGGG + Intronic
1162591942 19:11597691-11597713 AACCGGCTGTGGAGGGACCTAGG + Intronic
1162831518 19:13287406-13287428 TCCAGGCACTGCAGGGATCTGGG - Intronic
1162898139 19:13777749-13777771 CCCATGCAGTTTAGGGACCTGGG + Intronic
1162965003 19:14151377-14151399 CTCAGGCGGTGGAGGGCCCTTGG + Exonic
1163582966 19:18149268-18149290 GCCAGGCCGTGCAGGGAGCTGGG - Exonic
1163800194 19:19360065-19360087 CCCAGGCAGTGGTGTGATCTTGG - Intergenic
1163851895 19:19669016-19669038 AACCGGCAGTGGCTGGACCTGGG + Intronic
1164458863 19:28430824-28430846 AGCAGGGAGTGGTGGGAACTGGG - Intergenic
1164632894 19:29773301-29773323 ACCTGGCACTGGAGGGCCCTGGG + Intergenic
1164723859 19:30452281-30452303 ACCTGGCAGTGAAGGGATCTGGG - Intronic
1164861056 19:31562564-31562586 AACATGCAGTGGCGGGATCTGGG - Intergenic
1165146759 19:33735774-33735796 CCCAGGCAGTGGCGCGATCTCGG - Intronic
1165149145 19:33750774-33750796 AAGAGGCAGTGGTGGGCCCTGGG + Intronic
1165153963 19:33776665-33776687 ACCAAGCTGGGGAGGGCCCTGGG - Intergenic
1165325318 19:35111292-35111314 ACCAGGCAGAGCTGGGGCCTGGG + Intergenic
1165828255 19:38717873-38717895 ACAAGGAAGTGGAGGCACCCAGG - Intronic
1165986825 19:39776828-39776850 CCCAGGCAGTGGTGTGATCTCGG - Intronic
1166270251 19:41709129-41709151 CCCAGGCTGTGGAGGGCCCTGGG + Intronic
1166299258 19:41904895-41904917 GGCAGGCACTGGGGGGACCTGGG + Intronic
1166308951 19:41951744-41951766 ACCAGGCAGGGTGGGGACCCGGG - Intergenic
1167103750 19:47419103-47419125 GCCAGGCTCTGGAGGGACCCAGG - Exonic
1167366021 19:49055376-49055398 ACCAGGCAGGGGACGCACCAAGG - Exonic
1167968329 19:53167495-53167517 CCCAGGCAGTGGCGCGATCTCGG + Intronic
1202706808 1_KI270713v1_random:30552-30574 ACCTGGCAGGGGAGAGACCGTGG - Intergenic
924962659 2:47326-47348 ACCAGGCAGTGGATCAGCCTAGG + Intergenic
925266399 2:2569467-2569489 ACCAGGTAGTGCAGGGACACAGG + Intergenic
925350921 2:3200280-3200302 GCCAGGCTGGGCAGGGACCTGGG - Intronic
925362261 2:3287910-3287932 CCCAGGCGGTGGAGGGGCCAAGG + Intronic
925429452 2:3778487-3778509 ACCAGGGAGCAGAGGGCCCTGGG + Intronic
925436558 2:3843190-3843212 CCCAGGCAGGGGTGGGACCCAGG + Intronic
925615663 2:5742491-5742513 ACCGGGCAGTGTTGGGATCTGGG - Intergenic
925686157 2:6476050-6476072 ACCAGGCACTCGAGGTACATTGG + Intergenic
925764178 2:7214912-7214934 AGGATTCAGTGGAGGGACCTGGG - Intergenic
926002570 2:9345721-9345743 ACCAGGGACTGGAGGGACAAGGG - Intronic
926153860 2:10439761-10439783 ACCAGGCAGTGGGAGCATCTTGG - Intergenic
927001045 2:18794358-18794380 ACCACACAGTGGAGGGGCCATGG - Intergenic
929212602 2:39374315-39374337 CCCAGGCAGTGGTGTGATCTTGG - Intronic
929978603 2:46658043-46658065 ACCAGGCTGGGGAAGGACTTGGG + Intergenic
930034312 2:47075984-47076006 AGGAGGCATGGGAGGGACCTGGG + Exonic
930564937 2:53006833-53006855 ACCAGACAGTGGAGAAACTTGGG + Intergenic
934124472 2:88873432-88873454 AGCAGGCAGGGAAAGGACCTGGG + Intergenic
934841732 2:97628194-97628216 TCCAGGCAGAGGGGGCACCTGGG + Intergenic
935315615 2:101830841-101830863 GCCAGGCAGTGCAGGAACCAGGG - Intronic
935856567 2:107281022-107281044 TCCAGGGAGTGTAAGGACCTGGG + Intergenic
936049838 2:109214323-109214345 CCCTGGCAGAGGAGGGGCCTTGG + Intronic
946482064 2:220066616-220066638 ACCAGGTAGTGGAGTGAGGTGGG - Intergenic
948044727 2:234935017-234935039 ACAAGGCAGTGGTGGAGCCTTGG - Intergenic
948685490 2:239667124-239667146 ACCAGGCTGGGGAGGCACCCTGG - Intergenic
948754382 2:240150550-240150572 ACCAGTCAGTGCACGGCCCTAGG - Intergenic
948769357 2:240240687-240240709 ACACAGCAGTGGATGGACCTTGG - Intergenic
949023251 2:241752985-241753007 ACCAGGCTGTGGAGGGGCTGGGG - Intronic
949035692 2:241814844-241814866 ACCAGGACGTCCAGGGACCTGGG - Intronic
1169528284 20:6454678-6454700 AACAGGCAGTGGAATGACATTGG - Intergenic
1170173861 20:13445466-13445488 ATCTGCAAGTGGAGGGACCTGGG + Intronic
1170547141 20:17444085-17444107 ACCAGGCAGTGGAAGTCACTAGG - Intronic
1170642535 20:18167113-18167135 AACAGGGAGTGGAAGGATCTGGG + Intronic
1171117088 20:22534301-22534323 ACATGGCATTTGAGGGACCTTGG + Intergenic
1171527901 20:25830248-25830270 ACCAGGCAGTTGGGGGAGCAGGG - Intronic
1171548925 20:26025632-26025654 ACCAGGCAGTTGGGGGAGCAGGG + Intergenic
1172511468 20:35503990-35504012 AGCTGGCAGTGGAGGGACGGCGG + Exonic
1172536697 20:35679232-35679254 CCCAGGCAGTGGTGTGATCTCGG + Intronic
1173058087 20:39635822-39635844 ACCAGGCAGAGCAGAGAACTAGG + Intergenic
1173167454 20:40695507-40695529 CCCAGGCCTTGGAGGGACTTGGG + Intergenic
1173642683 20:44614949-44614971 AGCGAGAAGTGGAGGGACCTGGG - Intronic
1174488319 20:50874909-50874931 ACGAGACAGTGCAGGGAGCTGGG + Intronic
1174519473 20:51118563-51118585 GCCAGGCAGTGGTGGGAGGTGGG - Intergenic
1175076888 20:56382882-56382904 AAGAGGGAGTGAAGGGACCTGGG + Intronic
1175160737 20:57005760-57005782 TCCAGTCAGTGGAAAGACCTTGG - Intergenic
1175255921 20:57647158-57647180 CTCAGGCAGTGCAGTGACCTTGG + Intergenic
1176110265 20:63407724-63407746 CCCAGGAGGTGGGGGGACCTGGG + Intronic
1176115735 20:63431133-63431155 TCCAGGCAGGGGAGGGCCCAGGG + Intronic
1176302726 21:5106235-5106257 ACCAGGCAGAGGCGGGAGCCGGG + Intergenic
1179248050 21:39650116-39650138 CCGAGGCAGTGGAAGGGCCTGGG + Intronic
1179261685 21:39763576-39763598 ACAAGGCACTGGAAGGAACTGGG + Intronic
1179297305 21:40074901-40074923 ACCAGGCAGTGGAGGGACCTGGG + Intronic
1179583246 21:42358360-42358382 ACCAGGAGGTGGAGGGAGCCTGG + Intergenic
1179854298 21:44155688-44155710 ACCAGGCAGAGGCGGGAGCCGGG - Intergenic
1179924468 21:44526720-44526742 TCCAGGGAGTGGACGGAGCTGGG + Intronic
1180791167 22:18576559-18576581 GGCAGGTAGTGGAGGGGCCTTGG - Intergenic
1181230571 22:21418755-21418777 GGCAGGTAGTGGAGGGGCCTTGG + Intronic
1181248079 22:21516114-21516136 GGCAGGTAGTGGAGGGGCCTTGG - Intergenic
1181802770 22:25358223-25358245 ACCAGGGCTAGGAGGGACCTTGG + Intronic
1182347220 22:29674746-29674768 CCCCTGCAGAGGAGGGACCTGGG - Intronic
1183604671 22:38861370-38861392 ACCTGTCACTGGAGGGACATGGG + Intergenic
1183621120 22:38973412-38973434 AGCAGGCAGGGGATGGGCCTGGG + Intronic
1183786420 22:40031508-40031530 TCAGGGCAGGGGAGGGACCTGGG - Exonic
1184190709 22:42892601-42892623 ACGTGGCAGAGGAGGGGCCTAGG - Intronic
1184643401 22:45883870-45883892 ACCAGGCAAAGGAGGGTCTTCGG - Intergenic
1185154193 22:49183442-49183464 ACAGGGCAGTGAAGGGGCCTTGG + Intergenic
949260671 3:2099478-2099500 CCTGGGGAGTGGAGGGACCTGGG + Intronic
949991811 3:9585590-9585612 ACCAGGCTGTGGTGCGATCTTGG + Intergenic
950194101 3:10996949-10996971 ACCTAGCAGCTGAGGGACCTTGG - Intronic
952702860 3:36344130-36344152 CCCAGGTAGGGGAGGGACCCAGG - Intergenic
953784102 3:45897487-45897509 ACCGGGCAGTGGAGAAAGCTGGG + Intronic
954551006 3:51481642-51481664 CCCAGGCAGTGGTGCGATCTTGG - Intronic
955359475 3:58260731-58260753 AGCAGGCAGTAGAGGTAGCTTGG + Intronic
955419690 3:58724093-58724115 TCCATGCTGTGGAGGGGCCTGGG + Intronic
955514983 3:59717474-59717496 ACCAGGCAGAGGAAGGTTCTGGG + Intergenic
955687962 3:61563677-61563699 ACCAGGCAGAGCGGAGACCTCGG - Intronic
956882027 3:73520451-73520473 AACATGCAGTGGTGGGATCTCGG - Intronic
957587873 3:82155833-82155855 ACCAGGCTGTGGATGAAACTAGG - Intergenic
961029534 3:123589823-123589845 ACCATGCAGGCGAGGGATCTAGG - Intergenic
961056213 3:123790836-123790858 TGGAGGCAGTGGAGGGACCTAGG - Intronic
961435294 3:126912613-126912635 ACCAGGCAGTGGAGGGTGAAAGG + Intronic
961661854 3:128473260-128473282 ACCTGGCAGGGGAGGGGCCAGGG + Intergenic
962268383 3:133959773-133959795 CCCAGGCAGTGGCAGGATCTTGG - Intronic
963770526 3:149381871-149381893 ACCAGGCAGTGGTAGGCCCTGGG - Intergenic
966346067 3:178981618-178981640 AGCATGCAGTCTAGGGACCTGGG - Intergenic
966932061 3:184681930-184681952 ACCATGCAGTGAAAGTACCTGGG + Intronic
968506056 4:972031-972053 CCATGGCAGAGGAGGGACCTGGG - Intronic
968544154 4:1188158-1188180 CCCAGGCAGTGGTGTGATCTTGG - Intronic
971427036 4:26526183-26526205 CACAGGCATTAGAGGGACCTGGG - Intergenic
972742297 4:41898953-41898975 TCCTGGGAGTGAAGGGACCTGGG + Intergenic
973209754 4:47602907-47602929 CCCAGGCAGTGGTGAGATCTTGG + Intronic
975907013 4:79225512-79225534 ATCAGGCAGTGGAGAGAGCATGG + Intergenic
977524240 4:98125468-98125490 TCCAGGTGGGGGAGGGACCTAGG - Intronic
979409016 4:120351405-120351427 TCCAGGCAGTGGAAGTAGCTTGG + Intergenic
982126770 4:152190540-152190562 ACCAGTCAGTGGTGGGTCTTGGG + Intergenic
982653128 4:158112317-158112339 ACAATGCAGTGGAGGGAAGTGGG + Intergenic
983470732 4:168151075-168151097 TCCAGTCAGTTGAGGGACTTAGG + Intronic
984754738 4:183314520-183314542 ATCAGGCAGCGGTGGGGCCTGGG + Intronic
984934037 4:184874289-184874311 TCCAGGCAGTTGGGGGACATTGG + Intergenic
985791784 5:1931865-1931887 AGCCGGCGGTGGAGGGACCTGGG + Intergenic
986202756 5:5592805-5592827 ACCAGGCAGCGGAAGGAGCCAGG - Intergenic
986233649 5:5887559-5887581 ATCAAGCAATGCAGGGACCTGGG - Intergenic
986739558 5:10694191-10694213 ACCACGCAAAGGAGGGACCGTGG + Intronic
987025889 5:13926105-13926127 ACCATGGAGGGCAGGGACCTAGG + Intronic
987420911 5:17719171-17719193 ACCAGGCAGGGAAGGTGCCTGGG - Intergenic
988857240 5:35240069-35240091 ATCAAGCAGTGGAGGTACCATGG + Intergenic
988954774 5:36304335-36304357 AACAGGCAGTGTAGGAACCCAGG - Intergenic
991816191 5:70511370-70511392 ACCAGGCAGTCTTGGGACTTGGG - Intergenic
992749001 5:79844854-79844876 ACCAAGAAGAGGAGGCACCTTGG + Intergenic
992933388 5:81675206-81675228 ACCACTCAGTGGAGAGACCCTGG - Intronic
997240117 5:132300826-132300848 AGCAGGGACTGGTGGGACCTGGG + Intronic
997259619 5:132455890-132455912 ACCTGGCAAGGGAGGGAGCTGGG - Intronic
997591728 5:135077474-135077496 CCCAGGCAGTGGCGCGATCTTGG + Intronic
999100018 5:149015736-149015758 TCCAGGCAGGGCAGGGACCTGGG - Intronic
1001366425 5:171145508-171145530 ACCAGGGAGCAGAGGAACCTTGG - Intronic
1001527395 5:172438403-172438425 GCCAGGCACTGGGGGGACCATGG - Intronic
1002368003 5:178728744-178728766 CCCAGGCAGTGGCGGGATCTCGG - Intronic
1002382833 5:178842565-178842587 AGCAGGCAGTGGAGGGCCTGAGG + Intergenic
1003192794 6:3889117-3889139 TCCAAGGAGTGGAGGGAGCTGGG + Intergenic
1003371738 6:5534441-5534463 ACTAGGCACTGGAGGGAGCATGG - Intronic
1003569624 6:7247419-7247441 GCCAGGCAGGAGAGGGTCCTTGG + Intronic
1004362214 6:14981310-14981332 CCCAGGCAGTGGTGCGATCTCGG + Intergenic
1004678845 6:17872684-17872706 CCTAGGCTGTGGTGGGACCTCGG + Intronic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006317400 6:33298704-33298726 ACCGGGCAGGGAAGGGACGTGGG + Intronic
1006385712 6:33729639-33729661 ACCAGGGACTGGGGGGACCCAGG - Intronic
1006795797 6:36731655-36731677 ACCAGGTCCTGGAGGGATCTGGG - Intronic
1007067067 6:39001527-39001549 TCCAGGCTGTGGAGGTAACTTGG + Intronic
1007163357 6:39810748-39810770 AAAAGGCAGGGGAGGGATCTGGG - Intronic
1007957816 6:45933236-45933258 ACCAGGAGGTGGTGGGAACTAGG + Intronic
1009890383 6:69673563-69673585 ACCTGGGGGAGGAGGGACCTAGG + Intergenic
1011661886 6:89602002-89602024 AGAAGGCAATGGAGGGACCCTGG + Intronic
1013198858 6:107871539-107871561 ACTAGGCAGTGGCGGTGCCTTGG - Exonic
1013766605 6:113581378-113581400 ACTAGGAAGTGGTGGGACTTTGG - Intergenic
1014253803 6:119141525-119141547 CCCAGGCAGTGGCGCGATCTTGG + Intronic
1015846540 6:137525951-137525973 ACCTGGTGGTGGAAGGACCTGGG + Intergenic
1016894150 6:149036173-149036195 CCCTGGCTGTGGAGGGAACTGGG + Intronic
1017995084 6:159525270-159525292 ACCAGGGAGTGAAGCGATCTTGG - Intergenic
1018859671 6:167702097-167702119 CCCAGGCAGTGGCGTGATCTCGG - Intergenic
1019515537 7:1438313-1438335 GCCAGGCAGAGCAGGGACATTGG + Exonic
1019637021 7:2081473-2081495 ACCAGCCTGTGGAGGGACTGTGG + Intronic
1019682198 7:2356747-2356769 CCCAGGCAGTGGTGGGATCTAGG - Intronic
1019747740 7:2709935-2709957 TCCAGGCAGTGCAGAGCCCTGGG + Intronic
1019883956 7:3887382-3887404 AACAGGCAGGGGAGGAACCGTGG + Intronic
1020087923 7:5321414-5321436 GCCAGGCAGGGGAGGGGGCTAGG - Intronic
1022415269 7:30171873-30171895 CCCAGGCAGAGGTGGGAGCTTGG + Intergenic
1023885621 7:44352318-44352340 ACGAGGCAGTGGTGTGATCTCGG - Intergenic
1024272602 7:47654003-47654025 ACCAGGCAGGGCAGAGACCTAGG - Intergenic
1024578483 7:50782998-50783020 AGGAGGCAGTGGAGGGAACAAGG - Intronic
1024674213 7:51623648-51623670 ACCAGTCAGTGGAAGGGCCTGGG + Intergenic
1024855572 7:53774572-53774594 ACCAGGCTGTGGAGGGATTAAGG + Intergenic
1025249805 7:57344200-57344222 ACCAGGCAGTGCATGGACACAGG - Intergenic
1025297742 7:57789635-57789657 ACCAGGCAGTTGGGGGAGCAGGG + Intergenic
1026360048 7:69595493-69595515 ACTAAGGAGTGGAGGCACCTTGG + Intergenic
1028288978 7:89041492-89041514 ACCTGGCACTGGAGTGTCCTTGG + Intronic
1028473412 7:91228736-91228758 ACAAAGCTTTGGAGGGACCTGGG + Intergenic
1029283152 7:99449588-99449610 TCCAGGCACTGGAGGGACAATGG + Intronic
1029437744 7:100572475-100572497 GCCAGGCAGTGGAGGGGCCCCGG + Exonic
1030298330 7:107951173-107951195 ATCAGAGAGTGGAGGGAACTGGG - Intronic
1032540297 7:132697352-132697374 ACCAGGGAGTGGAGGGGCAGGGG + Intronic
1033529758 7:142250020-142250042 ACCACCCAGTAGTGGGACCTTGG - Intergenic
1036406029 8:8455959-8455981 ACCAGGCAGGGCAGAGTCCTGGG - Intergenic
1038040551 8:23720542-23720564 ACCAGGCAGGAGGGGGACCCGGG + Intergenic
1039411378 8:37357971-37357993 GCCAGGCAGAGGAGGGAAGTAGG - Intergenic
1039826689 8:41180377-41180399 AAGAGGCAGTGCAGCGACCTAGG - Intergenic
1043053424 8:75408170-75408192 AGCGGGCAGTGGGGGGACCGGGG + Intronic
1045285702 8:100789424-100789446 CCCAGGCAGTGGAGGGCTGTTGG + Intergenic
1045337679 8:101223628-101223650 ACCATGCATTGGAGGGTCTTTGG - Intergenic
1045418000 8:101986079-101986101 CCCAGGCAGTGGCGCGATCTTGG + Intronic
1048283975 8:133127192-133127214 ACCTGGCAGTGGATGGAGCTGGG - Intronic
1049013187 8:139901637-139901659 ACCAATCAGTGGTGAGACCTAGG + Intronic
1049159286 8:141087043-141087065 GCCAGGCACTGGGGGGCCCTGGG + Intergenic
1049514367 8:143045619-143045641 ACCAGGCCTGGGAGGGTCCTGGG - Intronic
1049602750 8:143515526-143515548 TCCAAACAGTGGAGGGGCCTGGG - Intronic
1051599127 9:18854482-18854504 ACCAGGTAGTTGAGGGAGATGGG + Intronic
1051849933 9:21494625-21494647 ACTAGGCATAGGAGGGATCTAGG - Intergenic
1052758662 9:32567377-32567399 CCCAGGCAGTGGTGCGATCTTGG + Exonic
1053023876 9:34714922-34714944 ACCAGGCAGAGATGGGACCTAGG - Intergenic
1054788507 9:69232952-69232974 ACAAGGCTGTGGGAGGACCTTGG - Intronic
1055906223 9:81296083-81296105 ACCAGACAGTGTAGGGATGTTGG + Intergenic
1056435749 9:86574793-86574815 TCCAGGGAGTGTATGGACCTAGG + Intergenic
1057189832 9:93080660-93080682 CTCTGACAGTGGAGGGACCTGGG - Intronic
1057426015 9:94950439-94950461 ACATGGCAGTGGAGAGACTTGGG + Intronic
1058418298 9:104810930-104810952 CCCAGGCAGTGGAGGGGGCAGGG + Intronic
1058584705 9:106494578-106494600 CCCAGGCAGTGGCGGGATCTCGG + Intergenic
1058981351 9:110173580-110173602 ACCAGGAAGAGGAGGGGCCGAGG - Intergenic
1059472402 9:114515771-114515793 CCCAGACAGTGGAGTGACCTTGG - Intergenic
1060297800 9:122355102-122355124 CTCAGGCACTGGAGGGAGCTGGG - Intergenic
1060950053 9:127595829-127595851 ATCAGGAAGTGGTGGGACTTGGG - Intergenic
1061242345 9:129381940-129381962 ACTAGCCAGTGGGGTGACCTTGG + Intergenic
1061479030 9:130887384-130887406 GACAGGCAGTCGGGGGACCTGGG - Intronic
1061796052 9:133086532-133086554 ACTTGCCAGTGGAGGGACTTTGG + Intronic
1061988356 9:134143488-134143510 CCCAGGCAGTGGTGCGATCTCGG - Intronic
1061994478 9:134176799-134176821 ACCGGGCAGAGGAGAGACATAGG - Intergenic
1062186428 9:135221023-135221045 ACCAGGCAGGGCAGAGACGTGGG + Intergenic
1187137059 X:16558253-16558275 ACCAGGTAGAGGAGGGAACTAGG - Intergenic
1189250585 X:39598268-39598290 CCCAGGGAGAGGTGGGACCTTGG + Intergenic
1190263404 X:48813862-48813884 AGCAGGAAGTGGAGAGACCTGGG - Intronic
1192847984 X:74925457-74925479 ACGAGGCAGGGGAAGAACCTGGG - Intronic
1194136387 X:90149231-90149253 CCCAGGCAGTGGTGTGATCTCGG + Intergenic
1198219110 X:134583724-134583746 ACCAGGGGGTGGAGGGAGGTGGG - Intronic
1199304601 X:146252431-146252453 ACCAGGCAGTGGTGTGATCTCGG - Intergenic
1199500614 X:148501682-148501704 ACCCGGGAGTGCAGGGAACTTGG - Intronic
1200482144 Y:3719296-3719318 CCCAGGCAGTGGTGTGATCTCGG + Intergenic
1201901622 Y:19049761-19049783 ACAAGGCACTTGAGGGGCCTAGG - Intergenic