ID: 1179303827

View in Genome Browser
Species Human (GRCh38)
Location 21:40136813-40136835
Sequence CAGAATGAGGAAGAGGAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 878
Summary {0: 1, 1: 0, 2: 4, 3: 77, 4: 796}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179303822_1179303827 21 Left 1179303822 21:40136769-40136791 CCCTCCGGCAAATACTTGAATCA 0: 1
1: 0
2: 0
3: 3
4: 87
Right 1179303827 21:40136813-40136835 CAGAATGAGGAAGAGGAGCCTGG 0: 1
1: 0
2: 4
3: 77
4: 796
1179303823_1179303827 20 Left 1179303823 21:40136770-40136792 CCTCCGGCAAATACTTGAATCAG 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1179303827 21:40136813-40136835 CAGAATGAGGAAGAGGAGCCTGG 0: 1
1: 0
2: 4
3: 77
4: 796
1179303824_1179303827 17 Left 1179303824 21:40136773-40136795 CCGGCAAATACTTGAATCAGAAT 0: 1
1: 0
2: 1
3: 19
4: 179
Right 1179303827 21:40136813-40136835 CAGAATGAGGAAGAGGAGCCTGG 0: 1
1: 0
2: 4
3: 77
4: 796

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179303827 Original CRISPR CAGAATGAGGAAGAGGAGCC TGG Intronic
900123946 1:1061386-1061408 CCGAAGGAGGAGGAGGAGCTGGG + Intergenic
901004713 1:6166150-6166172 CAGAATTGGGCAGAGGGGCCAGG + Intronic
901447912 1:9319415-9319437 GAGAAGGAGGAAGAGGAGGGAGG - Intronic
901627804 1:10633613-10633635 CAGGAGGAGGAAGAGCGGCCAGG - Intergenic
901629750 1:10642296-10642318 GAGGAGGAGGAGGAGGAGCCGGG + Intronic
901929096 1:12585619-12585641 CTGGAGGGGGAAGAGGAGCCAGG - Intronic
903281038 1:22250200-22250222 CAGGACCAGGAGGAGGAGCCGGG + Intergenic
903460361 1:23516528-23516550 CTGGAGGAGGAAGAGAAGCCAGG + Intronic
903581268 1:24372788-24372810 CAGAAGCAGGAGGAGGAGCAGGG - Intronic
903864761 1:26389918-26389940 CAGAATGAGGAGGAAGGGGCAGG + Intergenic
904190190 1:28737294-28737316 CAGGCTGAGGGAGAGGCGCCGGG - Intronic
904335962 1:29798281-29798303 CAGGCTGGGGAAGAGGAGGCAGG - Intergenic
904878753 1:33678145-33678167 GAGAATGAGCAAGAGAAGTCGGG - Intronic
905032688 1:34898286-34898308 CAGACTGAGGATAAGCAGCCAGG + Intronic
905258786 1:36703088-36703110 GAGAAAGAGGAGGAGGTGCCAGG + Intergenic
905345188 1:37306425-37306447 CAGAGTGAGAGAGAGGAGGCTGG + Intergenic
905493784 1:38367388-38367410 CAGACTGATGAAGAGCAGACTGG - Intergenic
906302849 1:44696141-44696163 CAGCAAGAGGCAGGGGAGCCTGG + Intronic
906315807 1:44785758-44785780 CAGAATGAGAAAGAGCCTCCTGG - Intronic
906579822 1:46927328-46927350 CAGATTTAGGAAGAGAAGCAAGG + Intergenic
906603904 1:47151571-47151593 CAGATTTAGGAAGAGAAGCAAGG - Intergenic
906694137 1:47812762-47812784 CAGAATGATATAGAGGAGCATGG + Intronic
907287356 1:53390401-53390423 CGGGAGGAGGCAGAGGAGCCAGG + Intergenic
907561792 1:55397681-55397703 AAGAATGAGTCAGAGTAGCCAGG - Intergenic
907770604 1:57459787-57459809 AAGAATGAGAAAGAGGAGAGAGG - Intronic
908600504 1:65733935-65733957 AAGAAAGGGGAAGAGGTGCCAGG + Intergenic
909235235 1:73144571-73144593 CAGAGAGAGGCAGAGGGGCCAGG - Intergenic
909635886 1:77816948-77816970 AGGAAAGAGGAAGAGGATCCTGG + Intronic
910922349 1:92362419-92362441 CAGAATGGTGAAAAAGAGCCTGG + Intronic
911257294 1:95647069-95647091 CAGACTGGGGAAGAGAAGGCAGG + Intergenic
912416589 1:109512451-109512473 CAGAAAGAGGAAAGGGAGGCCGG - Intergenic
912551932 1:110490293-110490315 AAGAAGGAGGAGGAGGAGCCCGG - Intergenic
912956471 1:114157062-114157084 CAGATGCAGGAAGAGGAGCTGGG + Intergenic
914993103 1:152515480-152515502 CAGCAGGAGGAGGAGGAGGCGGG - Exonic
915138946 1:153754309-153754331 CAGGAGCAGGAAGAGCAGCCAGG + Intronic
915237684 1:154497156-154497178 GAGAAGCAGGAAGCGGAGCCAGG + Intronic
915366967 1:155322071-155322093 CTGAGTGAGGAGGAGCAGCCTGG - Exonic
915505408 1:156352724-156352746 AAGAATGAGCAAGAGCGGCCGGG - Intronic
915641448 1:157230253-157230275 CAGCAGGAGGAAGGGGATCCAGG + Intergenic
915735508 1:158082120-158082142 CAGAACAAGGAGGAAGAGCCAGG + Intronic
915928654 1:160043676-160043698 CAGAATGAAGTAGAAGAGCTAGG + Intronic
916023456 1:160814306-160814328 GAGAAAGAGGAAGAGGAGGAGGG + Intronic
916507681 1:165442911-165442933 CACCAGGAGGAAGAGGAGGCAGG - Intronic
916745819 1:167684103-167684125 CCAAATTAGGAAGAGAAGCCAGG + Intronic
916840338 1:168594119-168594141 CTGAAGGAGGGAGAGGAGCAAGG + Intergenic
917383815 1:174446084-174446106 CAGGATGAGGAGGAGGAGTAGGG + Intronic
917471181 1:175327258-175327280 CAGAAATGGGAAGGGGAGCCAGG - Intronic
917534264 1:175863215-175863237 GGGAATGAGGAAGAGGACCAGGG - Intergenic
918069511 1:181124592-181124614 CAGAAGGAGGAGGAGGAGGGAGG - Intergenic
918134397 1:181658834-181658856 CAGAATGAGAAAAAGAAACCAGG - Intronic
918222902 1:182452231-182452253 CAGAGTGAAGGAGAGAAGCCTGG + Intronic
919441658 1:197641293-197641315 AAAAATGAGGAGGAGGAGCTGGG + Intronic
919594483 1:199545269-199545291 CAGAATGAGCAAGAGGCGCTAGG + Intergenic
919774480 1:201185224-201185246 CAGACTGGGGCAGGGGAGCCAGG - Intergenic
920415208 1:205794978-205795000 CACGAGGAGGAAGAGGACCCGGG + Exonic
920983073 1:210856528-210856550 GAGAATGAGGAAGAAGAGGCTGG - Intronic
921176455 1:212599541-212599563 GAGAGGGAGGAAGAAGAGCCAGG - Intronic
922152583 1:223018357-223018379 CAGAATGACAAAGTGGAACCAGG - Intergenic
922343077 1:224673106-224673128 CAGACTGAGGAACAGGTGCTGGG - Intronic
922516175 1:226209809-226209831 CAGAGAGAGGGAGAGGAGCCAGG + Intergenic
922563750 1:226587751-226587773 GAGAATGAGGAAGAGTGGACAGG - Intronic
923218197 1:231869611-231869633 AAGAAAGAGGAGGAGGTGCCAGG + Intronic
923784385 1:237053599-237053621 CAGAATGAAGGAGAAGAGACCGG - Intronic
923994042 1:239471555-239471577 CAGGATCAGGAAGAGGGGCTAGG + Intronic
924156015 1:241177377-241177399 GAAAATAAGGAACAGGAGCCTGG + Intronic
1062777544 10:165806-165828 TAAAATGAGGAAGAGGAGAGTGG - Intronic
1062858176 10:789956-789978 CAGGAAGAGGAAGATGCGCCAGG + Intergenic
1063282517 10:4645769-4645791 CTGAATGTGGAGGAGGAGCCAGG - Intergenic
1063522333 10:6752238-6752260 CAGAATGAGGATGAAGTGCTGGG - Intergenic
1063811426 10:9713361-9713383 CAGAATGAGGTTGGTGAGCCTGG + Intergenic
1064659374 10:17591118-17591140 TAGAATGGAGAAGAGGAGGCTGG - Intronic
1064990488 10:21252657-21252679 AAAAATGAGGCAGAGGAGGCTGG + Intergenic
1065034612 10:21624977-21624999 CAGTAAGAGGAAGAGGAGGAAGG - Intronic
1065294354 10:24260227-24260249 AAGGATGAGGAAGGGGACCCGGG + Intronic
1065900150 10:30198973-30198995 CACAATGAGGACAAGCAGCCAGG + Intergenic
1066046289 10:31598352-31598374 CAGAATGTGGGAGAGAAGCCAGG + Intergenic
1066076931 10:31888194-31888216 CAGAATAAGGGAGAGGTGCCAGG - Intronic
1067485576 10:46646736-46646758 CAGAATAAGGACTAGGAGCTGGG - Intergenic
1067609183 10:47694916-47694938 CAGAATAAGGACTAGGAGCTGGG + Intergenic
1068513791 10:58000674-58000696 AAGAAAGAGGAAAAGGAGGCAGG + Intergenic
1068673059 10:59743470-59743492 CACCATGAGGAACAGGAACCAGG + Intergenic
1069415811 10:68199983-68200005 CAGAATGAGTAGGAGGTGCCAGG - Intronic
1069801494 10:71084576-71084598 CAAAATGAGGAATGGGTGCCAGG + Intergenic
1069898201 10:71691904-71691926 AAGACTGAGGAAGGGGACCCAGG + Intronic
1070501777 10:77079411-77079433 TATAATGAGGAAGAAGAGGCTGG + Intronic
1070538079 10:77394215-77394237 CAGAGTGAGGAAGAGCCTCCTGG - Intronic
1070714280 10:78707918-78707940 CAGAAGGAGGAAGGAGAACCAGG - Intergenic
1070740320 10:78899008-78899030 CACACTGAGGCAGAGGAGACAGG - Intergenic
1070741667 10:78907463-78907485 AAGAAAGAGGAAGAGGAGGAGGG - Intergenic
1070789754 10:79181973-79181995 CTGGAGGAGGAGGAGGAGCCAGG + Intronic
1071348308 10:84714562-84714584 TAGAAAGAGGAAGAGGAGAGAGG + Intergenic
1071624770 10:87156562-87156584 CAGAATAAGGACTAGGAGCTGGG + Intronic
1071883406 10:89923842-89923864 CAGAAAGAACAAGATGAGCCTGG - Intergenic
1072563432 10:96597864-96597886 CAGAAAGCGGAAGAGGGGCTGGG - Intronic
1073060432 10:100730478-100730500 GAGAAAGAGGCAGCGGAGCCAGG - Intergenic
1073560884 10:104495934-104495956 AACAATGAGGAAGGGGACCCAGG + Intergenic
1074519659 10:114207653-114207675 AAGAATGAGGAAGATGAAGCTGG + Intronic
1074936920 10:118190861-118190883 CAGGAACAGAAAGAGGAGCCGGG + Intergenic
1075450939 10:122551625-122551647 CAGCATGAGCAACAGGAGGCAGG - Intergenic
1075510017 10:123064391-123064413 CAGTGTGAGGCAGAGAAGCCAGG + Intergenic
1076172014 10:128327206-128327228 GAGAATGAGGAGGAAGGGCCAGG - Intergenic
1076302879 10:129441327-129441349 CAGTCTCAGGACGAGGAGCCAGG - Intergenic
1076569056 10:131420420-131420442 CAGCAGGAGGAAGAGGAGGGCGG - Intergenic
1077270900 11:1679956-1679978 TTGAAGGAGGAAGTGGAGCCGGG + Intergenic
1079079984 11:17407353-17407375 CAGGATGAGGAAGAGGAGGAAGG - Exonic
1080037283 11:27722614-27722636 CAGGATGAGGAAGCGGCTCCGGG - Intergenic
1080073335 11:28115724-28115746 TAGACTGAGGAAGAGGAGGAGGG + Intronic
1080284185 11:30588989-30589011 GAAAATGAGAAAGAGGAGCGTGG + Intergenic
1080550366 11:33369189-33369211 GAGAAAGAGGAAGAGGAGGAGGG - Intergenic
1080778040 11:35404392-35404414 AAGGATGAGGACGAGGACCCAGG + Intronic
1080882197 11:36332742-36332764 CAGCAGGAGGAGGAGGTGCCAGG - Intronic
1080957501 11:37116928-37116950 CAGAAGGAGGAATACCAGCCAGG + Intergenic
1081983414 11:47284443-47284465 CAGAAGGAAGCAGAAGAGCCTGG + Exonic
1082243511 11:49893572-49893594 CAGGAGGAGGAGGAGGAGCACGG - Intergenic
1082286449 11:50322921-50322943 GTGAAAGAGGAAGAGGAGTCAGG - Intergenic
1082862563 11:57869856-57869878 GAGAATGGGGAGGAGGTGCCAGG + Intergenic
1083708915 11:64535368-64535390 CAGACTGAGGAAGAAGAGCTGGG + Intergenic
1083890507 11:65593425-65593447 GGGAAGGGGGAAGAGGAGCCTGG - Intronic
1084148881 11:67278914-67278936 CAGGGTGAGGCAGAGGAGCGGGG - Intronic
1084163845 11:67365958-67365980 GACAGAGAGGAAGAGGAGCCTGG + Intronic
1084370200 11:68736744-68736766 CAGAAGGAGGAAAAGGAGAGAGG + Intronic
1084951358 11:72667713-72667735 GAGAAAGAGGAAGATGAGCTGGG + Intronic
1085459672 11:76686050-76686072 TAGGACGAGGAAGAGAAGCCAGG - Intergenic
1085651023 11:78268806-78268828 CTGAAGGAGGAAAAGGAGACAGG - Intronic
1086165219 11:83769916-83769938 CAGACTTAGGAAGAGGAAGCAGG - Intronic
1088891850 11:114050787-114050809 CAGAATGAACGAGACGAGCCTGG + Intergenic
1088993091 11:114971485-114971507 CAGACTGAACAAAAGGAGCCAGG - Intergenic
1089058787 11:115608996-115609018 CAGAATGAGGAGGAGGGCACAGG - Intergenic
1089134570 11:116238854-116238876 CAGGAGGATGAAGATGAGCCAGG + Intergenic
1089157535 11:116413932-116413954 CAGGATGAGGGAGGGGAACCTGG - Intergenic
1089206826 11:116771081-116771103 AAGAATGAGGAAGAGTTTCCTGG - Intronic
1089335982 11:117724365-117724387 AAGAATGAGGAAGACCCGCCAGG + Intronic
1089353316 11:117833707-117833729 CAGGGTGAGGCAGAGCAGCCAGG + Intronic
1089500769 11:118929973-118929995 CAGATTGAAGCAGGGGAGCCCGG + Intronic
1089779675 11:120864669-120864691 GAGAATGAGGAAATAGAGCCTGG - Intronic
1090014465 11:123073715-123073737 GAGCCTGAGGAAGAGGAGCTGGG + Exonic
1090080827 11:123611529-123611551 AGGAAGGAGGAAGAGGAGCAAGG - Intronic
1090433477 11:126666296-126666318 CAGAAAGAGGAACGGGTGCCTGG - Intronic
1090441601 11:126729346-126729368 AAGAAACAGGAAGTGGAGCCTGG + Intronic
1090846658 11:130535145-130535167 AAGAATGAGAAAAAGGAGCTCGG + Intergenic
1090979018 11:131700669-131700691 CACACTGAGGATGAGGTGCCTGG - Intronic
1091371163 11:135059468-135059490 AGGAATGGGGAAGAGGACCCAGG + Intergenic
1091458717 12:628018-628040 CAGGGTGTGAAAGAGGAGCCGGG - Intronic
1092225347 12:6744843-6744865 TAGCCTGAGGGAGAGGAGCCTGG - Intergenic
1092236167 12:6811106-6811128 CAGAAAGAGGGAGAGGACCTGGG + Intronic
1094167801 12:27460573-27460595 TAGACTGAGGAGGAGAAGCCGGG + Intergenic
1094480653 12:30878885-30878907 GAGGGTGAGGAAGAGGAGCTGGG - Intergenic
1094628768 12:32151699-32151721 CAGCAGAAGGAAGAGGAGCAGGG + Intronic
1095508076 12:42919845-42919867 CAGAGGGAGGAACAAGAGCCAGG - Intergenic
1095710969 12:45287623-45287645 GAGAATAAGGAAAAGGAGTCAGG + Intronic
1095813917 12:46400716-46400738 CTGAAGGAGGATGTGGAGCCAGG + Intergenic
1096758907 12:53823512-53823534 CAGAATGTGGAAGAGGAAAAAGG + Intergenic
1096803896 12:54128504-54128526 AAGAAAGGGGAAGAGGAGCAAGG - Intergenic
1097285560 12:57874386-57874408 CGGAAAAAGGAAAAGGAGCCTGG - Intergenic
1098232581 12:68387629-68387651 CTGAATGATGAGGAGGAACCAGG - Intergenic
1098596697 12:72280527-72280549 GGGAAGGAAGAAGAGGAGCCTGG + Intronic
1099215923 12:79853389-79853411 GAGAATAAGGCAGAGGAGCTAGG - Intronic
1099871707 12:88357961-88357983 CAAAAGGAGGAAGAGGAGGAGGG - Intergenic
1101723421 12:107370523-107370545 CTGAGAGAGGAAGGGGAGCCAGG - Intronic
1102493245 12:113301848-113301870 CAGAGTCAGGCAGAGGTGCCAGG - Intronic
1102496224 12:113321082-113321104 CAGAAACAGGTAGAGCAGCCAGG + Exonic
1102531729 12:113551657-113551679 CAGAAGGAAGAAGGGGAGGCAGG - Intergenic
1102538807 12:113603092-113603114 GAAAATGAGGAAGAGGAGGAAGG - Intergenic
1102972022 12:117176355-117176377 ATGAATGAGGAAGTGAAGCCAGG + Intronic
1103147929 12:118611424-118611446 CAGAATGAGTAATGGGAGTCGGG + Intergenic
1103205785 12:119127789-119127811 GAGAAGGAGAAAGAGGAGGCAGG + Intronic
1103401903 12:120649051-120649073 GAGATGGAGGAGGAGGAGCCTGG - Intronic
1103711565 12:122916707-122916729 CAGAATGAATAAGGAGAGCCGGG + Intergenic
1103736142 12:123062032-123062054 GAGAAGGAGGAGGAGGAGCAGGG - Intronic
1103889820 12:124229991-124230013 CAGAATGAGGCAGAAGTGGCTGG + Intronic
1104782783 12:131432554-131432576 GAGAATGAGGAGGAGGAGTTGGG + Intergenic
1105977873 13:25489259-25489281 CAGACACAGGAAGAGGAGCCTGG - Intronic
1106174963 13:27322333-27322355 CAGAAGCAGGCAGGGGAGCCAGG + Intergenic
1106314616 13:28582426-28582448 CAGAGTGGGGGAAAGGAGCCAGG - Intergenic
1106359177 13:29014179-29014201 CAGACTGGGGCTGAGGAGCCAGG + Intronic
1106513978 13:30436805-30436827 AAGAAAGAGGAAAAGGAGGCTGG - Intergenic
1106928716 13:34640639-34640661 CAGAATGACGCAGAGGAGTCTGG - Intergenic
1107643168 13:42465396-42465418 GAGAAGGAGGAAGAGGGGCATGG + Intergenic
1108004665 13:45934624-45934646 CAGTATCAGGAAGAGGAGGCTGG + Intergenic
1108113158 13:47099369-47099391 CAGAATTAATAAGAGAAGCCTGG - Intergenic
1108546531 13:51500944-51500966 TAGAAAGAGGAACAGGAGCTGGG + Intergenic
1108605112 13:52029825-52029847 GAGAGTGAGGAAGAGGAGGGAGG + Exonic
1108770239 13:53691764-53691786 CAAAATGAGGAAGAGGCACAGGG - Intergenic
1108788458 13:53936401-53936423 CACAATTAGGAAGAGTAACCTGG - Intergenic
1108850999 13:54728800-54728822 CAGAATGTGGAGGAAGAGCAAGG - Intergenic
1109182518 13:59230805-59230827 GAGAAAGGGGAAGAGGATCCAGG + Intergenic
1109397779 13:61783115-61783137 CTGAATGATGAGGAGGAACCAGG - Intergenic
1110370790 13:74737854-74737876 CAGATGGAGGAGGAAGAGCCAGG + Intergenic
1111961544 13:94816138-94816160 AAGAATTAGGAGGAGGGGCCAGG + Intergenic
1112091903 13:96091127-96091149 GAGGAGGAGGACGAGGAGCCCGG + Exonic
1112104752 13:96228864-96228886 CAGAAGGAGGAAGAGGGACCAGG + Intronic
1112392606 13:98998843-98998865 CACCATTAGGAAGATGAGCCTGG - Intronic
1112444374 13:99450845-99450867 GAGAATGAGGGATAGGAGACAGG - Intergenic
1112744840 13:102514894-102514916 AAGAAGAAGGAAGAGGAGCAAGG + Intergenic
1113069162 13:106402838-106402860 GAGAATGAGGAGGAGGAGATAGG - Intergenic
1113149466 13:107246054-107246076 CAGAATGAGATAGAGGAGGGTGG - Intronic
1113164490 13:107423371-107423393 CAGAATGATGAACAAGAGACAGG + Intronic
1113741966 13:112717095-112717117 CAGGAAGAGAAAGAGAAGCCAGG + Intronic
1113908600 13:113831503-113831525 CAGAGTGGGGAACAGAAGCCAGG - Intronic
1113984351 13:114301908-114301930 CAGAGGGAAGAAGGGGAGCCAGG + Exonic
1114248388 14:20935359-20935381 CAAAAGGAGGAAGAGGAGGAGGG + Intergenic
1114519112 14:23321755-23321777 CAAGAGGAGGAGGAGGAGCCGGG + Exonic
1114523495 14:23352973-23352995 CAGAGAGAGGAAGGGGGGCCAGG + Intergenic
1115967206 14:38904244-38904266 CAGATTGAGTATGAGGAGCCAGG + Intergenic
1116084694 14:40219828-40219850 TAGCATGAGAAACAGGAGCCAGG + Intergenic
1116206524 14:41874564-41874586 CATTATGAGGAAGAGGAGAAAGG - Intronic
1117058140 14:51933843-51933865 GAGAATGAGGATGAGGAGAAAGG + Intronic
1117285772 14:54284572-54284594 CAGAGTGAGAAAGTGGATCCAGG + Intergenic
1117292201 14:54344759-54344781 CAGAGTGGGGAGGAGGAGCATGG - Intergenic
1117375289 14:55113533-55113555 CGGAATGGGAAAGAGAAGCCAGG - Intergenic
1117572037 14:57057392-57057414 CAGAATGAGGACCAGAACCCAGG + Intergenic
1118336986 14:64861905-64861927 CACAATGAGGATGAAGAGCCAGG - Intronic
1118513977 14:66507452-66507474 CAGCAGGAGGAAGAGAAGCCAGG + Exonic
1118534634 14:66746949-66746971 AAAAATGAGGAAGAGGAGAGGGG + Intronic
1118977344 14:70689036-70689058 AAGACTAAGGAAGAGGAACCTGG + Intergenic
1119067339 14:71542236-71542258 GAGGAGGAGGAGGAGGAGCCAGG - Intronic
1120153336 14:81063244-81063266 GAGACTAAGGAAGAGTAGCCAGG - Intronic
1120398787 14:84002175-84002197 GAGAATGAGGAAGAGAAGACTGG - Intergenic
1120649137 14:87110012-87110034 AAAAATTAGGAAGAGGAGTCAGG - Intergenic
1121318457 14:92975962-92975984 CAGAATGAAGCAGGGGAGCATGG - Intronic
1121732836 14:96198188-96198210 TAGAATTAGGAAGAGTGGCCAGG + Intergenic
1122425837 14:101604799-101604821 CAGCATGAGGATGAGGGGCAGGG + Intergenic
1123409309 15:20045315-20045337 CATGATGAGGAAGAGAAACCAGG - Intergenic
1123518640 15:21052023-21052045 CATGATGAGGAAGAGAAACCAGG - Intergenic
1123774582 15:23566009-23566031 CAGCCTCAGGAGGAGGAGCCTGG + Exonic
1124133507 15:27011360-27011382 TGGAAGGAGGAAGAGAAGCCAGG - Intronic
1124154638 15:27215203-27215225 CTGAAGGAGGAAGAGGAGTCAGG + Intronic
1124409196 15:29421970-29421992 CAGAATGAGGACATGGGGCCGGG + Intronic
1124845686 15:33287809-33287831 GAGAATGAGGAAAATGATCCAGG - Intergenic
1124892419 15:33745447-33745469 GAGATTGAGAAAGAGCAGCCAGG + Intronic
1124907504 15:33885042-33885064 GATCATGATGAAGAGGAGCCAGG - Intronic
1125093598 15:35825434-35825456 CAGAGAGAGGAAGAGGATCAGGG + Intergenic
1125929946 15:43593492-43593514 TAGAACCAGGAAGAGGAGCAAGG - Intronic
1125943114 15:43693324-43693346 TAGAACCAGGAAGAGGAGCAAGG - Intronic
1126210064 15:46092076-46092098 CAGCTTGAGGAAGAAGGGCCAGG - Intergenic
1126329833 15:47520348-47520370 CAGAGTGAGGAATAGGAATCAGG + Intronic
1126697670 15:51340032-51340054 GAGCAGGAGGAAGAGGGGCCAGG + Intergenic
1126842097 15:52727308-52727330 CAACATGGGTAAGAGGAGCCTGG - Intergenic
1127012008 15:54641805-54641827 GAGAATGAGGAAAAGCAGACTGG + Intergenic
1127122054 15:55780313-55780335 CAGAAGGAGGAAGAGGAAAAAGG + Intergenic
1127267443 15:57373708-57373730 GAGAGTGAGGACCAGGAGCCAGG - Intergenic
1127611775 15:60644160-60644182 CAGCATGAGGGAGAGGAGAGAGG + Intronic
1128113798 15:65093228-65093250 CTGCCTGAGGAAGAGGAGACAGG + Exonic
1128610715 15:69070993-69071015 GAGAGGGAGGAAGAGGTGCCAGG + Intergenic
1128935120 15:71739451-71739473 CAGGATGATGAAGTGGACCCAGG + Intronic
1128989688 15:72249330-72249352 CAGGATGAGTAATATGAGCCTGG + Intronic
1129113248 15:73350623-73350645 CAGAAAGAGGAAGGGGACACTGG - Intronic
1129255179 15:74330306-74330328 CAGGAGGAGGAAGAGGGGCAGGG + Exonic
1129263390 15:74381381-74381403 CAGAAAGGGGCACAGGAGCCAGG + Intergenic
1129515280 15:76153539-76153561 GAGAATGTGGAATTGGAGCCAGG + Intronic
1129591634 15:76920340-76920362 CAGACTGAGGAAGAGGATTCAGG + Intergenic
1129887186 15:79046894-79046916 CAGCATGCGCAAGAGGAACCAGG - Exonic
1130298663 15:82664382-82664404 CAGGATGAGGATGAGGAGAAAGG - Exonic
1130355866 15:83129875-83129897 GAGAATAAGGCAGAGGAACCAGG - Exonic
1130631023 15:85569337-85569359 GGAGATGAGGAAGAGGAGCCAGG + Intronic
1131344626 15:91634506-91634528 CAGACTCAGGACTAGGAGCCAGG - Intergenic
1131512584 15:93057416-93057438 CAGAAGGAGGGAGAGGGGGCAGG - Intronic
1131821740 15:96280887-96280909 AAGAAGGAGGAGGAGGAGGCAGG + Intergenic
1132198696 15:99932988-99933010 GAGAAAGGGGAAGAGGAGCCAGG - Intergenic
1132298983 15:100764918-100764940 GAGAAGGAGGAAAAGGAGGCCGG - Intergenic
1133009127 16:2900630-2900652 GGGAGTGAGGAAGAGGAGGCCGG + Intergenic
1133090467 16:3400561-3400583 TAGCATGAGGATGGGGAGCCAGG + Intronic
1133405971 16:5524834-5524856 CAGAATGATGAATAGGGGCCGGG - Intergenic
1134390226 16:13813113-13813135 GAGGAGGAGGAAGAGGAGCAGGG + Intergenic
1134668550 16:16037726-16037748 TAGAATGAGGAACAGAACCCCGG - Intronic
1135303576 16:21350661-21350683 CGGAATGAGGAAGAGGTGAAAGG + Intergenic
1135734153 16:24917422-24917444 CAGAACGGGAAAGAGGATCCAGG + Intergenic
1135736036 16:24932462-24932484 CAGAAAGAGGCAGAACAGCCAGG + Intronic
1135745470 16:25013197-25013219 AAGAATGAGCAAGAGGTGCCTGG + Intronic
1135933846 16:26762343-26762365 GAGAGAGAGGAAGAGGTGCCAGG + Intergenic
1136381676 16:29898963-29898985 CAGAATTAGGAACAGCAGCTGGG + Exonic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137673573 16:50292859-50292881 CAGAAAGAGGAAGAGGACAGGGG - Intronic
1137792827 16:51189135-51189157 CAGCAAGGGGAAGATGAGCCTGG + Intergenic
1137844542 16:51674463-51674485 CACTATGAGGCAGAAGAGCCGGG + Intergenic
1137883665 16:52079035-52079057 AAGAATGAGGAAGAATAGCAAGG + Intergenic
1138094305 16:54200069-54200091 CAGAAAGATGAAGATGAGCTGGG - Intergenic
1138170332 16:54843611-54843633 GAGAATCAGGAGGAGGGGCCAGG - Intergenic
1138513122 16:57520142-57520164 CAGGATGAAGACGAGGAGGCTGG - Intronic
1138589849 16:57993771-57993793 CAGAGGGAGGAAGAAGAGCATGG + Intergenic
1139120609 16:64011872-64011894 CAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1139165765 16:64563364-64563386 GAGAAGGAGGAAGAGGAGGAAGG + Intergenic
1139482732 16:67239478-67239500 GAGACTGAGGAAGAGGTGGCAGG + Intronic
1140295368 16:73704721-73704743 GAGAGTGAGCCAGAGGAGCCGGG + Intergenic
1140356896 16:74314284-74314306 GAAAATGAGGAAGAGAGGCCAGG - Intergenic
1140574143 16:76145190-76145212 CAGAAAGTGAAAGAGGAGCAGGG + Intergenic
1140965000 16:79957336-79957358 TAAAAAGAGGAAGAGGAGCATGG - Intergenic
1141778458 16:86140482-86140504 GAGAGAGAGGAAGAGGTGCCAGG + Intergenic
1141908245 16:87041614-87041636 CAGGATGTGGAGGAGGAACCAGG - Intergenic
1142658987 17:1414595-1414617 GAGAGTGAGGAAGATGAGGCTGG + Intergenic
1142667107 17:1469487-1469509 GAGGATGAGGAAGTGGAGTCAGG - Intronic
1142698846 17:1647784-1647806 CAGAATGAGGGAGGGAGGCCTGG + Intronic
1143035221 17:3991298-3991320 GAGAAAGAGGAGGAGGAGGCCGG - Intergenic
1143151087 17:4807860-4807882 CTGAAGGAGGGAGAGGACCCAGG + Exonic
1143173275 17:4942471-4942493 CTGAATGAGGAAGGGGAGCTGGG + Intronic
1143391491 17:6561523-6561545 GAGGATGAGGAAGAGGAGGAGGG - Intergenic
1143391558 17:6561756-6561778 GAGAAGGAGGAAGAGGAGGAGGG - Intergenic
1143615653 17:8047706-8047728 CAGAATGAGGCTGAGGAGCTGGG - Intronic
1143630017 17:8133653-8133675 CACAATGAGGGAGGGGAGGCTGG - Intergenic
1143680116 17:8470078-8470100 CAGAAAGCGGGAGATGAGCCAGG - Intronic
1143749805 17:9020514-9020536 CAAAAACAGGAAGAGAAGCCTGG - Intergenic
1143772640 17:9178454-9178476 GAGAATTAGGAAGAGGAGGGAGG - Intronic
1143928786 17:10398555-10398577 CAGTATGAGGAAGAGCAGGAAGG - Exonic
1143963837 17:10741950-10741972 GAGGCTGAGGAAGAGTAGCCCGG - Intergenic
1144067654 17:11639080-11639102 CAGCAGGAGGAAGAGGACCCTGG - Intronic
1144218966 17:13082920-13082942 GAGAGAGAGGAAGAGGTGCCAGG + Intergenic
1144479887 17:15620529-15620551 CAGAATGGGGAATAGGAATCAGG + Intronic
1144497581 17:15758235-15758257 CAAATGGAGGAAGAGGACCCTGG - Intergenic
1144613395 17:16745855-16745877 CAGAGGGAAGAAGGGGAGCCAGG - Intronic
1144629378 17:16862719-16862741 CAAATGGAGGAAGAGGACCCTGG - Intergenic
1144652049 17:17013397-17013419 CAAATGGAGGAAGAGGACCCTGG + Intergenic
1144722757 17:17483640-17483662 AAGAATGAGGAAAGGGAGGCTGG + Intronic
1145058931 17:19720331-19720353 CAGGATGAGGCAGAGGGGCATGG - Intergenic
1145133059 17:20375931-20375953 CAGAGGGAAGAAGGGGAGCCAGG - Intergenic
1145160949 17:20573285-20573307 CAAACGGAGGAAGAGGACCCTGG - Intergenic
1145210722 17:21011238-21011260 CAGAATGGGGTGGAAGAGCCGGG + Exonic
1145764924 17:27452017-27452039 CAAGATGAGGGAGAGGAGCAAGG - Intergenic
1146496657 17:33328686-33328708 CAGCATGAGAAAGGGGAGACAGG - Intronic
1146570457 17:33948223-33948245 CAGAATGAGGTAAAGCAGGCTGG - Intronic
1146980819 17:37159833-37159855 GAAACTGAGAAAGAGGAGCCAGG + Intronic
1147564804 17:41529489-41529511 CAAAATGAGGAAGCAGAGCCTGG + Intergenic
1147917532 17:43897710-43897732 AAGAATGAGGAAGAGGGGGAGGG - Intronic
1147926695 17:43951037-43951059 AAGGATGAGGCAGAGGAGGCAGG - Intergenic
1148555600 17:48577120-48577142 CAGAAGGAAGAAGAGGTGGCGGG - Intronic
1148586633 17:48785900-48785922 CAGTAGGAGTAAGAGCAGCCAGG - Intronic
1148615732 17:48998318-48998340 AAGACTGAGGAACGGGAGCCGGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148827780 17:50406852-50406874 CAGAAGGAGGAACAGAAGCTGGG - Intergenic
1149291941 17:55225880-55225902 CAGAATCAGGGAGAGGCGCCTGG + Intergenic
1149656034 17:58310031-58310053 GAGGAGGAGGAAGAGGAGCTGGG - Exonic
1149718693 17:58820308-58820330 CAAAATTAGTAAGTGGAGCCAGG - Intronic
1150355462 17:64480794-64480816 CAGGAAGAGGCAGAAGAGCCAGG + Intronic
1150726821 17:67658062-67658084 CTGACTGAGCAAGAGGAACCTGG - Intronic
1151158775 17:72147057-72147079 AAGAAGGAGGAAGAGGAGGAGGG + Intergenic
1152103453 17:78315842-78315864 CAGGAGGAGGAGGAGGAGCAGGG - Intergenic
1152123532 17:78433113-78433135 GAGAGTGAGGAGGAGGACCCAGG + Intronic
1152725383 17:81942426-81942448 CAGAATGAGGGTGGGGAGCGGGG - Intronic
1153997365 18:10454327-10454349 CAGAGGGAGGCAGAGGGGCCTGG + Intergenic
1155566212 18:27137548-27137570 GAGAATGAGGCTGAGGAGGCAGG + Intronic
1155940792 18:31800183-31800205 CAGACTGGGGAAGAGAAGGCAGG - Intergenic
1156181046 18:34604750-34604772 CTTAATGAGGCAGAGGATCCTGG + Intronic
1156787678 18:40935176-40935198 AAGAATGAGGAAAAGAAGTCAGG + Intergenic
1157106647 18:44780300-44780322 CAGGATCAGGAAGAGGAGTCAGG - Intronic
1157452818 18:47800990-47801012 CAGAATGAGGCCCACGAGCCAGG + Intergenic
1158182346 18:54730660-54730682 GAGAGTGAGGAGGAGGAGTCAGG - Intronic
1158423153 18:57313609-57313631 CAGGAGGAGGAAGAGGAGGAAGG + Intergenic
1159446844 18:68551267-68551289 AAGAAAGAGGAAGAGGAGGAAGG + Intergenic
1159559072 18:69975098-69975120 CAGGATGGGGAAGAGAAGGCAGG + Intergenic
1159670672 18:71217029-71217051 CAGAATGTGGCAGAAGAGCCAGG + Intergenic
1159893164 18:73971995-73972017 GAGAATGAGGGAGAGGAGAGGGG - Intergenic
1160278804 18:77466887-77466909 CAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1160340727 18:78086815-78086837 CAGAGCGAAGACGAGGAGCCAGG - Intergenic
1160513669 18:79466712-79466734 CCAACTGAGGAAGAGGAGGCAGG - Intronic
1160557273 18:79734387-79734409 CAGAAAGAGGGAGAGGAGATCGG + Intronic
1160699542 19:499137-499159 CAGAATGAGGAGGGGGAGAAAGG - Intronic
1160804418 19:985741-985763 GAGAACCAGGAAGAGGAGTCGGG - Intronic
1161069367 19:2252678-2252700 GAGAACGACGAAGAGGAGCCCGG - Exonic
1161103973 19:2434244-2434266 CAGAGTGAGGAGGAGGGGCAGGG - Intronic
1161171758 19:2815645-2815667 GAGCATGGGGCAGAGGAGCCAGG - Exonic
1161270307 19:3386000-3386022 CAGAATGAGGAGGATGGGCCGGG - Intronic
1161274907 19:3410518-3410540 CAGAGTGAGGAAGGGGAGACAGG + Intronic
1161410391 19:4113737-4113759 AAGAATGAGGAATTTGAGCCAGG + Intronic
1161458279 19:4381026-4381048 CAGAGAGAGGGAGAGGAGGCCGG - Intronic
1161634220 19:5377179-5377201 CAGAGTGAGGAAGGGGAGAGAGG + Intergenic
1161814232 19:6489510-6489532 CTGCATTAGGAAGACGAGCCAGG - Intergenic
1161957536 19:7504908-7504930 CAGAAAGAGGGAGGGGAGCAGGG - Intronic
1162012820 19:7828652-7828674 CAGAATGGGGAAGGGAAGGCTGG - Intergenic
1162197950 19:9000219-9000241 CAGGATAAGGATGAGAAGCCCGG + Intergenic
1162378531 19:10318722-10318744 CTGGAGGAGGAAGAGGAGGCGGG - Intronic
1162541110 19:11296503-11296525 CAGACGGAGGAGGAGGAGCAGGG + Intronic
1163222133 19:15929339-15929361 GAGAAGCAGGAAGAGGGGCCTGG + Intronic
1163460784 19:17436272-17436294 CAGAATGAGGAGGTGAAGGCTGG + Exonic
1163621533 19:18363716-18363738 GAGAAGGAGGAAGAGGAGGTGGG - Exonic
1164130127 19:22354527-22354549 CAGAGGGAGGCTGAGGAGCCTGG + Intergenic
1164155785 19:22596164-22596186 CAGAAAAAGGAAGCGCAGCCAGG - Intergenic
1164472342 19:28546761-28546783 CAGGGAGGGGAAGAGGAGCCAGG - Intergenic
1164795358 19:31022483-31022505 CAGAAAGAGGAAGAAGAGGGAGG - Intergenic
1164845004 19:31424554-31424576 CAGACATAGGCAGAGGAGCCAGG - Intergenic
1164866838 19:31611441-31611463 CAGAAAGAGGGAGAGGAGAGAGG + Intergenic
1164909314 19:31992800-31992822 CAGACTGAGGGAGGGGAGCCAGG - Intergenic
1165344167 19:35233313-35233335 CAGAAAGTGGAAGAAGAGGCAGG + Intergenic
1165549699 19:36573566-36573588 CAGAATGGGGAACAGGAAGCTGG + Intronic
1165690920 19:37862544-37862566 AAGAAGGAGGAAGAGGAGGAGGG + Intergenic
1165827765 19:38714913-38714935 CAGAAGGATGGAGAGGGGCCTGG + Intronic
1166093525 19:40525528-40525550 CAAAACGAGGAGGAGGAGCCCGG + Intronic
1166344986 19:42159880-42159902 GAGATAGAGGAAGAAGAGCCAGG - Intronic
1166546635 19:43638313-43638335 CAGAAAGAGAAACAGAAGCCTGG + Intronic
1166644643 19:44522598-44522620 AAGAATGAAGGAGAGGAACCGGG + Intronic
1166877588 19:45906896-45906918 GGGAATGAGGAAGAGCATCCAGG + Intergenic
1167248855 19:48390373-48390395 CCCACTGAGGCAGAGGAGCCGGG - Intronic
1167270187 19:48501971-48501993 CAGGAGAGGGAAGAGGAGCCAGG - Intronic
1167334074 19:48873943-48873965 CAGAAAGAAGTAAAGGAGCCAGG + Exonic
1167786717 19:51643605-51643627 CAGGGTGAGGACGAGGGGCCAGG + Exonic
1167898734 19:52602161-52602183 CAGAGTGAGGGAGAGGAGGAGGG + Intronic
1167903162 19:52637398-52637420 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167904556 19:52648019-52648041 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167913847 19:52724795-52724817 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167921351 19:52785791-52785813 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167925858 19:52820649-52820671 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167930044 19:52856638-52856660 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167934179 19:52892870-52892892 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167937855 19:52922427-52922449 GAGAATGAGGGAGAGGAGGAGGG - Intergenic
1167940355 19:52941693-52941715 CAGAGTGAGGGAGAGGAGGAGGG - Intronic
1167946372 19:52992360-52992382 CAGAGTGAGGGAGAGGAGGAGGG - Intergenic
1167995211 19:53396116-53396138 CAGAGTGAGGGAGAGGAGGAGGG + Intronic
1168157961 19:54487924-54487946 AAGAATGAGGAACGGGGGCCGGG - Intergenic
1168238319 19:55077042-55077064 CAGGATGAGGAACAGGAGTTTGG + Intronic
1168649648 19:58085229-58085251 GAGGAGGAGGAAGAGCAGCCTGG - Exonic
926439755 2:12875459-12875481 GAGAATGAGGAGGTGGAGGCTGG + Intergenic
926676980 2:15633097-15633119 CAGAACAAGGCAGAGGAACCTGG + Intergenic
926850956 2:17196569-17196591 CAGAAAGAGGAAGAGGGACAGGG - Intergenic
927404034 2:22747513-22747535 CAGAGTGATGAAGAGGAACAGGG + Intergenic
927504155 2:23602447-23602469 CAGAGTGAGGAAGAGCTTCCAGG - Intronic
928150022 2:28818304-28818326 TAAAATGAAGAAGAGGAGCCTGG + Intronic
928358051 2:30638764-30638786 GAGAATGGGGAGGAGGAGCAGGG - Intronic
928775655 2:34759925-34759947 CAGAATGAAGAGTAGAAGCCAGG - Intergenic
929054478 2:37863859-37863881 CAGGAGGAGAGAGAGGAGCCGGG - Intergenic
929325968 2:40611052-40611074 GAGAAAGAGGAGGAGGTGCCGGG + Intronic
929344462 2:40864111-40864133 CAGCATGAGGGAGAGGAGGGTGG - Intergenic
930406790 2:50968531-50968553 CAGAAACAGGAAGTGGATCCAGG - Intronic
930615226 2:53586832-53586854 CACAGTGAGGAAGAGGAGGAAGG + Intronic
930920407 2:56746678-56746700 CACAATGAAGAAGGGGTGCCAGG - Intergenic
930929478 2:56862747-56862769 CAGAAGGAGGAAGCAGACCCTGG - Intergenic
931007196 2:57865234-57865256 AAGAAAGAGGAAGAGGAGAATGG + Intergenic
931230989 2:60374718-60374740 CAGAATGAGGTATAGGATCTGGG + Intergenic
931534301 2:63255538-63255560 CAGAGAGAGGAGGAGGACCCAGG - Intronic
932276985 2:70458907-70458929 CAGAATGGGGCCGGGGAGCCTGG + Intronic
932552975 2:72790941-72790963 CAGAATGGGGAAGGGGAGGATGG + Intronic
932778342 2:74542919-74542941 AAAAATGAGTAAGAGGAGGCTGG - Intronic
932973133 2:76570182-76570204 CAGAGTGAGGAAGAGGGACAGGG + Intergenic
934037938 2:88104284-88104306 AAGAAGGAGGAAGAGGAGAAGGG - Intronic
935702783 2:105826753-105826775 CAGGATAAGGCAGAGGAGCTAGG - Intronic
935750009 2:106223581-106223603 GAGAAAGAGGAGGAGGGGCCAGG + Intergenic
936697265 2:114965680-114965702 CAGAAAGATAAAGAGGAGGCCGG + Intronic
936926541 2:117742713-117742735 CAGGAAGAGGAGGAGGAGCAAGG + Intergenic
937751969 2:125486817-125486839 GAGACTTAGGAAGAGGAGCAGGG - Intergenic
937785173 2:125887460-125887482 CAGATTGGGGAAGAGAAGGCAGG + Intergenic
937833117 2:126445066-126445088 AAGAGTGATGAAGAGGAGCTAGG + Intergenic
937868711 2:126772499-126772521 CAGAAGGAGAAGGGGGAGCCAGG + Intergenic
937873966 2:126806301-126806323 GATACTGAGAAAGAGGAGCCAGG - Intergenic
938962377 2:136354996-136355018 CAGACCGGGGAGGAGGAGCCAGG + Intergenic
940123527 2:150295381-150295403 CTGAAGGTGGAAGAGGAGCCAGG - Intergenic
940861249 2:158772542-158772564 CAGAATTAGAAAGCTGAGCCTGG + Intergenic
941572302 2:167186693-167186715 CAGCATGAGGAAGAGCAAGCAGG - Intronic
941653721 2:168121130-168121152 CAGAATGAAGAAGAAGAGAACGG - Intronic
941675927 2:168343723-168343745 CAGAATGAGAAATGGCAGCCAGG + Intergenic
941809244 2:169739009-169739031 CAGAAGGAGGGAGAGGAGATGGG - Intronic
942321681 2:174741715-174741737 CTGGATGGGGAAGAGGAGGCAGG - Intergenic
942372010 2:175295250-175295272 TGGAAGGAGGAAGAGCAGCCAGG - Intergenic
942414604 2:175745675-175745697 CTGAATGAGGAAGATAAGCCAGG - Intergenic
943247488 2:185473865-185473887 CAGACTGTGGAAGTGAAGCCTGG + Intergenic
943324466 2:186481238-186481260 CAGAAAGTAGAAGAGGATCCAGG - Intergenic
944445035 2:199780536-199780558 CAGAAGCAGGAAGAGAAGCATGG - Intronic
944785741 2:203068003-203068025 CAGAAAGTGGCAGAGTAGCCTGG + Intronic
945030082 2:205655199-205655221 AACAATGAGGAAGTGGAGACAGG - Intergenic
945489031 2:210432874-210432896 CAGAAGGAGGAAGCTGATCCTGG + Exonic
945494073 2:210488772-210488794 AGGAATGAGGAAGAGGAGATAGG - Intronic
946296205 2:218785588-218785610 TAGGATGAGGAAGAGGAAGCAGG + Intronic
946433717 2:219638821-219638843 CAGGATGAGGACGAGGAGGGCGG - Exonic
946459971 2:219860300-219860322 GAGAAAGTGGAAGATGAGCCTGG - Intergenic
946812061 2:223536349-223536371 CAGAATCACGAAGAGCAGTCAGG - Intergenic
947458847 2:230284371-230284393 CAGAATGAGAATGAGAAGGCAGG + Exonic
947792782 2:232877302-232877324 CGGAGTGAGGGTGAGGAGCCTGG + Intronic
947930716 2:233962802-233962824 CAGAATGGTGAATAGGAGCTGGG + Intronic
948002503 2:234579920-234579942 CAGAATGGGGAACAGGGGACAGG + Intergenic
948233007 2:236365613-236365635 CAGCAGGAGGCAGAGGAGCAAGG + Intronic
948336069 2:237208137-237208159 GAGACTGTGGAAGAGGAGGCAGG + Intergenic
948561485 2:238856725-238856747 GACACTGAGGAAGAGGTGCCGGG - Intronic
948578642 2:238969869-238969891 AAGAGGGAGGAAGAGGAGCGAGG - Intergenic
948899306 2:240948088-240948110 CAGAAGGGGGAAGAGCTGCCAGG + Intronic
948939284 2:241188031-241188053 GAGAATGAGGACGAGGAGGAGGG + Intergenic
949032247 2:241802637-241802659 CAGAGGGAGGAGGAGGGGCCGGG + Intronic
1169211677 20:3769165-3769187 CAGAAAGAGGCGGAGGAGGCAGG - Intergenic
1170039324 20:12023578-12023600 CAGAATCAGGAAGTGGAGAAGGG + Intergenic
1170295011 20:14814153-14814175 GAGAAAGTGGAAGATGAGCCCGG + Intronic
1170339406 20:15306647-15306669 CAGAGTGAGGAAGAGAAGAAAGG + Intronic
1170422747 20:16208723-16208745 AACAAAGAGCAAGAGGAGCCAGG + Intergenic
1170504315 20:17009032-17009054 CCTAAAGAGGAAGAGGTGCCAGG - Intergenic
1170673097 20:18453317-18453339 CAGCATCAGGAAGGGGACCCAGG - Intronic
1170700582 20:18699598-18699620 TATAAAGTGGAAGAGGAGCCAGG + Intronic
1170755953 20:19207253-19207275 CTGAGTGTGGCAGAGGAGCCTGG - Intergenic
1170779591 20:19412421-19412443 GAGAAGGAGGAAGAAGAGACAGG + Intronic
1170809721 20:19664484-19664506 CAAAATGAGGATGAGGAGGAAGG - Intronic
1170929056 20:20752240-20752262 CAGAATGGGGAGGAGGAAACAGG + Intergenic
1170963697 20:21048214-21048236 TTGAATGAGGAAGTAGAGCCTGG - Intergenic
1171121839 20:22575460-22575482 CAGAATGGGGAAGATGGCCCAGG + Intergenic
1171255943 20:23689109-23689131 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171263292 20:23751006-23751028 AAGAAAGAGGAGGAGGAGTCAGG - Intronic
1171272356 20:23826800-23826822 CAGAAAGAGGAGGAGGAGTCAGG - Intergenic
1171278796 20:23879821-23879843 TAGAAAGAGGAGGAGGAGCCAGG - Intergenic
1171754919 20:29097247-29097269 GAGAAAGAGGAACAGGAGCTGGG - Intergenic
1172212934 20:33213687-33213709 AAAAATGTGGAAGGGGAGCCAGG - Intergenic
1172274121 20:33670577-33670599 TAGGATGAGGAAGAGGGGGCAGG - Intronic
1172274836 20:33673887-33673909 CTGACTGGGGAAGGGGAGCCTGG - Intronic
1172560565 20:35884348-35884370 CAGCAGGAGGAGGAGGAGCTGGG + Intronic
1172595497 20:36148500-36148522 GAGAATGAGGCTGAAGAGCCAGG + Intronic
1173848174 20:46201113-46201135 CAGCATGGGGAAGCGGAGGCCGG - Intronic
1174171378 20:48620052-48620074 CAGCATGGGGAACTGGAGCCTGG + Intergenic
1174581702 20:51576855-51576877 CAGACTGGGGAGGAGGGGCCTGG + Intergenic
1174657234 20:52181751-52181773 CAGATTCAGGAGGTGGAGCCCGG + Intronic
1174723880 20:52841045-52841067 AAGAATAAGGAAGAGGAGAGGGG - Intergenic
1177759834 21:25390938-25390960 TAGAATGAAGAGGAGGAGACTGG - Intergenic
1177817270 21:25991157-25991179 CAGAATGAGGAAGAGTGGGAAGG + Intronic
1178110682 21:29367104-29367126 CAGAAAGAGGAGGAGGTGCCAGG - Intronic
1178287751 21:31339355-31339377 CAGGAGGAGGAAGAGGAGGCTGG - Exonic
1178353707 21:31892962-31892984 CAGGAGGAGGCAGAGAAGCCAGG - Intronic
1178513939 21:33230330-33230352 CAGGAGGAGGAGGAGGAGTCGGG - Intronic
1178573626 21:33764390-33764412 CAGAATAAGGAAGAGCGGGCAGG + Intronic
1179164500 21:38925077-38925099 CTCAGTGAGGAAAAGGAGCCAGG + Intergenic
1179303827 21:40136813-40136835 CAGAATGAGGAAGAGGAGCCTGG + Intronic
1179482004 21:41684474-41684496 CGGGAGGAGGGAGAGGAGCCAGG + Intergenic
1179649311 21:42796529-42796551 AAGAATGAGGAAGAGGTCCCAGG - Intergenic
1179678809 21:43003269-43003291 CAGAGTGGGGGAGAGCAGCCGGG - Intronic
1179873666 21:44256630-44256652 CAGGATGAGCAAGACCAGCCTGG - Intronic
1180228906 21:46414596-46414618 CAGGAGGAGGAGGAGGAGCAGGG - Intronic
1180228924 21:46414665-46414687 CAGGAGGAGGAGGAGGAGCAGGG - Intronic
1180411972 22:12621355-12621377 GGGAATGAGGAACAGGAGCTGGG - Intergenic
1180765942 22:18345950-18345972 CAGGATGAGGAAGAGGACTTTGG + Intergenic
1180780371 22:18516428-18516450 CAGGATGAGGAAGAGGACTTTGG - Exonic
1180813087 22:18773749-18773771 CAGGATGAGGAAGAGGACTTTGG - Intergenic
1181199264 22:21208065-21208087 CAGGATGAGGAAGAGGACTTTGG - Exonic
1181319126 22:21991192-21991214 TTGAATGAAGAACAGGAGCCAGG - Intergenic
1181398242 22:22636032-22636054 CAGAGTGGGGAAGAGGAGAGTGG - Intergenic
1181651172 22:24260028-24260050 CAGAGTGGGGAAGAGGAGAGTGG + Intergenic
1181706209 22:24650711-24650733 CAGAGTGGGGAAGAGGAGAGTGG - Intergenic
1181886087 22:26023514-26023536 CAGGAGGAGGAAGAGGAGGAGGG - Intronic
1182019771 22:27071635-27071657 GAGCATGAGGGAGAGGAGCAGGG + Intergenic
1182668302 22:31974825-31974847 CTGAATGATGAGAAGGAGCCAGG + Intergenic
1182675992 22:32040408-32040430 TGGAAGGAGGAAGAGGAGACAGG + Intergenic
1182843246 22:33409288-33409310 CGGAAGGAGGAGGAGGAGGCTGG + Intronic
1183007754 22:34917361-34917383 AAGAATGTGGAGGAGGAACCAGG + Intergenic
1183217482 22:36490279-36490301 CAAAATGAGGAGAATGAGCCAGG + Intronic
1183225973 22:36550133-36550155 CAGAATAGGGAAGACGGGCCAGG + Intergenic
1183282994 22:36942794-36942816 AACAATGAGGAAGAGGCCCCAGG - Intergenic
1183508911 22:38223765-38223787 GAGGATGGGGAAGAGGAGGCTGG - Intronic
1183546910 22:38459238-38459260 CAGAAAGTGGAAGTTGAGCCTGG - Intergenic
1183775000 22:39958205-39958227 GAGACTGAGGAGGAGAAGCCAGG - Intronic
1183820590 22:40342986-40343008 CTGAATGAGGAAGAAGACTCAGG + Intergenic
1184955844 22:47885461-47885483 CAGACAGATGGAGAGGAGCCTGG - Intergenic
1185109811 22:48894635-48894657 TAGAATGAGGAAGAAAAGCCTGG - Intergenic
1185200200 22:49497767-49497789 TAGAATGAGTAAGAAGAGGCCGG + Intronic
1203227561 22_KI270731v1_random:86841-86863 CAGGATGAGGAAGAGGACTTTGG + Intergenic
949618915 3:5788027-5788049 CAGAGGGAGGGAGGGGAGCCTGG - Intergenic
950042682 3:9930300-9930322 TAGAATGAGGTAGAGGGGACTGG - Intronic
950113390 3:10434900-10434922 AAATATGAGGAAGAGGGGCCAGG - Intronic
950276649 3:11666946-11666968 TGGAATGAGGAAGCGGAGTCAGG - Intronic
950280268 3:11701252-11701274 AAGAAAGAGGAAGAGGTGCCAGG - Intronic
950336095 3:12194649-12194671 GAGAATGAATAAGATGAGCCAGG + Intergenic
950665940 3:14494997-14495019 CAGAAGGAGGAGGAGGTTCCTGG + Intronic
951897426 3:27623499-27623521 CAGAATGAGGAATAGGCCTCAGG - Intergenic
952130157 3:30352774-30352796 CAGAAAGAGGAAAATGAGACAGG + Intergenic
952635343 3:35522632-35522654 GAGAATGAGGCAGAGGAGGCAGG - Intergenic
953134356 3:40169980-40170002 CAGCAAGTGGAAGAAGAGCCAGG + Exonic
953525380 3:43686105-43686127 AGGAATGAGGAAGAGGAGCATGG - Intronic
954108359 3:48421032-48421054 TTGAATGGGGAAGAGGACCCGGG + Intronic
954272935 3:49523669-49523691 GAGAACTAGGGAGAGGAGCCTGG + Intronic
954280113 3:49571280-49571302 CAGGACAGGGAAGAGGAGCCTGG + Intronic
954774697 3:53006279-53006301 CGGAATGGGGAGGAAGAGCCTGG + Intronic
955148544 3:56344317-56344339 GAGAATGAGGAGGAGGAGGAGGG - Intronic
955488633 3:59460469-59460491 CAGAAGGAGGCACAGGACCCAGG + Intergenic
958689564 3:97446221-97446243 CATGATGAGGAAGAGGGTCCAGG - Intronic
959029316 3:101279536-101279558 CAGAAAGAGGAAGGGGAACCTGG + Intronic
959459381 3:106605941-106605963 ATGAATGAGGAAGAGGAGTGTGG + Intergenic
959650608 3:108746991-108747013 CAGAAAGAGGAAAAAGAACCTGG - Intronic
959744359 3:109759408-109759430 GAGAAGGAGGAGGAGGAGACGGG - Intergenic
959972818 3:112426404-112426426 AAGAAAGAGGAGGAGGTGCCAGG + Intergenic
960002025 3:112742565-112742587 CAGAATGAATAAGAGCTGCCTGG + Intergenic
960250163 3:115442953-115442975 GAGAGAGAGGAAGAGGTGCCAGG + Intergenic
960473827 3:118099565-118099587 CAGAATGAAGCAGAGATGCCAGG + Intergenic
960943014 3:122946814-122946836 CAGAATGGGGAAGGGGAGAGGGG + Intronic
961091774 3:124118982-124119004 CAGTATGATGAAAAGGAGACCGG - Intronic
961219924 3:125191733-125191755 CAGGAGGTGGAAGAGGAGCTGGG - Intronic
961644716 3:128386753-128386775 GAGAGTGAGGAGGAGGTGCCAGG + Intronic
961866655 3:129958360-129958382 AAGAAAGAGGGAGAGGAGACTGG + Intergenic
962865940 3:139448090-139448112 GAGAATGAGGAAGAAGAGAAAGG - Intergenic
962922421 3:139963088-139963110 GAGAATGAGGAGGAGGAGGGGGG + Intronic
963311469 3:143714800-143714822 CAGAGTGGGGAAGAAGAGTCAGG + Intronic
964413501 3:156423812-156423834 CAGAGTCAGGAAAATGAGCCAGG + Intronic
964624950 3:158749838-158749860 GAGAATGAGAAAGAGGTGCCAGG - Intronic
964734656 3:159904110-159904132 AAGAATGAGACAGAGGAGACCGG - Intergenic
965142677 3:164860053-164860075 CAGTTTGAGGAAAAGTAGCCTGG - Intergenic
965612643 3:170561073-170561095 CAGAAGGAAGAAGTGGAGGCAGG - Intronic
965680189 3:171242314-171242336 GAAAATGAGGAAGAGGAGGAAGG - Intronic
965761166 3:172078497-172078519 CAGAAGAAGGTAGAGGAGCCAGG + Intronic
966603217 3:181795865-181795887 CAAAATAAGGAAGAGAGGCCAGG - Intergenic
966621397 3:181968140-181968162 CAGAGTGAGAAAGTGGAGGCCGG + Intergenic
966828800 3:183988337-183988359 CAGACTCAGGAAGAGAAGCGGGG + Intronic
968224554 3:196965596-196965618 GAGAATGAGGAACAAGAGCTGGG - Intronic
968239186 3:197060433-197060455 CAGAATGAAAAATAGGAACCTGG - Intronic
968438706 4:610477-610499 CAGAGAGTGGCAGAGGAGCCAGG + Intergenic
968585297 4:1413591-1413613 GAAACTGAGGCAGAGGAGCCAGG - Intergenic
968685915 4:1958494-1958516 CAGCAGGAGGAAGTGCAGCCAGG + Intronic
969107322 4:4817501-4817523 CAGAATGATGCGCAGGAGCCAGG - Intergenic
969311299 4:6354266-6354288 GAGACTGAGGAAGAGCAGGCAGG - Intronic
969469618 4:7379953-7379975 CAGACTGGGGATGGGGAGCCAGG - Intronic
969689114 4:8694577-8694599 GAGAGTGAGGAGGAGCAGCCGGG + Intergenic
969696829 4:8739839-8739861 CTGCAGAAGGAAGAGGAGCCTGG + Intergenic
969913557 4:10467055-10467077 GAGAGAGAGGAAGAGGTGCCAGG + Intergenic
970612350 4:17737582-17737604 CAGAATGAGGAAGGTGATCCTGG - Intronic
971895894 4:32593536-32593558 GAGAAAGAGGAAGAGGTGCCAGG - Intergenic
972538387 4:40018293-40018315 CAGAATGAAGAAGAGAAGAGAGG - Intergenic
973118474 4:46489318-46489340 CAGGCTGAGGAAGAGTAGGCAGG - Intergenic
973766521 4:54168178-54168200 CAGAAAGATGAGGAAGAGCCAGG + Intronic
973769699 4:54195279-54195301 CAGCATGAGGAAGCAGAGCCTGG - Intronic
974193809 4:58542999-58543021 AAAAATGAGGAAGAGAGGCCAGG + Intergenic
975619723 4:76284111-76284133 AAGAGAGAGGAGGAGGAGCCAGG - Intronic
975648591 4:76569459-76569481 CAGAATGAGGAAGAGAAGTCAGG + Intronic
976305146 4:83552576-83552598 CAGATGGTGGAAGAGGAGGCAGG + Intronic
976551033 4:86395811-86395833 CAGGATGAGGAAGAGACACCAGG - Intronic
977135834 4:93303078-93303100 GAGAAGGAGGAAGAGGAAACAGG + Intronic
977168923 4:93735970-93735992 AAGAATGAGAAAGAGGATACTGG + Intronic
977804729 4:101283609-101283631 GGGAAGGAGGAAGTGGAGCCAGG - Intronic
978134918 4:105245651-105245673 CAGAAAGAGCAAGAGGAGTCAGG - Intronic
978182989 4:105824185-105824207 CAGAATGATGACGAGGGGACAGG + Intronic
979897751 4:126181092-126181114 GAGAATGAGGAAGATGAGACTGG - Intergenic
980039288 4:127920792-127920814 CAGCATCTGGAAGTGGAGCCCGG - Exonic
980279548 4:130702023-130702045 CAGAATCAGGCAGGGGAGCCTGG + Intergenic
980643860 4:135616253-135616275 GAGAATGAAGAAGATGAGGCCGG - Intergenic
981270927 4:142846590-142846612 GAGGAGGAGGAAGAGGAGCGGGG - Intronic
981619322 4:146676249-146676271 GAGAATGAGGTAGAGGAGAGAGG - Intergenic
981825488 4:148935905-148935927 GAGAGAGAGGAGGAGGAGCCGGG - Intergenic
982034658 4:151333884-151333906 CAGAAGCTGGAAGAGAAGCCTGG - Intergenic
982438028 4:155400051-155400073 CAAGATGAGGGAGAGGAGCAAGG - Intergenic
982723082 4:158879421-158879443 CAGAGTGAGGATGAGAAGCAGGG + Intronic
982770282 4:159390753-159390775 CACATTGTGGAAGAGGACCCGGG - Intergenic
983317532 4:166151153-166151175 AAGAAAGAGGAAGAGGAGAGTGG + Intergenic
983523389 4:168734761-168734783 GAGAAGGAGGAGGAGGAGCCAGG + Intronic
983591529 4:169417455-169417477 CAGAATTAGGAAGAGAAGTTAGG + Intronic
983884255 4:172962884-172962906 CAGAAGCAGGGAGATGAGCCAGG - Intronic
984616442 4:181903872-181903894 CAGAATGAAAAAGAAGAGGCAGG - Intergenic
985319692 4:188696810-188696832 CCCAATGAGGATGAGCAGCCTGG - Intergenic
985485474 5:146145-146167 CAGAATGGGGGAGAGGAGGGAGG - Intronic
985860642 5:2467928-2467950 GAGAAGGATGAAGAGGAGGCAGG - Intergenic
986026212 5:3853792-3853814 AAGAAGGAGGAAGAGGAGGAGGG + Intergenic
986061864 5:4199256-4199278 CAGACCCAGGGAGAGGAGCCAGG - Intergenic
986067067 5:4245154-4245176 CAGAATGAGGAGGAAGAGAAAGG - Intergenic
986200534 5:5574413-5574435 CAAAATCAGTAAGAGAAGCCAGG + Intergenic
986569542 5:9150784-9150806 CAGAATGAGGAAGAGGCTAACGG + Intronic
987425287 5:17766131-17766153 GAACATGAGTAAGAGGAGCCAGG - Intergenic
987504414 5:18750104-18750126 CAGGATGGGGAAGAGAAGGCAGG - Intergenic
987568748 5:19627887-19627909 CAGAATGATGATGATGGGCCAGG + Intronic
987578313 5:19758043-19758065 CAGACTGGGGAAGAGAAGGCAGG + Intronic
987627737 5:20424454-20424476 CAAAATGAGGAAGTGAGGCCTGG + Intronic
987809662 5:22818244-22818266 GATAATGAGGAAGAGATGCCAGG - Intronic
987885476 5:23806768-23806790 CAGGATGAGGGAGAGAAGGCAGG - Intergenic
988228796 5:28448392-28448414 CAGGCTGAGGAAGAGAAGGCAGG - Intergenic
990165832 5:52992293-52992315 CAGAATGAAGAGGAGGATTCAGG - Intronic
990513462 5:56510578-56510600 CAGAATGAGCAAGGGGGGCAGGG - Intergenic
990989203 5:61668864-61668886 CAGAATCTGGAGGAAGAGCCAGG + Intronic
991368541 5:65894438-65894460 CTGAATGGGGAAAAGGAGACAGG - Intergenic
991560604 5:67947602-67947624 CAGAATGGGGAGCAGGGGCCAGG - Intergenic
992423969 5:76636458-76636480 CAAAATGAGTCAGAGGAACCAGG + Intronic
993139861 5:84018575-84018597 CACAAGGAGGTAGAGGAGCCAGG - Intronic
993499983 5:88654739-88654761 AAGAATCAGGAAGGGGCGCCGGG + Intergenic
994055824 5:95413886-95413908 AAGAATGAGCTGGAGGAGCCAGG - Intronic
995856355 5:116597067-116597089 GAGAGAGAGGAGGAGGAGCCAGG - Intergenic
996411278 5:123162043-123162065 CTGAGTGAGAAAGAGGAGTCAGG + Intronic
997346594 5:133196721-133196743 GAGAAGGAGGAAGAGGAGGAAGG - Exonic
997348529 5:133211733-133211755 CAGAATGAAGAGGAGAAGCCAGG - Intronic
998200149 5:140113016-140113038 CAGAAGGAGGAGGGGGAGGCGGG + Intronic
999084814 5:148878257-148878279 GAGAATGAGGAAGAAGAGGAGGG + Intergenic
999540528 5:152566848-152566870 TAGGAGGAGGAAGAGGAGACGGG - Intergenic
999694796 5:154179368-154179390 CAGAGGGAGGGAGAAGAGCCAGG - Intronic
999794913 5:154980085-154980107 GAGAATGAGTAAGATGAGCCTGG - Intergenic
1000199917 5:158997994-158998016 CAGAATGAGGAGGAGGTAGCAGG - Intronic
1000282869 5:159797316-159797338 CAGAATAAGGAGGAGAATCCTGG + Intergenic
1000873502 5:166606177-166606199 GAGAAGGTGGAAGAGGAGGCAGG - Intergenic
1001184582 5:169556646-169556668 GAGAAGGAGGAAGAGGTGGCAGG - Intergenic
1001395878 5:171419542-171419564 CACAATGAGGATGCGGGGCCTGG - Intergenic
1001758120 5:174186301-174186323 CAGAGGGAGCAGGAGGAGCCGGG - Intronic
1001962358 5:175887237-175887259 CAGATTGAGGAAGATCAGCTGGG + Intergenic
1002505952 5:179679235-179679257 CAGAATGATGAAGGCGAGCCAGG + Exonic
1002681325 5:180967558-180967580 GAGAATGGGGAAGAGGAGGAGGG - Intergenic
1002763620 6:220071-220093 CAGAATGGGGAACTGGAGCCGGG + Intergenic
1002884656 6:1282767-1282789 GAGAGAGAGGAAGAGGACCCAGG - Intergenic
1003003378 6:2358277-2358299 AAAAATGATGAAGATGAGCCGGG - Intergenic
1003113878 6:3270503-3270525 CAGCCTGAGGAGGAGGAGGCCGG - Exonic
1003227083 6:4215725-4215747 AAGAAAGAGGAGGAGGTGCCAGG - Intergenic
1003447172 6:6195267-6195289 CCAAAGGAGGAAGGGGAGCCTGG - Intronic
1003789253 6:9524506-9524528 TAGAATGTGGAAGAGTAGTCTGG + Intergenic
1004276866 6:14244346-14244368 CAGAATGAGGATTAGGACCCAGG + Intergenic
1004482395 6:16033310-16033332 CAACATGAGGAAGAGGCCCCAGG + Intergenic
1005083625 6:21981564-21981586 CAGAACAAGAAAGAGGAGGCAGG - Intergenic
1005388916 6:25313554-25313576 CAGCATGAGGATGAGGGGCAGGG + Intronic
1005661504 6:28003304-28003326 CAGACGGAGAGAGAGGAGCCAGG + Intergenic
1005687938 6:28273091-28273113 CAGTAAGAGGAAGAAGAGCAAGG - Intronic
1005852339 6:29830869-29830891 CAGCATGAGGAAGAGGGTCATGG - Exonic
1005896921 6:30186291-30186313 GAGGAGGAGGAAGAGGAGGCCGG - Exonic
1006189823 6:32201044-32201066 CAGAGGGAGGAAAGGGAGCCAGG - Intronic
1006391565 6:33761840-33761862 GAGACTGAGGATGAGGAGACTGG - Intergenic
1006609743 6:35287147-35287169 CAGAATGAGCAGGAGGAAACTGG + Intronic
1006621920 6:35371296-35371318 CGGAAAGAGGAAGAGGAACCAGG - Intronic
1006876601 6:37302922-37302944 CAGAATGAGAGAGAGCAACCTGG - Intronic
1007346881 6:41237395-41237417 CAGAGTGCTGGAGAGGAGCCTGG - Exonic
1007941021 6:45781645-45781667 GAGAATGAGGAAGAAGAGAAGGG + Intergenic
1007969200 6:46033607-46033629 CAGAATGAGGAAGGGCTGGCAGG - Intronic
1008149665 6:47935438-47935460 CAGAAAGCGCAAGATGAGCCAGG - Intronic
1008508602 6:52255374-52255396 CAGACAGAGGAAGAGCAGGCAGG - Intergenic
1009400394 6:63247901-63247923 CAGGATGAGGAAGAGCAGGAAGG + Intergenic
1011034230 6:82955995-82956017 CAGAAAGAGGAAGAGCATCACGG + Intronic
1011627725 6:89296945-89296967 CAGTATGTAGAAGAAGAGCCTGG - Intronic
1012985113 6:105867365-105867387 CTGAAGGAGGAATAGGAGTCTGG + Intergenic
1012990662 6:105922586-105922608 AAGAAGGAGGAAGAGGAGGAAGG + Intergenic
1013226382 6:108121769-108121791 CATACTGAGGAAGAGTAGCTGGG - Intronic
1013760420 6:113511327-113511349 CAGACAGAGGAAAAGGAGCATGG - Intergenic
1013803324 6:113970932-113970954 CAGCAGCAGGAGGAGGAGCCCGG - Exonic
1013922215 6:115419799-115419821 CAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1014089852 6:117391431-117391453 CAGAGTGAGGAGGAGAAGCTGGG + Intronic
1014528074 6:122524219-122524241 GAGGATGAGGAAGAGGAGGAGGG - Intronic
1014823911 6:126026196-126026218 AGAAATGAGGAAGAGTAGCCTGG + Intronic
1015123027 6:129721958-129721980 CAGGATGGGGAAGGGGAGGCAGG + Intergenic
1015846913 6:137530527-137530549 CAGAATTAGCAAGAGGAGAGTGG - Intergenic
1015939167 6:138431542-138431564 CAGGAGGAGGAGGAGGAGCCGGG + Exonic
1016168915 6:140983812-140983834 GAGAATGAGGAAGAGGTTGCAGG - Intergenic
1016805905 6:148211902-148211924 TAGAATAGGGAAGAGAAGCCAGG + Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017301103 6:152859052-152859074 GAAAACGAGGAAGAGGAGACTGG - Intergenic
1017437443 6:154429713-154429735 GAGAAGGAGGAGGAGGAGACGGG - Intronic
1017978270 6:159376331-159376353 TAGAAAGATGAAGAGGAGGCAGG + Intergenic
1018323216 6:162635306-162635328 CAGAATGAGAAAGAGGGGAAGGG - Intronic
1018463639 6:164022573-164022595 AAGAAGGAGGAAGAGGAGAATGG + Intergenic
1019032869 6:169027739-169027761 CAGAAGGAGGAAGAGAAGGCGGG + Intergenic
1019346845 7:535288-535310 CAGGGTGAAGAGGAGGAGCCGGG - Intergenic
1019516975 7:1444482-1444504 GGGAATGGGGAGGAGGAGCCAGG - Intronic
1019603513 7:1897140-1897162 CAGAAGGAGGAGGAAGAGCCGGG + Intronic
1020125517 7:5530786-5530808 GAGATTGAGGAAGAGGAGGAGGG + Intronic
1020775757 7:12451692-12451714 GACAATGAGGAAGAGGAGCCAGG - Intergenic
1020998982 7:15303687-15303709 CAGAAGAAGGAAGTGGAGCATGG + Intronic
1021315714 7:19145115-19145137 GAGGAGGAGGAAGAGGAGCGCGG - Exonic
1021546779 7:21822321-21822343 GAGAATGGGCAGGAGGAGCCAGG + Intronic
1021744585 7:23725954-23725976 CAAAGGGAGGAAGAGGTGCCAGG + Intronic
1021886367 7:25143946-25143968 CTGAATGGGGAAGTGGAGCTGGG + Intronic
1021908661 7:25362297-25362319 CAGAAGGAGGAAGAGCAAACTGG + Intergenic
1022258852 7:28685043-28685065 CAGAGTGAGGAAAAACAGCCTGG - Intronic
1022425987 7:30269284-30269306 CTGGTGGAGGAAGAGGAGCCAGG - Intergenic
1022667970 7:32428883-32428905 CAGAAGCAGGAAGGGAAGCCTGG + Intergenic
1023558141 7:41444815-41444837 CAAAATGAGGAGAAGGTGCCAGG - Intergenic
1023689345 7:42770138-42770160 CAGGATGAGGAAGCAGAGCGAGG - Intergenic
1023849286 7:44141177-44141199 CAGGGAGAGGAAGAGGATCCTGG - Intronic
1023860993 7:44217699-44217721 CAGAATGGGGAACAGGACACAGG - Exonic
1023959174 7:44912490-44912512 CAGAGTGAGAGAGAAGAGCCAGG + Intergenic
1024222539 7:47299755-47299777 CAGAAGTAGGCTGAGGAGCCTGG + Intronic
1024884310 7:54124378-54124400 CAGACTGAGGGAGAGAAGGCAGG + Intergenic
1025100515 7:56130998-56131020 CAGAAAGAGAAAGAGAAGACAGG - Intergenic
1025147858 7:56520515-56520537 CAGAAAGAGAAAGAGAAGACAGG - Intergenic
1025794304 7:64723627-64723649 CAAAATGAGGAAGGTGAGGCTGG + Intergenic
1026318539 7:69248803-69248825 CAGAAAGAGAAAGAGAAGACAGG + Intergenic
1026464558 7:70643048-70643070 CAAAATGAAGATGAGGAGACGGG - Intronic
1026499946 7:70935629-70935651 CTGAATAAGGAAGAGGGGGCAGG - Intergenic
1027348433 7:77286235-77286257 GAGAAAGAAGCAGAGGAGCCAGG + Intronic
1027544005 7:79503715-79503737 TAGACTGAGGAAGAGGAGAAGGG + Intergenic
1027569222 7:79842321-79842343 CAGAATATGGAAGAGGAGAAAGG - Intergenic
1029112255 7:98218310-98218332 CAGAAAGAGGATCAGGAGGCCGG - Intronic
1029198838 7:98825445-98825467 GAGAGTGAGGAGGAGGTGCCAGG - Intergenic
1029611050 7:101626749-101626771 GGGAATGAGGAAGAGGAGGGTGG - Intronic
1029623564 7:101705641-101705663 GAGAAAGAGGAAGAGGAGGTGGG + Intergenic
1030275324 7:107714715-107714737 CAGAATGAGGACTAGCACCCAGG - Intronic
1031144224 7:117979915-117979937 CAAAATGAGCAAGAGAAGCTTGG - Intergenic
1032523188 7:132561573-132561595 GAGAAGGAGGAAGAGGAGGAGGG - Intronic
1033184194 7:139210912-139210934 CAGCAGGAGGAAGAGAAGCAGGG + Intergenic
1033480708 7:141737713-141737735 CAGAAAAAGAAAGGGGAGCCAGG - Intergenic
1033890445 7:146006434-146006456 GAGGAGGAGGAAGAGGAGCAGGG - Intergenic
1034460922 7:151197659-151197681 CGGCATGGGGAAGAGGAGCAAGG - Intronic
1034590521 7:152134258-152134280 CTGAAGGATGAAGAGGAGCTGGG - Intergenic
1035019840 7:155794387-155794409 CAGAACTGGGAAGAGGTGCCAGG + Intergenic
1035120495 7:156562811-156562833 CAGAATGAGGAAGAGGAAATTGG + Intergenic
1035538998 8:417110-417132 CAGCATGGGTAAGGGGAGCCCGG + Intronic
1035759845 8:2061394-2061416 CAGACAGAGGGAGAGAAGCCAGG - Intronic
1036424726 8:8633783-8633805 CAGTCTCCGGAAGAGGAGCCAGG - Intergenic
1036490692 8:9222645-9222667 CAGAATGAGGAAGACTGGCTTGG - Intergenic
1036557852 8:9875794-9875816 CAAAATGAGGAAGAGGTGGCTGG + Intergenic
1037041694 8:14244258-14244280 AAGAATGAGGAAGAGGAAGAAGG - Intronic
1037443192 8:18938324-18938346 AAGAATGAGGGAAAGGGGCCAGG + Intronic
1038020759 8:23550412-23550434 AGGAATGAGCAAGAGGAGGCTGG + Intronic
1038962739 8:32539365-32539387 AAGAATGAGGAAGAGGACCCAGG + Intronic
1039195654 8:35028504-35028526 CAGAAAGAGGAAAAGGAGCAGGG + Intergenic
1039950146 8:42164532-42164554 GACACTGAGGAAGAGGAGCTGGG + Intronic
1040447654 8:47511873-47511895 GAGGATGAGGAAGAGGAGGAAGG - Intronic
1040449104 8:47526147-47526169 CAGTGTGAGGAAGCTGAGCCTGG - Intronic
1040719423 8:50299299-50299321 AAGAAGGAGAAAGAGGAGACAGG - Intronic
1041291155 8:56310085-56310107 AAGAAGGAGGAAGAGGAGGAAGG + Intronic
1041313469 8:56539163-56539185 CAGAATGGGGAGGAGGAGGGAGG + Intergenic
1041854516 8:62435393-62435415 CAGAATTAGTATGTGGAGCCAGG + Intronic
1041904358 8:63015197-63015219 CAGAATGAAGAATCAGAGCCAGG + Exonic
1043829408 8:84970000-84970022 CAGAGAGAGGAAGAGAAGGCTGG + Intergenic
1044701027 8:94965340-94965362 GGGAATGAGGAAGAAGAGGCTGG + Intronic
1044897048 8:96903529-96903551 CATGAAGAGGAAGAGGAGACAGG - Intronic
1044995043 8:97830619-97830641 CAGAAGGAGGTAGAGGAGTTAGG + Intronic
1045367325 8:101488657-101488679 CAGCATGAGAAAGAGGAGAGAGG + Intergenic
1045773773 8:105776986-105777008 CAGAATCAGAAAGAGGAAGCAGG - Intronic
1046420662 8:113979798-113979820 TAAAATGAGGAAGAAGAGTCAGG + Intergenic
1046444981 8:114306670-114306692 CAGGATGAGGAGGAAGAGCTGGG - Intergenic
1046654530 8:116878570-116878592 CAGAATGGGGCAGAGTATCCCGG - Intergenic
1046680576 8:117164956-117164978 CAGAATGGGGGAGAGGAGGCAGG - Intronic
1046740224 8:117819860-117819882 CAGCATGAGGCAGCGGAGCAAGG - Intronic
1047280419 8:123440449-123440471 CAGAAAGACGAAAAGCAGCCAGG - Intronic
1047427269 8:124758190-124758212 CAGAAAGATCAAGAGGAGCCAGG + Intergenic
1047541222 8:125768486-125768508 GAGAAGGAGGAGGAGGACCCAGG + Intergenic
1047938693 8:129806793-129806815 GAGAGAGAGGAAGAGGTGCCAGG - Intergenic
1048032201 8:130643238-130643260 GAGAATGGAGTAGAGGAGCCTGG - Intergenic
1048139384 8:131778255-131778277 CAGAATCAGGAAGTGAATCCAGG - Intergenic
1048317304 8:133371680-133371702 AAGAATGAGGAAGAGCAGAAAGG + Intergenic
1048468726 8:134688558-134688580 CAAAAGGAAGAAAAGGAGCCAGG + Intronic
1051434626 9:17017993-17018015 CAGAATTCAGAAGAGGAGACCGG + Intergenic
1052558408 9:30050559-30050581 TAGGGTGAGGAAGAGGAACCAGG - Intergenic
1052773414 9:32710065-32710087 CAGCATCTTGAAGAGGAGCCGGG + Intergenic
1053293595 9:36898128-36898150 GAGAATGAGAAAGAGGAACAAGG + Intronic
1053299344 9:36937569-36937591 CAAACACAGGAAGAGGAGCCTGG - Intronic
1053317955 9:37068565-37068587 GAGAATGAGGAAGGGGAGATGGG + Intergenic
1053944849 9:43296390-43296412 CAAAATGGGGAAGATGAGTCGGG + Intergenic
1055319444 9:75068025-75068047 CATAATGAGGTTGAGGTGCCTGG - Intronic
1055454301 9:76458974-76458996 CACAGTGAGGAAGAGGAGCGAGG + Intronic
1055532145 9:77194770-77194792 CAGAAGGAGGATGCGGATCCTGG - Intronic
1055558909 9:77503059-77503081 AAGAATAAGGAAGATGAGCAGGG - Intronic
1055599243 9:77898143-77898165 GAGAAAGAGGGAGAAGAGCCTGG - Intronic
1055723123 9:79197909-79197931 CAGGATGAGGAGGAGGAGGAAGG - Intergenic
1056194247 9:84214045-84214067 CACAGTTAGGAAGCGGAGCCAGG - Intergenic
1056526415 9:87446941-87446963 CAGCATGAGGTAGTGGAGCTGGG - Intergenic
1056527581 9:87457566-87457588 TATAAAGAGGAAGATGAGCCAGG + Intergenic
1056755151 9:89377003-89377025 CAGGACAGGGAAGAGGAGCCAGG + Exonic
1057068709 9:92077514-92077536 CAGGAGGAGGCAGAGGAGCTAGG - Intronic
1057565644 9:96164071-96164093 ATGAATTAGGAAGAGGAGCGGGG + Intergenic
1057761615 9:97879179-97879201 TGGAAGGAGGAAGAGGAGACAGG - Intergenic
1057922009 9:99105234-99105256 CAGCACGAGGAGGAGCAGCCGGG - Exonic
1058017910 9:100056802-100056824 CAGAATGTGGAAGTGGAGAGAGG + Intronic
1059142142 9:111863836-111863858 CAGAAATAGGAAGAGAAGGCAGG - Intergenic
1059357155 9:113708824-113708846 GAAACTGAGGAAGAGGGGCCAGG - Intergenic
1059420266 9:114186262-114186284 GAGAATGAGGCAGAGAAGCTAGG + Intronic
1060089657 9:120731742-120731764 CTGAATGAGAACGAGGAGGCAGG + Intergenic
1060406805 9:123376899-123376921 CAGGAGGAGGAGGAGGAGGCAGG - Exonic
1060763494 9:126275755-126275777 CAGAAAGAGATAGAGAAGCCAGG + Intergenic
1060978912 9:127781347-127781369 CAGACTGAGGAAGAGGGGCAAGG - Intergenic
1061380569 9:130254310-130254332 CAGAGAGAGGAAGAGAAGCCTGG - Intergenic
1061979104 9:134089919-134089941 CAGAAGGTGAAAGAGGAGGCGGG + Intergenic
1062080794 9:134622429-134622451 GAGAAGGAGGAAGAGGAGGATGG - Intergenic
1062294131 9:135814684-135814706 GTGAATGAGGAACAGGGGCCAGG - Intronic
1062744610 9:138203433-138203455 GAGAATTAGGAAGAGGAGGAGGG + Intergenic
1203782330 EBV:107576-107598 CAGGATGAGGAAGAGGTTCACGG - Intergenic
1203587984 Un_KI270747v1:24968-24990 CAAAATGGGGAAGATGAGTCGGG + Intergenic
1185499258 X:584794-584816 GAGAAAGAGGAAGAGGAGAGGGG + Intergenic
1185575471 X:1168957-1168979 GAGAAAGAGGAAGAGGAGGAGGG + Intergenic
1185745563 X:2569932-2569954 GAGAGAGAGGAGGAGGAGCCAGG + Intergenic
1185814997 X:3146430-3146452 AAGGATGAGGAAGAGGAGGAGGG - Intergenic
1185853788 X:3513361-3513383 GAGAATGAGGCAAAGGAGTCTGG + Intergenic
1186771038 X:12818423-12818445 CAGAAATAGGGAGGGGAGCCTGG + Intronic
1187164835 X:16795483-16795505 AAGAATGAGTAAAAGGATCCGGG - Intronic
1187217682 X:17292769-17292791 CAGAATAAGAAAGAAAAGCCAGG - Intergenic
1188021468 X:25163284-25163306 AGAAATGAGGCAGAGGAGCCAGG - Intergenic
1188098444 X:26051445-26051467 CAAAATGAAGAACAGGAGTCGGG - Intergenic
1189008383 X:37018950-37018972 GACAAGGAGGAAGAGGAGGCAGG - Intergenic
1189040344 X:37536060-37536082 GACAAGGAGGAAGAGGAGGCAGG + Intronic
1189256321 X:39642504-39642526 CAGGATGAGGAGGAGGAGTAGGG + Intergenic
1190335953 X:49261736-49261758 CAGAAGGGGGAAGGGGAACCTGG - Intronic
1191851350 X:65588390-65588412 CAGCAGGAAGAAGAGGCGCCCGG + Intronic
1192032875 X:67533393-67533415 CAGGATGAGAAAGAGGAGCCAGG + Intergenic
1192079611 X:68033836-68033858 GAGAAAGAGGAGGAGGTGCCAGG - Intergenic
1192184363 X:68936646-68936668 GAGAAGGAGGAAGAGGAGAATGG + Intergenic
1192233653 X:69282958-69282980 CAGATTGAAGATGAGGAGCTGGG + Intergenic
1192312247 X:70026863-70026885 GAGAAGGAGGAAGAGGGGCACGG - Intronic
1192316560 X:70056289-70056311 CAGAATGGGGAACAGGAGTTGGG + Intergenic
1192564544 X:72152784-72152806 CAGAATTAGGAAGGGAAACCAGG + Intergenic
1192620283 X:72672356-72672378 CAGCATGATGAACGGGAGCCAGG - Intronic
1193076235 X:77359157-77359179 CAGAATTTGGAACAGAAGCCAGG - Intergenic
1193293926 X:79810676-79810698 AAAAATGGGGAAGGGGAGCCAGG - Intergenic
1194467360 X:94250100-94250122 CAGAAAGAGGATGATAAGCCAGG - Intergenic
1195702931 X:107718274-107718296 CAGAAGGAGCAAGAGGGGCAGGG + Intronic
1195791627 X:108594580-108594602 CAGAATGAGGGAGGGGAACAAGG - Intronic
1195923724 X:110005058-110005080 GAGGAGGAGGAAGAGGAGACTGG + Intronic
1196175009 X:112630829-112630851 CATAATGAGGAAGGGGCTCCAGG + Exonic
1197744374 X:129921263-129921285 GAGAGTGAGGAAGAGGAGGGAGG + Exonic
1198132213 X:133707210-133707232 CAGAAGGAGGAAAAGGGGCATGG + Intronic
1198428361 X:136541808-136541830 CTGATTGGGGAAGAGAAGCCAGG - Intronic
1198867015 X:141133904-141133926 TAGCTTGAGGAAGAGGAGACTGG + Intergenic
1199083492 X:143604100-143604122 CAAAATGGTGAGGAGGAGCCTGG - Intergenic
1199201508 X:145095217-145095239 CAGACTTAGGAAGAGGAAGCAGG - Intergenic
1199502813 X:148527746-148527768 TAGAATGAGGATGAGGTGGCGGG - Intronic
1199819301 X:151428833-151428855 CAGAAGCAGGAAGAGTAGCCAGG - Intergenic
1201486137 Y:14496460-14496482 CAGGATGAGGAAGGAGACCCAGG - Intergenic