ID: 1179297779

View in Genome Browser
Species Human (GRCh38)
Location 21:40078864-40078886
Sequence CTAGTGTGAAGGAGGTGATG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 249}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179297772_1179297779 -6 Left 1179297772 21:40078847-40078869 CCCAAAGGGCCTGTACTCTAGTG 0: 1
1: 0
2: 0
3: 3
4: 77
Right 1179297779 21:40078864-40078886 CTAGTGTGAAGGAGGTGATGGGG 0: 1
1: 0
2: 1
3: 20
4: 249
1179297767_1179297779 21 Left 1179297767 21:40078820-40078842 CCTCTGAGCTGTGGTCCAAACTG 0: 1
1: 0
2: 1
3: 21
4: 171
Right 1179297779 21:40078864-40078886 CTAGTGTGAAGGAGGTGATGGGG 0: 1
1: 0
2: 1
3: 20
4: 249
1179297771_1179297779 6 Left 1179297771 21:40078835-40078857 CCAAACTGTGGTCCCAAAGGGCC 0: 1
1: 0
2: 0
3: 12
4: 130
Right 1179297779 21:40078864-40078886 CTAGTGTGAAGGAGGTGATGGGG 0: 1
1: 0
2: 1
3: 20
4: 249
1179297773_1179297779 -7 Left 1179297773 21:40078848-40078870 CCAAAGGGCCTGTACTCTAGTGT 0: 1
1: 0
2: 0
3: 7
4: 102
Right 1179297779 21:40078864-40078886 CTAGTGTGAAGGAGGTGATGGGG 0: 1
1: 0
2: 1
3: 20
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179297779 Original CRISPR CTAGTGTGAAGGAGGTGATG GGG Exonic
901738185 1:11325471-11325493 CTTGCGGAAAGGAGGTGATGGGG + Intergenic
902181574 1:14693215-14693237 CAAATGCGAAGGAGGTGATAAGG - Intronic
902735433 1:18397710-18397732 CAAGTGGAAAGGTGGTGATGCGG - Intergenic
903002427 1:20275782-20275804 CTAGTGTGGAGGAGATGAGGGGG + Intergenic
903263016 1:22141640-22141662 CTTGGGGGACGGAGGTGATGTGG - Intronic
904536810 1:31204822-31204844 CTAGAGGGATGGAAGTGATGGGG + Intronic
904659944 1:32076833-32076855 CCATCGTGAAGGAGGTGATTGGG + Exonic
905845779 1:41230267-41230289 CTAGAATGAAGGAAGTGGTGAGG + Intronic
905980505 1:42221739-42221761 CTAGTGTCAAGGAGTAGAAGAGG - Intronic
906061382 1:42951204-42951226 GTGGTATGAAGAAGGTGATGGGG + Intronic
906151910 1:43592474-43592496 CTAGTGTGTAGGAGGAGGTTGGG - Exonic
906241812 1:44246840-44246862 CTACTCTGAAGGAGGTGACTGGG + Intronic
906699309 1:47846376-47846398 GCAGTGAGAAGGAGCTGATGTGG + Intronic
908419685 1:63947601-63947623 TTACTGTGAAGGAGGTGGGGTGG + Intronic
909399387 1:75209744-75209766 CCAGTGTGAAGTTGGTGCTGTGG + Intronic
912313699 1:108647525-108647547 CTGGTGGGGAGGAGGTGAGGTGG + Intergenic
912866816 1:113264952-113264974 CTGGTGTGAAGGACCTTATGTGG - Intergenic
916548165 1:165826509-165826531 CTAGTATCAATGAGCTGATGGGG - Intronic
916844742 1:168638221-168638243 CATCTGTGAGGGAGGTGATGAGG + Intergenic
917116559 1:171609299-171609321 CTAGTCTCAAGGAGGAGATAGGG - Intergenic
917117442 1:171616599-171616621 CAGGTTTGAAGGAGGTGATCAGG + Intergenic
917546309 1:175972365-175972387 CTAGTGAGAGGGAAGTGAGGAGG + Intronic
918136697 1:181680373-181680395 TTAGGGTGAAGGATGTGATCTGG + Intronic
918350823 1:183653893-183653915 CTTGTGTCTAGGAGATGATGTGG - Intronic
918728791 1:187962336-187962358 CTAATTTGAAGGAGGTGAAGAGG + Intergenic
919933872 1:202238787-202238809 CTAGTATGAATCAGGTGAAGAGG + Intronic
920041151 1:203098349-203098371 CCAGTGTGATGGAGGAGACGAGG - Intronic
920230378 1:204466138-204466160 CTAGGGAGAAGGAAGTGAGGGGG + Intronic
920303224 1:205002330-205002352 CTAGTGTGAAGACTGTGGTGAGG + Intronic
920838552 1:209534590-209534612 GTAGTGTGACGGGGGAGATGTGG + Intergenic
921055775 1:211541437-211541459 CTGGAGTGGAGGGGGTGATGTGG - Intergenic
921072532 1:211674327-211674349 ATATTGTGAAGGAGGGGATCTGG - Exonic
924200204 1:241650574-241650596 CCAGTGTGACTGAGGTGGTGTGG - Intronic
924493309 1:244561420-244561442 GTAGGGTGTAGGAGGTGCTGTGG + Intronic
1062991160 10:1820418-1820440 ATAATTTGGAGGAGGTGATGGGG - Intergenic
1064623075 10:17234413-17234435 CTATTCTGAAGGAGGTGATGTGG - Intronic
1065334829 10:24645989-24646011 TTACTGGGAAGGAAGTGATGTGG - Intronic
1065974113 10:30827698-30827720 CTAGTATGAAGGGTGCGATGTGG + Intronic
1066323445 10:34328543-34328565 CAACTGTGAAGGTGGTGGTGGGG + Intronic
1067228816 10:44392724-44392746 CTGGTGTGGAGGGGGTGAAGGGG - Intergenic
1070715962 10:78721148-78721170 TTGCTGTGAAGGATGTGATGTGG - Intergenic
1073528761 10:104211673-104211695 CTAGTGTTAGGGAGGAGAGGTGG - Intronic
1078142415 11:8702020-8702042 CTGGGGAGAAGGATGTGATGGGG - Intronic
1079360450 11:19766350-19766372 CAAGTGTGAACATGGTGATGGGG + Intronic
1079490489 11:20983721-20983743 CTAGAATGAAGGAAGTGAAGAGG - Intronic
1081647718 11:44801532-44801554 CTAGTTTCAAGGAGTTGGTGGGG + Intronic
1081741940 11:45447042-45447064 CCAGTGTGGTGGAGGTGAGGCGG + Intergenic
1083244280 11:61414032-61414054 TTAGTGTGAAAGGGTTGATGAGG + Intronic
1084111262 11:67015453-67015475 CTGGTGTGGAGGCGGTGGTGGGG + Intronic
1084719829 11:70897680-70897702 CTTGTGTGTATGAGGTGATCTGG + Intronic
1089309628 11:117549122-117549144 GGAGTGGGAAGGTGGTGATGGGG - Intronic
1089524555 11:119088398-119088420 CTAGTATGAAGGAGATGGGGTGG + Intronic
1090090418 11:123692060-123692082 ACAGTGTGACGGTGGTGATGGGG + Intergenic
1090498084 11:127234216-127234238 CTCGTGTGTATGTGGTGATGGGG + Intergenic
1091141702 11:133240764-133240786 CTAAGGAGAAGGAGGTGATGAGG - Intronic
1092060823 12:5548930-5548952 ACAGGATGAAGGAGGTGATGGGG + Intronic
1094243078 12:28251629-28251651 CCAGTATGAAGGAGATGAGGAGG - Intronic
1096530697 12:52241145-52241167 CTATTGTGAGGGAGGCCATGGGG - Intronic
1101592207 12:106134553-106134575 CTAGTGAGCAGTAGGTGGTGTGG - Intronic
1102735479 12:115155459-115155481 CTAGTGTGATGGAGGTGTGAAGG + Intergenic
1104947359 12:132422051-132422073 ACAGTGAGAAGGAGGGGATGGGG + Intergenic
1105592712 13:21809653-21809675 CTAGGGACAAGGAGGTGTTGAGG - Intergenic
1106203853 13:27570140-27570162 CTAGTTTGAAGGATGGGAGGAGG + Intronic
1106353508 13:28956928-28956950 CTGGTGGGAAGGAAGTGTTGGGG + Intronic
1107443417 13:40448495-40448517 ATAGAGTGAAGGAGGTGGAGAGG - Intergenic
1108013536 13:46048668-46048690 GTAGGGTGAGGGAGGTGAGGAGG - Intronic
1111397596 13:87685330-87685352 TTAGTGTGAATAAGGGGATGGGG + Exonic
1113339919 13:109412433-109412455 CCAGTGTGAGGGAGGGGAAGAGG - Intergenic
1114186355 14:20405423-20405445 GAGGTGTGAAGGAGGGGATGGGG - Intronic
1114336850 14:21699338-21699360 CTAGTGTTTACGAGGGGATGAGG + Intergenic
1117960485 14:61157035-61157057 CGAGTGGGAAGGAAGAGATGTGG + Intergenic
1118658339 14:67978584-67978606 ACAGTGTGAAGGAGGTGCAGAGG + Intronic
1118733993 14:68689508-68689530 CCAGAGAGAAGGAAGTGATGGGG - Intronic
1121790239 14:96693860-96693882 CTAATGTGAAGGAGTTGGAGAGG - Intergenic
1123056291 14:105572197-105572219 CCAGTGTGGGGGAGGTGCTGCGG - Intergenic
1123057642 14:105579610-105579632 CCAGTGTGGGGGAGGTGCTGCGG + Intergenic
1123080720 14:105692325-105692347 CCAGTGTGGGGGAGGTGCTGCGG - Intergenic
1123081921 14:105699543-105699565 CCAGTGTGGGGGAGGTGCTGCGG + Intergenic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1124151561 15:27183503-27183525 TTATTGTGAAGGGGGTGAAGAGG + Intronic
1125460896 15:39905792-39905814 CAAGGGTGAAGGAGGGGATCGGG + Intronic
1126883161 15:53120959-53120981 CTGGTGTAAAGAAGGGGATGTGG - Intergenic
1127849304 15:62899046-62899068 CCAGAGAGAAGGAGGTGGTGAGG + Intergenic
1128214138 15:65922694-65922716 CTAGAGGGAAGGAAGAGATGGGG + Intronic
1129808886 15:78489835-78489857 GTAGTTTGAAGGCGTTGATGTGG + Intronic
1130689169 15:86065490-86065512 CTAGTGTGAATGAGGGGAGAGGG + Intergenic
1132051612 15:98612199-98612221 CTACTCTGAAGGCTGTGATGAGG + Intergenic
1134660200 16:15978251-15978273 CTAGTTTGGAGCAGGTGAGGAGG + Intronic
1135209606 16:20513164-20513186 CGAGTGTGAAGGACGGGTTGGGG - Intergenic
1135483166 16:22840268-22840290 CAAGTATGAAGGAAATGATGTGG - Intronic
1137713993 16:50586486-50586508 CTAGGTTGAGGGAGGTGCTGGGG + Intronic
1137937529 16:52648939-52648961 CATGTGTGAAGGAGGAGGTGGGG - Intergenic
1138193084 16:55032509-55032531 CTAGGGTGAAGCAAGTGAGGTGG + Intergenic
1140303789 16:73783392-73783414 CTTGTGTAAAGGAGGTTTTGGGG - Intergenic
1144066319 17:11627734-11627756 CTAGTGGGAAGCAGCTGAAGTGG - Intronic
1146465616 17:33083968-33083990 CTAGTGAGAAGCAGGAGCTGGGG - Intronic
1147305269 17:39559496-39559518 CAAGGGTTAAGGAGGGGATGAGG - Intronic
1148667090 17:49382902-49382924 CTAGTGAGTGGGAGGTGATGGGG + Intronic
1149637884 17:58184957-58184979 CTAGTCTGATGGAGGAGGTGAGG + Intergenic
1151265695 17:72953371-72953393 ATAATGTGAAGGAGGTGAGGGGG + Intronic
1155280671 18:24236360-24236382 ATAGAGTGAAGGAGGAAATGGGG + Intronic
1155623383 18:27807188-27807210 CTGGTGTGATGGAGTTGAGGTGG - Intergenic
1158684472 18:59600704-59600726 CCAGTGGGCAGGAGGAGATGGGG - Intronic
1161080799 19:2309054-2309076 CCAGGGGGAAGGAGGTGGTGCGG - Intronic
1161773435 19:6243635-6243657 CGAGTGTGAGGGAGGTGAGCTGG - Intronic
1162529838 19:11229421-11229443 TTAGTGTGGATGAGGTGAAGGGG + Intronic
1163038959 19:14588440-14588462 CTATTGTGAAGTATGTGATTGGG + Intronic
1163272997 19:16265476-16265498 CTGGTGTGCAGGAGGAGATGGGG + Intergenic
1164944197 19:32279012-32279034 ATAGTGTGAAGTAGGGGTTGAGG - Intergenic
1165111721 19:33506407-33506429 GTAGTGTGTAGGGTGTGATGAGG - Intronic
1166134895 19:40770210-40770232 CTGATGTGAAGCGGGTGATGGGG + Intergenic
1166535941 19:43574878-43574900 CTAGTGAGGAGGAGGTGGGGTGG + Intronic
1167964138 19:53129679-53129701 TGAGTGAGAAGGAGGAGATGTGG + Intronic
928870705 2:35974707-35974729 CTAATGTAAAGAATGTGATGGGG - Intergenic
929083430 2:38144798-38144820 CAGGTTTGGAGGAGGTGATGAGG - Intergenic
930381394 2:50634770-50634792 TTATTGGGAAGGAGCTGATGAGG + Intronic
930598398 2:53415186-53415208 GTAGTGGGGAGGAGGGGATGAGG + Intergenic
931724175 2:65092928-65092950 AGAGTGTGAAGGAAGTGAAGGGG - Intronic
931931708 2:67144856-67144878 CTAGTGTGAGGCAGGTGTTGAGG - Intergenic
932874692 2:75438812-75438834 CCAGGGTTAAGGAGGAGATGTGG + Intergenic
934163347 2:89272707-89272729 CTAGGGTTAAAGAGGTGATCAGG - Intergenic
934203927 2:89909817-89909839 CTAGGGTTAAAGAGGTGATCAGG + Intergenic
934512306 2:94955123-94955145 CTAGTGGTGAGGAGGTGATGTGG + Intergenic
935110092 2:100085321-100085343 CTGGTGTGGCCGAGGTGATGAGG - Intronic
935512963 2:103999011-103999033 CTAGTTTGAAGTAGGAGTTGAGG - Intergenic
936124885 2:109779887-109779909 CTGGTGTGGCCGAGGTGATGAGG + Intergenic
936219808 2:110591581-110591603 CTGGTGTGGCCGAGGTGATGAGG - Intergenic
939988937 2:148859244-148859266 CAAGTGTGCAGGAGGTCAAGTGG - Intergenic
944080920 2:195787720-195787742 TTAGTGAGAAGGAATTGATGGGG + Intronic
944113830 2:196165611-196165633 CTAGTGTGATGAAGGTGAAATGG + Intronic
946710221 2:222497800-222497822 CTACTGTTTAGGATGTGATGAGG + Intronic
948362384 2:237432229-237432251 CTGGTCTGAAGGAGAGGATGTGG + Intergenic
948871036 2:240798247-240798269 TTGGTGTGAAGGGTGTGATGGGG - Intronic
1168846557 20:949095-949117 AGCGTGTGAAGGAGGTGAAGGGG + Intergenic
1172215718 20:33234228-33234250 CTAGTGTGAGGGAGGCAGTGTGG + Intergenic
1172590951 20:36117467-36117489 CTAGTGTGAGCCAGGTGATAAGG - Intronic
1172606480 20:36217532-36217554 TTAGTGTGAAGGTGGAGGTGAGG + Intronic
1172630113 20:36372442-36372464 CAGATGTGAGGGAGGTGATGGGG - Intronic
1172872649 20:38145208-38145230 CTGGTGTGGAGGATGTGCTGGGG + Intronic
1173597012 20:44265069-44265091 GTTGTGTAAGGGAGGTGATGGGG - Intronic
1175168662 20:57064227-57064249 CTAGGGGGAAGGCGGGGATGGGG + Intergenic
1175491589 20:59384052-59384074 GTGGGGGGAAGGAGGTGATGGGG + Intergenic
1175811787 20:61862257-61862279 CAAGGGTGAAGGAGGAGATGGGG - Intronic
1176149156 20:63580544-63580566 CTTGAGTGGAGGAGGTGATAGGG - Intergenic
1176729169 21:10473547-10473569 CAAGTCTGAAGAAGGTGTTGGGG - Intergenic
1176879435 21:14173107-14173129 CAAATGTGAAGGATGTGAGGCGG + Intronic
1177099738 21:16885488-16885510 CTTGAGTGATGGAGGTGATTTGG + Intergenic
1177536623 21:22436589-22436611 GAAGTGTGAAGGAGTTGAGGAGG - Intergenic
1179297779 21:40078864-40078886 CTAGTGTGAAGGAGGTGATGGGG + Exonic
1179350956 21:40610453-40610475 CTACTCTGATGGAGGGGATGGGG - Intronic
1180875880 22:19175118-19175140 CTCGTGGGGAGGAGGAGATGGGG - Intergenic
1182083501 22:27545434-27545456 CTGTTATGAAGGAGCTGATGTGG - Intergenic
1184141100 22:42577796-42577818 CTAGAGTGAGGGGGGTGGTGGGG - Intergenic
1184989045 22:48155002-48155024 CGAGGGTGAAGGAGGAGCTGGGG - Intergenic
951761803 3:26156415-26156437 CTATTTTGAAGGTGGAGATGGGG - Intergenic
953983092 3:47422456-47422478 CTAGGGTGAAGTAGCCGATGAGG + Exonic
954542852 3:51406798-51406820 CCAGTGTGAAGGTGGTGGTGAGG - Intronic
954684311 3:52362136-52362158 CGAGTGGGAAGCAGGAGATGTGG + Intronic
955381212 3:58439851-58439873 CCAGTGTTAAGGGGGTGGTGGGG + Intergenic
956169789 3:66423938-66423960 CTAGTCTGTAGGAGGTGCTCTGG + Intronic
957211271 3:77261640-77261662 CATGTGTGCAGGAGGTGAGGGGG + Intronic
960340471 3:116468879-116468901 TTAGTGAGAAGGAGGAGATTTGG + Intronic
960800231 3:121531432-121531454 CCAGTGTGAAGGAAGTGAGAGGG + Intronic
961345736 3:126262176-126262198 CCAGTGGAAATGAGGTGATGTGG + Intergenic
961723009 3:128908500-128908522 CTAGTGTGAGGGACCAGATGGGG - Intronic
961994572 3:131228583-131228605 CTATTGTGAAGAGAGTGATGAGG + Exonic
963286142 3:143436264-143436286 CCTGTGAGAAGGAGGTCATGCGG - Intronic
963605046 3:147406213-147406235 GTAGGATGAAGGAGGAGATGGGG + Intronic
964634050 3:158841748-158841770 CTAGTGAGTAGGTGATGATGAGG + Intergenic
965384191 3:168026210-168026232 TTAGTGTGAAGGTGGTAATTTGG - Intronic
966922651 3:184623721-184623743 CTAGTATGATGGAGGTGGCGAGG - Intronic
969093869 4:4717947-4717969 CTAGGGTGGAGGAGATGCTGGGG - Intergenic
969238557 4:5885218-5885240 CTAGAGTGGGGGAGGTGAAGGGG - Intronic
970400663 4:15714289-15714311 CTAGAATGAAGGAGGTGTAGAGG - Intronic
971073882 4:23126042-23126064 CTGGTGTGAAGGCTGTGAAGTGG + Intergenic
972547773 4:40096860-40096882 CAGGTTTGAAGGGGGTGATGAGG + Intronic
973565070 4:52177609-52177631 CTACTGTGAAGTTGGGGATGGGG - Intergenic
974936904 4:68419835-68419857 CTAGTGTGGAGGGAGTGGTGTGG + Intergenic
975647793 4:76562648-76562670 ACAGTGTGAAGGAAGTGAGGAGG - Intronic
975871183 4:78780302-78780324 ATAGTGTGAATATGGTGATGTGG + Intronic
977707722 4:100089813-100089835 CTGGTGTGAATGTGGTGATGTGG - Intergenic
977966285 4:103152799-103152821 CTGGCGGGGAGGAGGTGATGAGG + Intronic
979572504 4:122244815-122244837 TTGGGGTGAAGGTGGTGATGTGG + Intronic
980835481 4:138186603-138186625 CTAGTGTGAAGAGGGTCCTGTGG + Intronic
982066423 4:151658441-151658463 CTGGAGTGATGGAGGTGATGGGG + Intronic
982741823 4:159065238-159065260 CTATTTTGAAGGAAGAGATGGGG + Intergenic
983570472 4:169202472-169202494 CTCATCTGAAGGAGGGGATGTGG + Intronic
985095303 4:186407321-186407343 CTAGTGTGAAGGAAGGAACGAGG + Intergenic
985542062 5:491952-491974 TCAGTGTGAAGGACGCGATGTGG + Exonic
991382731 5:66048644-66048666 CTAGTGAAAAGGGGGTGAGGGGG - Intronic
992206430 5:74434702-74434724 CTAGGGTGAAGGAGGCAATGCGG - Intergenic
994080978 5:95708836-95708858 CTGTTGTGAAAGAGGTGAGGAGG + Intergenic
996262417 5:121490186-121490208 CTAGAATGGAGGAAGTGATGTGG - Intergenic
997426761 5:133808485-133808507 CTAGTGTGAAGCAGGAACTGAGG + Intergenic
999528112 5:152430639-152430661 ATAGAGTGGCGGAGGTGATGAGG + Intronic
1001105739 5:168852581-168852603 CGAGGCTGAAGGAGATGATGTGG - Intronic
1001298577 5:170516974-170516996 GTGGTGTGATGGTGGTGATGGGG + Intronic
1002186364 5:177456536-177456558 CTGGTGGCAAGGAGGTGCTGCGG + Intergenic
1002690480 5:181046334-181046356 GAAGTGTGCAGGAGGTGTTGGGG - Intronic
1003153747 6:3573995-3574017 AGGGTGTGAAGGAGGTGACGAGG + Intergenic
1003700233 6:8456311-8456333 CTAGAGTGGGGGAGGGGATGTGG - Intergenic
1004800515 6:19141849-19141871 CAAGTCTGACGGATGTGATGAGG - Intergenic
1005449561 6:25959607-25959629 TTAGTGTGATGCATGTGATGTGG - Intergenic
1006107671 6:31726424-31726446 ATAGTGTGAAGGAGGGAAAGGGG - Intronic
1006372852 6:33656193-33656215 TTGCTGTGAAGGAGGGGATGTGG + Intronic
1008216186 6:48792701-48792723 GCAGTGTGAGGGATGTGATGAGG + Intergenic
1009023522 6:57970712-57970734 CTAGTTGGAAGGAGGTACTGAGG + Intergenic
1010192697 6:73209918-73209940 CAAGGATGAAGGAGGGGATGTGG + Exonic
1010828239 6:80498734-80498756 CTAGTGTGCAGAAGGAGAGGAGG + Intergenic
1011356759 6:86479346-86479368 CTGTTGTGAAAGAGGTGAGGAGG - Intergenic
1011749737 6:90443051-90443073 CTAGTGGGAGGGAGGGGAAGAGG - Intergenic
1011973452 6:93259587-93259609 CTGCTGTGAATCAGGTGATGTGG - Intronic
1012518506 6:100092237-100092259 GTAGAGTAAAGGAGGGGATGGGG + Intergenic
1013783675 6:113755832-113755854 CAAGTCTGAAAGAGGAGATGTGG + Intergenic
1016769745 6:147835806-147835828 CTGGAGACAAGGAGGTGATGCGG - Intergenic
1017176571 6:151510565-151510587 ATATTGCAAAGGAGGTGATGAGG + Intronic
1017491680 6:154950949-154950971 AGAGTGTGAAGGGGGTGCTGAGG + Intronic
1017881704 6:158566654-158566676 ATGGGGTGAGGGAGGTGATGGGG + Intronic
1018839916 6:167509223-167509245 AGTGTGTGAAGGAGGTGAGGGGG - Intergenic
1020900286 7:13995062-13995084 ATAATGAGAAGGAGGTGATAAGG - Intergenic
1021913677 7:25410642-25410664 CTAGTGTGGAGCAGGGCATGGGG - Intergenic
1021914644 7:25419280-25419302 CTAGGGTGAAGTAAGTGAGGAGG + Intergenic
1022027737 7:26464630-26464652 CTTGTGTGAAGGAGGAGGAGGGG + Intergenic
1023267605 7:38424027-38424049 CTAGTGTAATGGAGGTGATTGGG - Intronic
1025200158 7:56956911-56956933 CTGCTGTGAAGGAGGTTATGGGG + Intergenic
1025671787 7:63620021-63620043 CTGCTGTGAAGGAGGTTATGGGG - Intergenic
1026451953 7:70537171-70537193 CTGGTGGGAAGGAGGTGGAGGGG - Intronic
1026889471 7:73973602-73973624 CTAGTGGGGAGGTGGTGGTGTGG - Intergenic
1029416539 7:100446616-100446638 GTTGTGTGAAGGAGCTGGTGGGG + Intergenic
1030111086 7:106027478-106027500 CTAGTGAGAAGGGGGAGATGAGG + Intronic
1033045378 7:137957503-137957525 CTAGGGTGAAGGAGGACTTGGGG - Intronic
1033075551 7:138247033-138247055 CCAGGGGGAAGGAGGAGATGGGG - Intergenic
1034600418 7:152248061-152248083 CAAGTCTGAAGAAGGTGTTGGGG + Exonic
1034829063 7:154293504-154293526 CCAGGATGAAGGAGTTGATGGGG - Intronic
1036542342 8:9729221-9729243 ATAGTGTTAAGGAGGTGACTGGG - Intronic
1038574793 8:28695722-28695744 CCAGAGGGAAGGAGGTCATGCGG + Intronic
1038981932 8:32769283-32769305 CGTGTGTGAAGGAGGTGAGGTGG + Intergenic
1039110308 8:34034612-34034634 TTACCGTGAAGGAGGTTATGAGG - Intergenic
1039221577 8:35337214-35337236 ATATTGGGAAGGAGGTGAGGGGG - Intronic
1040703490 8:50096415-50096437 TAATTGTGAAGGAGGCGATGGGG + Intronic
1041309161 8:56496724-56496746 CTAGTGAGATGGTGGTTATGAGG - Intergenic
1041420983 8:57666863-57666885 CTAGTGGGAAGGTAATGATGGGG - Intergenic
1041599159 8:59695165-59695187 CTAGTGAGAGGGGCGTGATGGGG + Intergenic
1042505296 8:69553084-69553106 CTAATGTGAAGGAGGTGTTCTGG - Intronic
1045895427 8:107210226-107210248 GTACTGAGAAGGAGGAGATGTGG + Intergenic
1047050281 8:121103983-121104005 CTAGCCTGAAGGAGAGGATGCGG + Intergenic
1049146831 8:141006565-141006587 GTATTTTGAAGGAGGGGATGTGG - Intergenic
1050437002 9:5621533-5621555 CTAGTGAGAAGAAGATGAGGAGG - Intergenic
1053444411 9:38140675-38140697 CTAGGGTAAAGGAGGTGAGAAGG - Intergenic
1053901059 9:42795931-42795953 CTATGTTGAAGAAGGTGATGGGG + Intergenic
1054260586 9:62861633-62861655 CTATGTTGAAGAAGGTGATGGGG - Intergenic
1055019631 9:71655944-71655966 AAATTGTGAAGGAGGTTATGTGG - Intergenic
1057027630 9:91746998-91747020 CTAGTGGGAGGGAAGTGGTGGGG - Intronic
1058691162 9:107521878-107521900 CAAGTGGGGAGGAGGAGATGAGG - Intergenic
1058807260 9:108604483-108604505 CTTGGGTGGAGAAGGTGATGAGG - Intergenic
1058928385 9:109691662-109691684 CTTGTGAGAAGGAGGGGTTGGGG - Intronic
1059325783 9:113503437-113503459 GGAGTGTGAAGGAGGGGAAGAGG - Intronic
1059507498 9:114813185-114813207 GGAGAGTGAAGGCGGTGATGAGG + Intergenic
1061386931 9:130295877-130295899 CTAGAGTGTGGGTGGTGATGTGG + Intronic
1061420252 9:130469738-130469760 TTAATGTTAAGGTGGTGATGGGG + Intronic
1062532725 9:137008987-137009009 AGAGTGTGAAGGACGTGGTGCGG - Exonic
1203427042 Un_GL000195v1:50877-50899 CTACAGTGAGAGAGGTGATGTGG + Intergenic
1186530452 X:10290165-10290187 CAAGTGTGCAGGAGATGATGAGG - Intergenic
1191146217 X:57167653-57167675 CCAGTGTTAAGGATGTGAAGTGG + Intergenic
1194681008 X:96852619-96852641 CTAGAGTGAGGGAGGAGATTGGG + Intronic
1195032055 X:100935880-100935902 CTAGTGCTAGGGAGGTGATCTGG + Intergenic
1195086300 X:101417567-101417589 CTGCTGTGACGGAGGTGGTGGGG - Intergenic
1195976628 X:110534272-110534294 TTAGAGGGATGGAGGTGATGAGG + Intergenic
1198138754 X:133781660-133781682 CTAGTGGGAAGGTGGGGAAGAGG + Intronic
1198613904 X:138432587-138432609 CTTTAGTGAAGAAGGTGATGAGG + Intergenic
1200846796 Y:7838641-7838663 CTGTTGTGAAAGAGGTGAGGAGG - Intergenic