ID: 1179299184

View in Genome Browser
Species Human (GRCh38)
Location 21:40091064-40091086
Sequence GCCTTTCTTACAACTAATGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 106}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179299184_1179299188 4 Left 1179299184 21:40091064-40091086 CCGCCATTAGTTGTAAGAAAGGC 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1179299188 21:40091091-40091113 AATTAGGATGTCTATAAAAAGGG 0: 1
1: 0
2: 5
3: 26
4: 324
1179299184_1179299191 26 Left 1179299184 21:40091064-40091086 CCGCCATTAGTTGTAAGAAAGGC 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1179299191 21:40091113-40091135 GAAACTAGGTGTGAGGTAAATGG 0: 1
1: 0
2: 5
3: 51
4: 360
1179299184_1179299189 12 Left 1179299184 21:40091064-40091086 CCGCCATTAGTTGTAAGAAAGGC 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1179299189 21:40091099-40091121 TGTCTATAAAAAGGGAAACTAGG 0: 1
1: 0
2: 4
3: 38
4: 535
1179299184_1179299187 3 Left 1179299184 21:40091064-40091086 CCGCCATTAGTTGTAAGAAAGGC 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1179299187 21:40091090-40091112 TAATTAGGATGTCTATAAAAAGG 0: 1
1: 1
2: 0
3: 21
4: 352
1179299184_1179299190 19 Left 1179299184 21:40091064-40091086 CCGCCATTAGTTGTAAGAAAGGC 0: 1
1: 0
2: 0
3: 6
4: 106
Right 1179299190 21:40091106-40091128 AAAAAGGGAAACTAGGTGTGAGG 0: 1
1: 1
2: 7
3: 87
4: 562

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179299184 Original CRISPR GCCTTTCTTACAACTAATGG CGG (reversed) Intronic
902830369 1:19008469-19008491 CCCTGTCTTAGAACTCATGGTGG + Intergenic
907064641 1:51468462-51468484 GCATTTCTTACAAATCTTGGTGG + Exonic
910561295 1:88594775-88594797 GTGTTTCTTACAATAAATGGTGG - Intergenic
912024123 1:105145421-105145443 GCCTTTCTGACATTTCATGGAGG - Intergenic
1063162657 10:3430944-3430966 GGCCTACTTACAAGTAATGGTGG - Intergenic
1069117377 10:64524822-64524844 GCCTTTCTGACAACTAAGAAAGG - Intergenic
1069221005 10:65883446-65883468 GCATTTCTAAAAACTAATAGTGG - Intergenic
1070572670 10:77651793-77651815 GCCTTTGCTACAATTAATGAAGG + Intergenic
1071150173 10:82624868-82624890 TCCTTTCTTAAAATTAATGAGGG - Intronic
1072825864 10:98605651-98605673 GCCCTTCATACAAATAATAGTGG - Intronic
1074399989 10:113134121-113134143 GCCTTGCTCCCAGCTAATGGTGG - Intronic
1080973660 11:37308702-37308724 GCCTTTTTTACTACTGATGAAGG + Intergenic
1084313239 11:68328816-68328838 GCCTTTCTTGCATCAAATGCTGG + Intronic
1086574200 11:88319968-88319990 TCCTTTCTGACAGCAAATGGAGG - Intronic
1093363035 12:18255684-18255706 GCCTTTCTTTCAACTAGATGTGG - Intronic
1094500342 12:31015792-31015814 GCCTGTCAAACAAATAATGGGGG - Intergenic
1098577075 12:72054563-72054585 GCCTTTCTTACAATTAGGTGTGG + Intronic
1099606848 12:84813722-84813744 GACTTTTTTTCAACAAATGGTGG - Intergenic
1104759753 12:131289815-131289837 GGCTTTCTCAGGACTAATGGTGG - Intergenic
1109934637 13:69265103-69265125 GCCTTTCTGGCTACCAATGGTGG + Intergenic
1110437532 13:75492194-75492216 GCCTGTCTTGAAACTAATGGTGG + Intergenic
1113091394 13:106620129-106620151 GCCTTACTTACCACTAGGGGGGG - Intergenic
1113260028 13:108551689-108551711 GCCTTTCCTACAAATCTTGGGGG - Intergenic
1125975556 15:43948369-43948391 CCCATGCTTACAAGTAATGGTGG - Intronic
1129033318 15:72633963-72633985 GACTTTCATACAAATAATGAAGG + Intergenic
1129216567 15:74103267-74103289 GACTTTCATACAAATAATGAAGG - Intronic
1129408097 15:75332799-75332821 GACTTTCATACAAATAATGAAGG + Intergenic
1133735297 16:8610421-8610443 GCCTTTCTTCCAGCTCCTGGTGG - Intergenic
1142885001 17:2907099-2907121 GACTTTGTTAGAACTACTGGGGG - Intronic
1142909451 17:3075169-3075191 GGCTTTTATGCAACTAATGGTGG + Intergenic
1142925103 17:3228939-3228961 GGCTTTTATGCAACTAATGGTGG - Intergenic
1146502168 17:33373491-33373513 GCCTTTGTGAAAACTAATGAGGG + Intronic
1148331971 17:46818653-46818675 GACTTTGTTCCAACTATTGGGGG - Exonic
1149341465 17:55690766-55690788 GCCTTTCTTGCAGCTTATGGTGG + Intergenic
1150419828 17:65023145-65023167 GGCTGTGTTACAACTGATGGTGG + Intronic
1154458746 18:14557408-14557430 GCCGCTCTTGCAACTAAAGGTGG - Intergenic
1155435684 18:25810552-25810574 GCCTTTCTTATTTCTACTGGTGG + Intergenic
1157491593 18:48127570-48127592 GCCTTCCTCACAACCAGTGGGGG - Intronic
925860075 2:8166107-8166129 TCCTTCCTTACAGCTGATGGTGG - Intergenic
927450980 2:23209355-23209377 ACTCTTCTTACAACTGATGGAGG - Intergenic
928806310 2:35160968-35160990 GCCTTTCTTTCTTCTAAGGGAGG - Intergenic
929745196 2:44649924-44649946 GCCTCCCTCACAACTTATGGTGG - Intronic
933779321 2:85790624-85790646 CCCTTTCTCACAGCTAGTGGAGG + Intergenic
934512784 2:94960667-94960689 GCCAGTCTTACAACTAGTGATGG - Intergenic
938161863 2:128992605-128992627 GCCTTTTTAACAAATAATGTTGG + Intergenic
939383526 2:141466494-141466516 GTCTTTCTTGCAAATAAGGGTGG + Intronic
940817511 2:158312081-158312103 GCTTTTCTCACAACTCCTGGGGG - Intronic
945298389 2:208193364-208193386 TCCTTTCTGACAACAAATGAAGG + Intergenic
946217261 2:218194091-218194113 GCCTTCTTTACACCTAACGGTGG + Intergenic
1168833654 20:861947-861969 GCCTCTCTTACAGCTACTGGTGG + Intergenic
1168919088 20:1516072-1516094 GCCTTTCTTCCAGGTAAGGGGGG - Intergenic
1171008859 20:21495749-21495771 GGTTTTCTTTCAACTGATGGAGG - Intergenic
1175456392 20:59118146-59118168 GCCTTTCTTACAAAAAGTGAGGG - Intergenic
1179299184 21:40091064-40091086 GCCTTTCTTACAACTAATGGCGG - Intronic
1184027378 22:41867849-41867871 GCCATTCTGATAACTAGTGGTGG + Intronic
950886691 3:16368357-16368379 GTCTTTAATACAACTAATGTAGG - Intronic
951872263 3:27377077-27377099 GTTTTTCTTACAACTAAAGAGGG + Intronic
956993300 3:74794497-74794519 GCCTTGCTCACAGCTAGTGGAGG + Intergenic
957836874 3:85605688-85605710 GCTTTTCTTACAATTACAGGTGG - Intronic
960593019 3:119383266-119383288 TTCTTTCTTGCAACTAGTGGTGG + Intronic
960779984 3:121310078-121310100 GTCTTTTTAACAAATAATGGTGG + Intronic
961702952 3:128760965-128760987 GCCTTTCTTACAGATAAGGATGG + Intronic
963711541 3:148753155-148753177 GCATTTTTTAAAACTACTGGGGG + Intergenic
964575699 3:158165214-158165236 GCTTTTCCTGCAATTAATGGAGG + Intronic
964766813 3:160187364-160187386 GCCTTTCTTGCAATTAACAGTGG - Intergenic
965887898 3:173471365-173471387 GCCTTTCTTTCAGCTTCTGGTGG + Intronic
966377623 3:179312986-179313008 GCCTCTCTTACAGATAAGGGTGG - Intergenic
966931681 3:184679394-184679416 GTCTTTCTTGCCACTTATGGGGG - Intronic
967301804 3:188021596-188021618 GCTTTTCTTCCAGCTCATGGTGG - Intergenic
971243026 4:24905805-24905827 GCCTCTCTTACAACTAGGAGTGG + Intronic
972574278 4:40337765-40337787 GCCTCTCTTCTAGCTAATGGTGG + Intronic
977493710 4:97747092-97747114 TCCTTTCTTACAGCTAAGGTTGG - Intronic
977820548 4:101467297-101467319 ACATTTCTCACAACTAATGAGGG - Intronic
978042755 4:104090276-104090298 ACATTTCTTATAACTATTGGAGG + Intergenic
980975877 4:139609929-139609951 GCCTTGCTTACAACTAGAGATGG - Intergenic
984414828 4:179445106-179445128 CCATTTTTTAAAACTAATGGTGG + Intergenic
984770838 4:183435193-183435215 TCCTTTCTTAAAATTAATTGAGG + Intergenic
985060125 4:186069746-186069768 GGCTTTCTTTCACCTAATGAAGG + Intronic
987799068 5:22669514-22669536 GCTTTTCTTGCAACTAAAGGTGG + Intronic
988607352 5:32690211-32690233 GCCTCTCTTGAAACTAAGGGAGG - Intronic
990426279 5:55692959-55692981 GTCTTTCTTAAAACTAGAGGTGG - Intronic
990950539 5:61294173-61294195 GGGTTTCTTTCAACAAATGGAGG + Intergenic
992603374 5:78428288-78428310 GTCTTTCTAACAAGTAGTGGAGG - Intronic
995578134 5:113563454-113563476 GCATTTCTTACAATTAAAGCTGG - Exonic
995624733 5:114063984-114064006 TCTTTTCTCACAACTTATGGTGG + Intergenic
1000254125 5:159521537-159521559 TCCCCTCTTACTACTAATGGAGG - Intergenic
1002014537 5:176309279-176309301 GCCTTTCTGACAAATTATGCTGG + Intronic
1004230462 6:13828626-13828648 GCCTTTCTTACACCTGAGGCTGG - Intergenic
1005927567 6:30456405-30456427 GTCTTTCTTAAAACTAAAGTAGG + Intergenic
1006623207 6:35381684-35381706 GCCTCCCTTGCAACTAATGGAGG - Intronic
1010035598 6:71321980-71322002 CCCTTTCTTGAAACTGATGGAGG + Intergenic
1011266540 6:85526170-85526192 GACTTTCTTTCCCCTAATGGTGG - Exonic
1012971914 6:105740199-105740221 ACTTTTCTTACAGCTAATTGTGG - Intergenic
1014319060 6:119903699-119903721 GCCTCTTTTACAACTCAGGGTGG + Intergenic
1026434473 7:70383437-70383459 GGCTTTCTTACAGGCAATGGGGG - Intronic
1028451376 7:90988501-90988523 GCTTATTTTGCAACTAATGGAGG - Intronic
1035941855 8:3910135-3910157 GCTTTTCTTACAACTTATGTCGG + Intronic
1040985799 8:53293066-53293088 TCCTTACTTTCAACTAATGTTGG + Intergenic
1043151113 8:76717111-76717133 GGTTTCCTTACAACTACTGGAGG + Intronic
1050706914 9:8410611-8410633 GCCTTTTCTACTACTAAAGGTGG - Intronic
1052491433 9:29174957-29174979 GCCTTTCATTAAAATAATGGTGG + Intergenic
1191579127 X:62740776-62740798 GCCTTTCCCACAACTAATTCGGG + Intergenic
1193214200 X:78843200-78843222 GCCTTTATTACAAATGATGCTGG + Intergenic
1195155154 X:102115651-102115673 GCCTGCCTGACTACTAATGGTGG - Intergenic
1198340468 X:135708673-135708695 GCCTTTCTTACCACTAAATAAGG - Intergenic
1198347488 X:135773043-135773065 GCCTTTCTTACTACTAAATAAGG + Intergenic
1198349393 X:135790304-135790326 GCCTTTCTTACTACTAAATAAGG + Intergenic
1198351298 X:135807577-135807599 GCCTTTCTTACTACTAAATAAGG + Intergenic
1198353206 X:135824843-135824865 GCCTTTCTTACTACTAAATAAGG + Intergenic
1198355114 X:135842097-135842119 GCCTTTCTTACTACTAAATAAGG + Intergenic
1198357024 X:135859380-135859402 GCCTTTCTTACTACTAAATAAGG + Intergenic
1198358938 X:135876659-135876681 GCCTTTCTTACTACTAAATAAGG + Intergenic
1198365417 X:135934891-135934913 GCCTTTCTTACCACTAAATAAGG + Intergenic