ID: 1179302077

View in Genome Browser
Species Human (GRCh38)
Location 21:40121560-40121582
Sequence CTAGAGACATAGAAATATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 320}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179302077_1179302079 -1 Left 1179302077 21:40121560-40121582 CCATCATATTTCTATGTCTCTAG 0: 1
1: 0
2: 0
3: 28
4: 320
Right 1179302079 21:40121582-40121604 GTCTTTTTAATATGGTCAAAAGG 0: 1
1: 0
2: 0
3: 22
4: 310
1179302077_1179302078 -9 Left 1179302077 21:40121560-40121582 CCATCATATTTCTATGTCTCTAG 0: 1
1: 0
2: 0
3: 28
4: 320
Right 1179302078 21:40121574-40121596 TGTCTCTAGTCTTTTTAATATGG 0: 1
1: 0
2: 3
3: 26
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179302077 Original CRISPR CTAGAGACATAGAAATATGA TGG (reversed) Intronic
901145056 1:7059158-7059180 CTAGAGAGATAGAAACATCTGGG - Intronic
902126645 1:14219154-14219176 ATAGAGACATAAAAATAACAGGG + Intergenic
902779798 1:18697668-18697690 CTAGGGACATAGGACAATGAAGG + Intronic
905130862 1:35756082-35756104 CTAGAAAAAGAGAAAAATGAAGG + Intronic
907815104 1:57910985-57911007 CCAGATACTTAGAAATATGTAGG + Intronic
908101713 1:60797824-60797846 ATAGAGACATAAAAAAATGATGG + Intergenic
908554786 1:65247051-65247073 CTAAAGAGAGAGAAATAAGAAGG - Intergenic
909459478 1:75893606-75893628 CTAGAGGCAAAGAAATGTGGTGG - Intronic
910135715 1:83966689-83966711 ATAGAACCAAAGAAATATGATGG - Intronic
911117475 1:94260722-94260744 CATGAGACAAAGAAAAATGAAGG + Intronic
911237704 1:95429313-95429335 CTAGAGACACAGTCCTATGAAGG - Intergenic
912077499 1:105893541-105893563 ATACAGAGATAGAAATCTGAAGG - Intergenic
913235940 1:116783571-116783593 TTGGAGAAATAGAAATAAGACGG - Intergenic
913383801 1:118238197-118238219 CTAGAAACATACAAACATGGTGG - Intergenic
914378101 1:147091287-147091309 ATAGATAGATAGATATATGATGG + Intergenic
914387005 1:147179496-147179518 CTAAATCCAAAGAAATATGAAGG + Intronic
915408077 1:155677018-155677040 CTAGGGACAGAGAAATATATGGG + Intronic
916447983 1:164891353-164891375 CTAGAGACCTAGAAAAGTCAAGG - Intronic
917131152 1:171742998-171743020 CTAAAGACATAAAAATAAGAGGG + Intergenic
917529294 1:175819839-175819861 CCAGAGAAATATAAAAATGATGG + Intergenic
917874723 1:179275968-179275990 CAAGAGAAATAGAAACATTAAGG - Intergenic
919127126 1:193408633-193408655 ATAGAGAGATAGACAGATGATGG - Intergenic
919330576 1:196165076-196165098 CTAGACACATAGTAAGATGTAGG - Intergenic
919414005 1:197283600-197283622 CTAGATAGATAGATACATGATGG - Intronic
919418276 1:197338946-197338968 CTAGAGAGTTAAAAATGTGAGGG + Intronic
920437654 1:205958236-205958258 ATAGAGGCAGAGAAATATGAAGG - Intergenic
920495676 1:206453447-206453469 CTGGAGCCATAGGACTATGAGGG + Intronic
921101668 1:211933957-211933979 CTGGTTACAGAGAAATATGAAGG + Intergenic
921371376 1:214426527-214426549 CTAGAGAAAAAAAAAAATGATGG + Intronic
921419714 1:214932250-214932272 CAAGAGACATAGAGATTTGAGGG - Intergenic
922004356 1:221514291-221514313 TTAAAGCAATAGAAATATGAAGG + Intergenic
922892051 1:229069365-229069387 ATAGATACATAGACAGATGATGG + Intergenic
1063462202 10:6221954-6221976 CTAGGGACATAGAACTATATGGG + Intronic
1063599772 10:7469868-7469890 CTAGAGACACGGAAAGCTGATGG + Intergenic
1063637223 10:7794338-7794360 TAAGAGGCATAGAAATTTGAAGG - Intronic
1064133585 10:12731455-12731477 CTAGAGAAATAAAAGTATCAGGG + Intronic
1066267127 10:33787445-33787467 CTAGAGTCATAAAAAAATCATGG + Intergenic
1066650184 10:37647791-37647813 TGAGAGACATAGAAAGTTGAAGG - Intergenic
1067935654 10:50610264-50610286 AGAGAAAGATAGAAATATGAAGG + Intronic
1068354369 10:55891817-55891839 ATAGAGCCCTAGAAATATCAAGG + Intergenic
1069425461 10:68284924-68284946 TTAGAGGCAGAGAAAAATGATGG - Intronic
1072226810 10:93377854-93377876 TTAGAGACATAGAAATACAGAGG + Intronic
1073761337 10:106631867-106631889 CAAGAGAGATAGAAATTGGAGGG - Intronic
1074841239 10:117353732-117353754 CTACAGACAAAGCAAGATGAGGG + Intronic
1078712180 11:13804440-13804462 CTAAAGACATAAATATATGGGGG + Intergenic
1079570189 11:21933488-21933510 CAAAAGACATATAAATATCATGG + Intergenic
1079840443 11:25391626-25391648 ATATAGAAATATAAATATGAGGG - Intergenic
1080028992 11:27641270-27641292 CTAGAGAGATAGAAATAATGTGG + Intergenic
1080407556 11:31993177-31993199 CTAGAGACATAGGAAAATGCAGG + Intronic
1081721555 11:45293076-45293098 CTAATGACATAGAAGTATAAAGG + Intergenic
1082098486 11:48151339-48151361 AAAGAGACATAGACACATGAGGG - Intronic
1082754261 11:57057457-57057479 CTAGAGACAGAGAAAAATGCAGG + Intergenic
1085654696 11:78302826-78302848 CTATACAGATAGATATATGATGG + Intronic
1085746486 11:79119221-79119243 CTAGAGAAATAGAATTACTAGGG + Intronic
1086641744 11:89167200-89167222 CATGATACATAGAAATATCAAGG - Intergenic
1087592226 11:100204861-100204883 CTAGATACATACATATATGTAGG - Intronic
1087615750 11:100485233-100485255 AAAGAGAGATATAAATATGAGGG + Intergenic
1087799246 11:102486243-102486265 CTAGAGTCATAGAACTATAAGGG - Intronic
1087998955 11:104850660-104850682 CTACAGACTTCCAAATATGAAGG + Intergenic
1091198970 11:133756804-133756826 GTTGAGTAATAGAAATATGATGG - Intergenic
1091341167 11:134815163-134815185 CTGGAGTCAGAGAGATATGAGGG + Intergenic
1091525041 12:1291512-1291534 CTTGAGAGGCAGAAATATGAGGG + Intronic
1092149053 12:6234508-6234530 CTACAGCCATAGAAATAGGAGGG + Intronic
1093143350 12:15535977-15535999 ATAGATACATAGAAATCTGTAGG + Intronic
1093773627 12:23047020-23047042 CTAATGACATAGAGATGTGAGGG + Intergenic
1093799470 12:23355704-23355726 CTAAAGAGACAGAAATAGGAGGG - Intergenic
1093862014 12:24177335-24177357 GATGAGACATAGAAATATGGTGG - Intergenic
1094192719 12:27713324-27713346 GTAGATATATAGACATATGATGG + Intronic
1095628732 12:44348783-44348805 CTCAAGACATAGAAGTGTGAGGG + Intronic
1095705110 12:45228636-45228658 CTGGAGACATGGAAATACGGAGG + Intronic
1096017326 12:48288986-48289008 TAAGAGACAGAGAAAAATGAAGG + Intergenic
1096817295 12:54209610-54209632 CTAGAGACATACAGAAAGGAGGG + Intergenic
1097391711 12:59022769-59022791 GTAGATACACAGAAATATAAAGG - Intergenic
1098552454 12:71778295-71778317 CAAGAAACATACAAATATTAAGG - Intronic
1099825327 12:87769607-87769629 CTAAAGAGATAGAAATATGGAGG + Intergenic
1100101080 12:91106726-91106748 AAAGAGAAAAAGAAATATGATGG - Intronic
1100845150 12:98650587-98650609 TAAGAGACTTAGAAATATGGAGG + Intronic
1100909493 12:99342071-99342093 CTAGAGACCTAGGAATATGGTGG + Intronic
1100956500 12:99914880-99914902 CTAGAGGCAATGAAAGATGAAGG - Intronic
1102508083 12:113396634-113396656 CTAGAAACAAAGAAAAAGGAAGG - Intronic
1102889892 12:116550383-116550405 CAAGAGAAATGGAAATATGATGG + Intergenic
1102909966 12:116705907-116705929 TTAGAGCAATACAAATATGAAGG - Intergenic
1103239575 12:119401735-119401757 CTATAAACAGAGAAATGTGATGG - Intronic
1107784789 13:43943985-43944007 CCAGACAGAAAGAAATATGAAGG + Intergenic
1108059578 13:46519262-46519284 CTCGAGACTTAGAGATTTGAAGG + Intergenic
1109298654 13:60566980-60567002 CTAGAGACAGAAAAAAATAATGG - Intronic
1109592223 13:64500542-64500564 GAAGAGCCATAGAAATATGCTGG + Intergenic
1109648915 13:65298666-65298688 CAAGTAACATAGAAATATTATGG - Intergenic
1109833443 13:67824628-67824650 CTAGAGACATAGAAACCGCATGG - Intergenic
1110592581 13:77282045-77282067 CTAGAGACAGAGAAAAAAGGAGG + Intronic
1110947477 13:81441166-81441188 CTACTGACATAGAAATTTGCAGG - Intergenic
1111517961 13:89360053-89360075 CTAGATACATATAAATTTTAAGG + Intergenic
1111961667 13:94817448-94817470 ATAGATACATAGATAGATGATGG - Intergenic
1112074064 13:95889249-95889271 CTCAAGACATATAAATTTGAAGG + Intronic
1112782063 13:102911651-102911673 CCAGAGACAAAGAACAATGATGG - Intergenic
1114362393 14:21989243-21989265 CTAGAGACACAGAAATGTCTAGG - Intergenic
1115173218 14:30531865-30531887 CTTGAGACAGAAAAATAGGAAGG + Intergenic
1116596352 14:46852051-46852073 CAATAGACCTAGAAATATGTTGG + Intronic
1118545444 14:66882369-66882391 CTCTAGACATAAAAATAGGAAGG - Intronic
1119621517 14:76135379-76135401 CTAGAGACAAAGGCATATGCTGG - Intergenic
1119909074 14:78333505-78333527 CTAGATACATAGATAGATGCTGG + Intronic
1122250177 14:100433189-100433211 CTAAAGAGATAGAATGATGAAGG - Intronic
1125222733 15:37358089-37358111 CTAGAGACAAACAACTAGGATGG - Intergenic
1125358141 15:38838178-38838200 CTGGATACATAAAAAAATGAAGG - Intergenic
1128705569 15:69835370-69835392 CCAGAGACATAAAAAAATGCTGG - Intergenic
1129553037 15:76473971-76473993 CTAAAAACATAAAAATTTGATGG - Intronic
1133109040 16:3534690-3534712 TTAGAGAAAGAGAAAAATGAGGG + Intronic
1134903518 16:17959826-17959848 CTAGAGACAGAATAATAGGATGG - Intergenic
1135038594 16:19099377-19099399 CTAGAGAGCAGGAAATATGATGG + Intergenic
1135131822 16:19859733-19859755 GTAGAGCCATAGAAATATTCTGG - Exonic
1136627555 16:31471602-31471624 CCAGACACAAAGAAATCTGAGGG - Intronic
1138723764 16:59113140-59113162 ATGGAGAGAAAGAAATATGATGG - Intergenic
1139011084 16:62635087-62635109 CTAGAGACATTAGAAAATGATGG - Intergenic
1143068739 17:4271561-4271583 ATAGAGGCAGAGAAATATGAAGG + Exonic
1147496448 17:40921097-40921119 ATAGAGACAAAAAAATATGCAGG + Intergenic
1148831980 17:50439527-50439549 CTAGAGATATAGTAATAGCATGG - Intronic
1149084334 17:52696411-52696433 ATAGAGAAATAGAATTTTGAAGG + Intergenic
1149284923 17:55151710-55151732 CTAAAGACAAATAAATATGATGG - Intronic
1150610517 17:66729683-66729705 CCAGAGACATTAAAACATGAGGG - Intronic
1150957413 17:69874479-69874501 CTAGAGTCTCAGAAATATGTTGG - Intergenic
1150985539 17:70193138-70193160 ATAGAAACGTAGAAAAATGAAGG - Intergenic
1151391340 17:73788869-73788891 CAAGACACACAGAAATGTGAGGG - Intergenic
1151928843 17:77217994-77218016 CAACAGACACAGAAATATGAGGG - Intergenic
1153118185 18:1686656-1686678 CTTGATAGATAGAAGTATGAAGG - Intergenic
1153155790 18:2147440-2147462 CTGAAGACTTAGAAATGTGAAGG + Intergenic
1153948893 18:10040739-10040761 CTAGAGACCTAGGAATACGTTGG - Intergenic
1155449583 18:25949867-25949889 ATAAAGACATATAAAGATGATGG + Intergenic
1157436655 18:47676111-47676133 CTAAGGACATACACATATGATGG - Intergenic
1159283591 18:66320045-66320067 CTATTTACATATAAATATGAAGG - Intergenic
1159479914 18:68976692-68976714 TGAGAGAAATAGACATATGATGG - Intronic
1159499189 18:69247139-69247161 CTAGAGAAATGGCAATAAGAGGG - Intergenic
1160017049 18:75152684-75152706 CTGGAGACAAAGAAATACCACGG + Intergenic
1160085712 18:75775742-75775764 CTAGAGCAATAGAAACAGGAAGG + Intergenic
1160412436 18:78684010-78684032 TTAAACACATGGAAATATGAAGG + Intergenic
1162920036 19:13895552-13895574 TTAGAGACAGAGGAAGATGAAGG + Intronic
1163038653 19:14586721-14586743 AAAGAGACATAGAAATAGGCTGG - Intronic
1163216451 19:15881544-15881566 ATAGATACATAGATAGATGATGG + Intronic
1164687761 19:30179673-30179695 ATATAGATATAGATATATGAGGG + Intergenic
1164798003 19:31051619-31051641 CTAGATAGATAGACAGATGATGG + Intergenic
1166643353 19:44512968-44512990 CTAGAGGCACAGAATAATGAGGG - Intronic
1168190307 19:54733588-54733610 ACAGAGAAATAGAAAAATGATGG - Intronic
925141679 2:1554806-1554828 TGAGAGACATAGAAATAAGAGGG + Intergenic
925946368 2:8867709-8867731 CTAGAAACATATAAATATATTGG - Intronic
927202525 2:20587341-20587363 ATAGCTACATAGAAACATGATGG + Intronic
927295034 2:21444335-21444357 ATACAGACGTAGAAATGTGAAGG + Intergenic
928711518 2:34011752-34011774 ATAAAGAGATAGAAGTATGATGG + Intergenic
929018869 2:37530475-37530497 CTACAGTCAGAGAAATATAAAGG - Intergenic
929314985 2:40466174-40466196 CTAGAGAGTTATAAATGTGAGGG - Intronic
931601019 2:64002618-64002640 TTAGAAACCTAGAAATATGCAGG + Intronic
931861230 2:66356569-66356591 CTTGAAACAAAGAAATTTGATGG - Intergenic
932524771 2:72453033-72453055 CTTTAGACTTAGAAATATTAGGG + Intronic
933405095 2:81847889-81847911 CTATTGTCATAGAAAAATGAGGG - Intergenic
933433922 2:82220508-82220530 GTAGAGGAATAGAGATATGATGG - Intergenic
933679177 2:85083759-85083781 CTAGAAACACAAAAATATGAAGG + Intergenic
934306138 2:91823760-91823782 CTATATACATATATATATGAAGG - Intergenic
934327118 2:92028982-92029004 CTATATACATATATATATGAAGG + Intergenic
934465499 2:94259549-94259571 CTATATACATATATATATGAAGG + Intergenic
934917457 2:98311796-98311818 CTAGAGACAGAGAGAGATCAGGG - Intronic
938024416 2:127933648-127933670 CTATAGACCTAGAACTATTAAGG + Intergenic
939301299 2:140343673-140343695 CTAGTGACATACAAGTATGTAGG + Intronic
939588802 2:144037745-144037767 TTAGATACATATAAATATGCAGG + Intronic
939922369 2:148132259-148132281 CTAGAAAAATAAAAATGTGAAGG - Intronic
940692906 2:156941667-156941689 ATAGATACATAGATAGATGATGG + Intergenic
940714770 2:157208745-157208767 TTATAGACATAGAAATATTAAGG + Intergenic
941214968 2:162695272-162695294 GTAGAGACATAAAAATATTCTGG - Intronic
941226968 2:162862654-162862676 CTACATACATAGAACTATGTTGG - Intergenic
941536191 2:166724581-166724603 CCAGAGGAATAGAAATATCAAGG - Intergenic
941919594 2:170836578-170836600 TTAGAAACATAGAAGTTTGAGGG + Intronic
942881712 2:180869764-180869786 CCAGAGACATAGAAGTCTGGGGG - Intergenic
942978213 2:182044958-182044980 ATAGAGAGACAGAAAGATGAAGG - Intronic
943091461 2:183380431-183380453 CTAGAGAAATAGTAAGATGTTGG - Intergenic
943116447 2:183678195-183678217 CTAGAGACATTAAGTTATGAAGG + Intergenic
943217146 2:185052612-185052634 CTTGAGAAAAAGAAATCTGAAGG + Intergenic
943349045 2:186775732-186775754 CTAAAGACACAGAAATAAAAAGG + Intergenic
945363755 2:208925772-208925794 CTAGAGATAAAGCAATATTAGGG + Intergenic
945534340 2:210994365-210994387 GAAGACAAATAGAAATATGATGG - Intergenic
945679176 2:212892536-212892558 TGAGTGACAGAGAAATATGAGGG - Intergenic
946547588 2:220761707-220761729 CTAGAGAGAAAGACATATTATGG - Intergenic
946884150 2:224206336-224206358 ATAGAGCCATAGAAAGATGCTGG - Intergenic
947279283 2:228431151-228431173 GTAGAGACACAGAAATGTGATGG + Intergenic
947280657 2:228450090-228450112 GTAGAGACACAGAAGTAAGATGG + Intergenic
948302568 2:236919024-236919046 CTAGAGACATACAATTATTCCGG + Intergenic
1169753479 20:9019730-9019752 CTAGTGAAATAGAAATGTGGGGG - Intergenic
1169995266 20:11548848-11548870 AAAGAGAGATAGAAATATTATGG - Intergenic
1170402717 20:16005104-16005126 CTTTAGACATAGAAACAAGAAGG + Intronic
1177687862 21:24463387-24463409 AAAGAGAAACAGAAATATGATGG - Intergenic
1177796505 21:25784364-25784386 CTAGTGTCCTAGAAATCTGAAGG + Intergenic
1177916965 21:27100970-27100992 GTGAAGACATAGAAAGATGATGG - Intergenic
1178207980 21:30492554-30492576 CTAGAGTAATAGAAGAATGATGG - Intergenic
1179302077 21:40121560-40121582 CTAGAGACATAGAAATATGATGG - Intronic
1180586642 22:16898735-16898757 CTATATACATATATATATGAAGG + Intergenic
950448496 3:13052254-13052276 CTTGAGAGATGAAAATATGATGG - Intronic
951901606 3:27663178-27663200 CAAGAGACATAGAAATCTAAGGG - Intergenic
952588968 3:34928297-34928319 TTAGAGACATAGAAGTGGGAGGG + Intergenic
953676660 3:45007821-45007843 TTAGACACATAGAAATGAGATGG - Intronic
954828784 3:53400115-53400137 TTAGAGACTTAAAAAAATGAGGG - Intergenic
955455308 3:59113926-59113948 ATAGAGAAAGGGAAATATGAGGG + Intergenic
955655176 3:61238104-61238126 CTAGAAAGATAGCACTATGAGGG - Intronic
956119808 3:65954966-65954988 ATTGAGACTTAGAAAAATGAAGG + Intronic
957277851 3:78112121-78112143 ACAGAAATATAGAAATATGAAGG + Intergenic
957533496 3:81471121-81471143 CTGAAGACATAGATTTATGAGGG - Intergenic
957768278 3:84655446-84655468 CTAGAGACACAGAAAGGTGAAGG + Intergenic
958086444 3:88814293-88814315 CTATAGACATACAAAAATGTAGG + Intergenic
958095605 3:88940065-88940087 CACGAGACATAGAAATATTATGG - Intergenic
958580270 3:96009209-96009231 ATAGAGACTTAGAAGTATGAGGG + Intergenic
958606691 3:96367048-96367070 CTTTGTACATAGAAATATGATGG - Intergenic
959345862 3:105193559-105193581 GTAGAGAAATAAAAATATTATGG + Intergenic
959780754 3:110230546-110230568 CTAGAGACTTTGAAATCTCAAGG - Intergenic
960318832 3:116209422-116209444 CTAAAAATATAGAAATTTGAGGG - Intronic
960455517 3:117866515-117866537 CCAGAGACGAAGAAATAAGAAGG - Intergenic
960525833 3:118708749-118708771 AGAGACATATAGAAATATGAAGG + Intergenic
962847322 3:139283862-139283884 CTAGAGGGAGAGAAAGATGAGGG + Intronic
963326819 3:143872321-143872343 GTAGATAGATAGAAATATAATGG + Intergenic
963636180 3:147799350-147799372 CTAAAGACATAGAGATTAGATGG + Intergenic
964602959 3:158523425-158523447 CTATAGGGATAGACATATGAGGG + Intronic
965166590 3:165201557-165201579 TTAGCAACATAGAAATGTGAAGG - Intergenic
965344212 3:167527600-167527622 CCAGAGACATGGAAAGATGGGGG - Intronic
966160814 3:176966405-176966427 CTATAGTCCTAGAAATAAGAGGG - Intergenic
967505600 3:190249618-190249640 CTAGAGACAAACAGATATGTTGG + Intergenic
967755606 3:193164977-193164999 CTTGAAACTTAGAAAGATGATGG + Intergenic
970497914 4:16645807-16645829 ATTGAGACTTAGAAAGATGAAGG - Intronic
970711518 4:18869172-18869194 CTAGAGACATTTAAATGTGTAGG + Intergenic
971541146 4:27818175-27818197 ATAGAGACACATAGATATGATGG + Intergenic
971610958 4:28725994-28726016 ATAGATACATAGATAGATGAAGG + Intergenic
971628416 4:28955549-28955571 CTGGAGACTTAGAAATGTTAGGG + Intergenic
971637343 4:29078286-29078308 GTAGAGATATAGATATAGGAAGG + Intergenic
971680628 4:29695005-29695027 GTAGAAACATAGAACAATGAAGG - Intergenic
972045340 4:34658377-34658399 CCAGAGATATAGAGATATGTGGG - Intergenic
972401745 4:38710970-38710992 CTAGACAAATAAAAAAATGAGGG + Intergenic
973067398 4:45813285-45813307 CTAAACAAAAAGAAATATGAAGG + Intergenic
974367844 4:60975289-60975311 CTGGGTACATAGAAAAATGAAGG - Intergenic
974519888 4:62970557-62970579 CTATAGAGAGACAAATATGAAGG + Intergenic
976846348 4:89492307-89492329 CTAGAAACAGGGAAACATGAAGG + Intergenic
978096947 4:104789752-104789774 CTGGATACATAAAAAAATGAAGG + Intergenic
978551010 4:109927101-109927123 CTAGAAAGATAGAAATTTGCTGG + Intronic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
979829763 4:125284952-125284974 GTATAGACATAGATACATGAGGG - Intergenic
980263712 4:130488121-130488143 CAAGAAACAAAGTAATATGAGGG + Intergenic
980485742 4:133455766-133455788 CTAGAAACATGGGAAAATGATGG + Intergenic
980941144 4:139275853-139275875 ATAGATTTATAGAAATATGATGG - Intronic
981627683 4:146777536-146777558 ATAGAGAAAAAGTAATATGAAGG - Intronic
982391005 4:154863761-154863783 ATAGGAACATAGAAAGATGAGGG - Intergenic
982995760 4:162342869-162342891 CTAGATACATAGATAACTGATGG - Intergenic
983801941 4:171942283-171942305 GTAAAGACAGAGAAAAATGAGGG + Intronic
983974323 4:173914655-173914677 CTAGAGAAATAGAAACAAAATGG + Intergenic
984039695 4:174715869-174715891 ATATAGATATATAAATATGACGG - Intronic
986048160 5:4060844-4060866 TTAGAGAAATGGAAAGATGATGG + Intergenic
986097402 5:4573389-4573411 AAAGGGACATAGAAATATAATGG + Intergenic
986189669 5:5483516-5483538 CTAGAGTCACAGAAATGTGGTGG + Intronic
986937645 5:12910347-12910369 CTAGAGTCTTAAAAATAAGAAGG - Intergenic
987712954 5:21527861-21527883 CTAGAGAAACAGAAAGCTGATGG - Intergenic
987933778 5:24436263-24436285 CAAGACATATAAAAATATGATGG + Intergenic
988638660 5:33016642-33016664 CTACAGCGATAGAAAAATGATGG + Intergenic
991480149 5:67069343-67069365 CCAAAGAACTAGAAATATGAAGG - Intronic
992414590 5:76540116-76540138 CCAGTGACTTAGAAATATAAAGG + Intronic
992673008 5:79078288-79078310 CTAGAGGTAAAGAACTATGATGG + Intronic
993096206 5:83481524-83481546 CCAGAAACATAGAAACATTATGG + Intronic
995559122 5:113362062-113362084 ATATAGACATAGATATATGAGGG - Intronic
998817683 5:146030528-146030550 CTACAGACGTAGACAGATGAGGG - Intronic
1000640197 5:163693014-163693036 CAAGTGTCATAAAAATATGAAGG - Intergenic
1000763768 5:165258930-165258952 CTTGAAACATAGAAATGTAAAGG + Intergenic
1001376312 5:171262263-171262285 CTTGAAATGTAGAAATATGAAGG + Intronic
1004791048 6:19026880-19026902 CTACTGACCTGGAAATATGATGG + Intergenic
1005414162 6:25583546-25583568 CTGGAGACATAGATGGATGAAGG + Intronic
1005449292 6:25957450-25957472 CTAGGTACATAAAAATAGGATGG - Intergenic
1005509969 6:26503826-26503848 ATAAAAACATAGAAATTTGATGG + Intronic
1008366293 6:50684354-50684376 GTAGGGACATAGTAAAATGAAGG + Intergenic
1009003769 6:57754051-57754073 CTAGAGAAACAGAAAACTGATGG + Intergenic
1009650122 6:66465183-66465205 CAAAAGACAGAGAAATATGAGGG - Intergenic
1010465009 6:76157490-76157512 ATATAGATATAGATATATGATGG - Intergenic
1011999367 6:93634823-93634845 CTAGATACATAACAAAATGAAGG - Intergenic
1012182824 6:96176281-96176303 GTAGAGAGATATAAATAGGAGGG - Intronic
1012310673 6:97720439-97720461 CAAGAGAAATATAAATTTGAAGG + Intergenic
1012456321 6:99410211-99410233 CTAGGGACATAGAACTCTGTGGG - Intronic
1013016177 6:106162373-106162395 ATAGATAAATATAAATATGATGG - Intergenic
1014473983 6:121850194-121850216 CTAGAGATATAGAGCTATAAAGG - Intergenic
1016675488 6:146761970-146761992 ATGGAGACATACAAATAAGAGGG - Intronic
1017301478 6:152865103-152865125 CTAGATAGATAGAAAGTTGATGG + Intergenic
1018279944 6:162174480-162174502 ATATAGAAATAGAAATATGCAGG - Intronic
1020342975 7:7132446-7132468 TGACAGCCATAGAAATATGATGG + Intergenic
1020523091 7:9220104-9220126 CTAAACAAATAGAAATTTGAAGG - Intergenic
1022731150 7:33026999-33027021 TTAAAGACATAAAAATATTAAGG + Intronic
1022781684 7:33591388-33591410 CTAAAGACATAGAAATTTTAAGG - Intronic
1022828665 7:34042909-34042931 ACAGAGACATAGAAAGATGGAGG + Intronic
1024309540 7:47956955-47956977 CCAGATACATATAAAGATGAAGG + Intronic
1027650263 7:80858061-80858083 TTAGACACATAAAAATATTAAGG - Intronic
1028012116 7:85658859-85658881 TTAAAAACATTGAAATATGAGGG + Intergenic
1028115398 7:86991439-86991461 CTAGAAACAAAGAAATCTGGAGG - Intronic
1029122799 7:98279921-98279943 CTTGTGATAAAGAAATATGATGG + Intronic
1030429788 7:109430605-109430627 ATAGATAGATAGATATATGATGG - Intergenic
1030450929 7:109710024-109710046 CTATAAACTTAGAAAAATGATGG - Intergenic
1031057129 7:117003922-117003944 GTAGAGACAATGAAAAATGAAGG - Intronic
1031517392 7:122718272-122718294 CCAGATATATAGGAATATGATGG - Intronic
1032636416 7:133713987-133714009 GCTGAGACATAGAAATATGGCGG + Intronic
1033018964 7:137702379-137702401 CTAGAAGCACAGAAATAGGAAGG - Intronic
1033319111 7:140323753-140323775 CTATAGACACAGAAGTGTGATGG + Intronic
1033562447 7:142545338-142545360 GTAGAGACTTAGGAATAAGAGGG - Intergenic
1034898179 7:154890918-154890940 CTAGTGTCATAGAAAGATGTAGG + Intronic
1035096511 7:156360395-156360417 CTAGAGTCAAAGAAGTACGAGGG + Intergenic
1037719153 8:21428156-21428178 CAAGAGAAATAGAAACATTAAGG - Intergenic
1038622779 8:29159731-29159753 CTTGAGACATGCACATATGAAGG + Intronic
1038755416 8:30336100-30336122 AGAGAGACAAAGAAATAGGAAGG + Intergenic
1039404609 8:37301772-37301794 CTAGGGATACAGAAATCTGAGGG + Intergenic
1043532134 8:81162554-81162576 CAAGAGACATAGCAAAATAAAGG - Intergenic
1043603834 8:81974907-81974929 CTATAGAGCTAGAAATAAGAAGG + Intergenic
1044208745 8:89523611-89523633 CTAAAAACACAGAAATTTGATGG - Intergenic
1045106113 8:98894250-98894272 CTACAGACAATGAAATATGTGGG - Intronic
1046307444 8:112387981-112388003 GTAGTAACATTGAAATATGATGG + Intronic
1046373484 8:113344010-113344032 CTATATACCTAAAAATATGAAGG - Intronic
1046403822 8:113745510-113745532 ATAGAGTCATAGATATATCAGGG + Intergenic
1047048750 8:121085076-121085098 CAATAGACAAAGAAATATAAAGG + Intergenic
1051902919 9:22062143-22062165 GCAGAGATATAGAAATATCATGG - Intergenic
1053942554 9:43267373-43267395 CTATATACATATATATATGAAGG + Intergenic
1054306811 9:63435552-63435574 CTATATACATATATATATGAAGG + Intergenic
1054405542 9:64759542-64759564 CTATATACATATATATATGAAGG + Intergenic
1054439167 9:65245031-65245053 CTATATACATATATATATGAAGG + Intergenic
1054491239 9:65776910-65776932 CTATATACATATATATATGAAGG - Intergenic
1055238820 9:74158836-74158858 CTAGAGAGATATCAAAATGAGGG + Intergenic
1055239108 9:74163043-74163065 CTAGAGAGATATGAAAATGATGG + Intergenic
1055256632 9:74379565-74379587 CTAGAGGCAGAGAAATGTGTAGG - Intergenic
1056776943 9:89519915-89519937 ATAGATAGATAGATATATGATGG + Intergenic
1057278337 9:93689277-93689299 ATATTGACATAGAAATATGAAGG + Intergenic
1057555801 9:96086725-96086747 TTAGAAACATGGAAATATGAGGG - Intergenic
1058418717 9:104815167-104815189 ATAGAGCACTAGAAATATGATGG + Intronic
1058503151 9:105642959-105642981 GTAGAGACATAGAGAGAAGATGG + Intergenic
1059754755 9:117282126-117282148 GGAGAGACATAGAAAAATAAAGG - Intronic
1060865456 9:126991694-126991716 ACAGAGACACAGAAAGATGAGGG - Intronic
1185525975 X:779142-779164 ATAGATACATAGATAGATGATGG + Intergenic
1185602266 X:1348405-1348427 AGAGAGACATAGGACTATGATGG - Intronic
1187659456 X:21524470-21524492 CTAGAGAAATAGCAGTTTGAAGG + Intronic
1187789200 X:22930196-22930218 ATAGAGAGAAAGAAACATGAAGG - Intergenic
1189517088 X:41724047-41724069 CTACAGAAATAGAGAAATGAGGG + Intronic
1192690272 X:73355114-73355136 CTATATACAGAGAATTATGATGG - Intergenic
1193317626 X:80082145-80082167 TTAGAGTCCTAGAAATATGTTGG + Intergenic
1193325383 X:80173718-80173740 CTAGATATATATATATATGAAGG - Intergenic
1193670450 X:84377811-84377833 ATAAAGACATAGAGATATAAAGG + Intronic
1194907871 X:99601099-99601121 ATATAGACATAGATAGATGATGG - Intergenic
1195894477 X:109732394-109732416 CTATAGACATAGAAAAATCTAGG - Intronic
1195920391 X:109977774-109977796 CTACAGACGTAGAGATATGTAGG - Intergenic
1196061604 X:111413534-111413556 CTAGAGGCAAAGAAAAATCAAGG + Intergenic
1196305754 X:114100919-114100941 CAGGAGACAGATAAATATGAGGG + Intergenic
1196534601 X:116828191-116828213 AGAGAAACAGAGAAATATGAGGG - Intergenic
1197629746 X:128844684-128844706 TTGGAAACATAGAAATAAGAAGG + Intergenic
1198539291 X:137619678-137619700 CTAGAGACATAGAAAGTGGATGG - Intergenic
1198804318 X:140478308-140478330 ATAGAGACATAAAGACATGAGGG - Intergenic
1199640071 X:149851419-149851441 ATAGATAGATAGATATATGATGG + Intergenic
1201776510 Y:17671663-17671685 CTAGAGGCATAAAAACCTGAAGG + Intergenic
1201825046 Y:18234329-18234351 CTAGAGGCATAAAAACCTGAAGG - Intergenic
1201939708 Y:19446799-19446821 CTAGAGAAATAGGAAAAGGAAGG - Intergenic