ID: 1179305230

View in Genome Browser
Species Human (GRCh38)
Location 21:40147907-40147929
Sequence ACAGAGAAACTATATTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 318}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179305230 Original CRISPR ACAGAGAAACTATATTGTGA AGG (reversed) Intronic
910072149 1:83230128-83230150 GCAGAGAAACTGTATTCTGAAGG + Intergenic
910436090 1:87207650-87207672 ACAGAGAAAAGATGTTGAGAAGG + Intergenic
910932311 1:92454720-92454742 ACAGAAAAACTATATGCTCATGG - Intergenic
911538319 1:99127271-99127293 ACAGATAAACTAGATATTGAAGG - Intergenic
912647311 1:111405800-111405822 ACATAGAAACTAAATGGTGAAGG + Intergenic
913923895 1:124867422-124867444 TCACAGAAACTACTTTGTGATGG + Intergenic
913924012 1:124868950-124868972 TCACAGAAACTACTTTGTGATGG + Intergenic
913924504 1:124875072-124875094 TCACAGAAACTACTTTGTGATGG + Intergenic
913926951 1:124905687-124905709 TCACAGAAACTACTTTGTGATGG + Intergenic
915002137 1:152603250-152603272 ACAGAGCTGCTAGATTGTGAGGG - Intergenic
915982429 1:160428875-160428897 AGAGAGAAACAACAATGTGAGGG + Intergenic
918951880 1:191150771-191150793 ACTCAGTAATTATATTGTGAGGG + Intergenic
921797298 1:219361323-219361345 ACAGATAAACTACACTATGAGGG - Intergenic
922051504 1:221994900-221994922 ACAAAGAAACTATAAAATGATGG + Intergenic
922329014 1:224557401-224557423 ACAGAGAGAGGATTTTGTGAGGG - Intronic
923991897 1:239447347-239447369 ACATAGAAACTAACTTGTAAAGG - Intronic
1064647257 10:17472326-17472348 ACAGAGAAAATATATTGAAGAGG - Intergenic
1064787420 10:18913838-18913860 AGAGAAAATATATATTGTGATGG + Intergenic
1066002679 10:31119127-31119149 AAAGAGAAATTGTAGTGTGATGG - Intergenic
1066106173 10:32159253-32159275 ACAGAGAAACTTGAGTGTGTCGG - Intergenic
1066520944 10:36218140-36218162 ACAGAGAAGGTGTATTATGAAGG - Intergenic
1066928765 10:41730594-41730616 TCTGAGAAACTACTTTGTGATGG + Intergenic
1066932232 10:41777498-41777520 TCTGAGAAACGACATTGTGATGG + Intergenic
1067530014 10:47063608-47063630 ACAGAGAAAGTATATGGAGTGGG - Intergenic
1068378395 10:56214315-56214337 ACACAGATACGAGATTGTGAGGG + Intergenic
1068717651 10:60205929-60205951 ACAGTGAAACTGGATTTTGATGG - Intronic
1075081926 10:119390084-119390106 ACAGAGAAACAATTCTGAGAGGG + Intronic
1078002647 11:7510258-7510280 AGAGGGATACTATATTGTGAAGG - Exonic
1079395752 11:20061715-20061737 ATAAAGAATCTATATTTTGATGG + Intronic
1081940049 11:46933460-46933482 AGAGAGAGAATATATTGAGATGG - Intergenic
1082153060 11:48766261-48766283 TCAGAGAAACTTCTTTGTGATGG - Intergenic
1082593239 11:55041511-55041533 TCTGAGAAACTGCATTGTGATGG - Intergenic
1083112763 11:60428290-60428312 TCAGAGAAAAGAAATTGTGAGGG + Intergenic
1085089447 11:73697853-73697875 ACAGAGAAATTATATTGATCAGG - Intronic
1085919032 11:80929410-80929432 AAAGAGAAGCTATACTGTGATGG - Intergenic
1093487863 12:19671467-19671489 ACATTGAAACTATAGTGTAAAGG + Intronic
1094618193 12:32055344-32055366 ACAGAAAAACTATATATTAAAGG - Intergenic
1094879752 12:34707797-34707819 TCTGAGAAACTACTTTGTGATGG + Intergenic
1094949844 12:35907811-35907833 TCACAGAAACTACTTTGTGATGG + Intergenic
1094998639 12:36696137-36696159 TCACAGAAACTACTTTGTGATGG + Intergenic
1094998894 12:36700210-36700232 TCACAGAAACTACTTTGTGATGG + Intergenic
1095004496 12:36791366-36791388 TCACAGAAACTACTTTGTGATGG + Intergenic
1095021161 12:37061277-37061299 TCACAGAAACTACTTTGTGATGG + Intergenic
1095022177 12:37077587-37077609 TCACAGAAACTACTTTGTGATGG + Intergenic
1095030680 12:37272381-37272403 TCTCAGAAACTATATTGTGATGG + Intergenic
1095030783 12:37274251-37274273 TCTCAGAAACTACATTGTGATGG + Intergenic
1095269325 12:40198132-40198154 CCAGAGACACAATATTGTGTAGG + Intronic
1095758681 12:45801614-45801636 ACAGAGAATGTATTTTTTGAAGG - Intronic
1096746962 12:53735401-53735423 ACAGCAAAACTAGATTGTGGGGG - Intergenic
1097065885 12:56320303-56320325 ACAGAGAAACTATGGTTTAAAGG + Intronic
1097291816 12:57923009-57923031 ACAGTGAAACTATTCTGTAATGG + Intergenic
1097957218 12:65498176-65498198 AGAGACAAATTATATTGTGAAGG + Intergenic
1099351868 12:81581356-81581378 ACAGTTAAACTATCTAGTGATGG + Intronic
1099965102 12:89437605-89437627 ATAAAGAAACTATATGGTGGGGG - Intronic
1100926279 12:99551667-99551689 GCAGAGAAACTAAAGTGAGAAGG + Intronic
1101035755 12:100704196-100704218 GTAGAGAAAATATATTGGGAAGG + Intergenic
1104174133 12:126312715-126312737 ACATAGAAGCTAAATTGTGACGG + Intergenic
1105084126 13:16165342-16165364 TCTGAGAAACTTTTTTGTGATGG + Intergenic
1105084330 13:16168768-16168790 TCTGAGAAACTTTTTTGTGATGG + Intergenic
1105084705 13:16175621-16175643 TCTGAGAAACTTTTTTGTGATGG + Intergenic
1105085087 13:16182468-16182490 TCTGAGAAACTTTTTTGTGATGG + Intergenic
1105085666 13:16192741-16192763 TCTGAGAAACTTTTTTGTGATGG + Intergenic
1105085864 13:16196170-16196192 TCTGAGAAACTTTTTTGTGATGG + Intergenic
1105086255 13:16203019-16203041 TCTGAGAAACTTTTTTGTGATGG + Intergenic
1105086461 13:16206444-16206466 TCTGAGAAACTTTTTTGTGATGG + Intergenic
1105086651 13:16209870-16209892 TCTGAGAAACTTTCTTGTGATGG + Intergenic
1105086843 13:16213295-16213317 TCTGAGAAACTTTTTTGTGATGG + Intergenic
1105087037 13:16216721-16216743 TCTGAGAAACTTTTTTGTGATGG + Intergenic
1105087233 13:16220143-16220165 TCTGAGAAACTTTTTTGTGATGG + Intergenic
1105087429 13:16223568-16223590 TCTGAGAAACTTTTTTGTGATGG + Intergenic
1105087631 13:16226993-16227015 TCTGAGAAACTTTTTTGTGATGG + Intergenic
1106788669 13:33132083-33132105 ACACGGAAACTAGATTTTGAAGG - Intronic
1108169121 13:47723073-47723095 ACAGAATAAGTATATTCTGAGGG + Intergenic
1109130433 13:58577827-58577849 ACAGAGGTAGTATGTTGTGATGG - Intergenic
1109416039 13:62042285-62042307 AAAGAAAAAAAATATTGTGAAGG + Intergenic
1109432137 13:62249945-62249967 ACAGAGAAACTGAAATGCGATGG - Intergenic
1110194499 13:72771539-72771561 AAAGAGAAACTAAATTTTTATGG + Intronic
1111255697 13:85664722-85664744 ACAGAGATAAGATATTGTGTTGG - Intergenic
1113005443 13:105696579-105696601 ACAGATAAACTATATTGTAGGGG - Intergenic
1115751582 14:36498764-36498786 ACAGTGAGACTATATGGTGATGG - Intronic
1116699799 14:48226088-48226110 ATAGAGAAACAAAATTGTTAAGG + Intergenic
1118464574 14:66019320-66019342 ACAGAGAAACTAAACTATTATGG + Intergenic
1119432153 14:74575489-74575511 TCACAGAGACTATAATGTGAAGG + Intronic
1119622692 14:76144505-76144527 ACAGGGAAACTGTATTTTTATGG - Intergenic
1120445800 14:84594010-84594032 ACAGAGACACTGTATTATCATGG + Intergenic
1120591521 14:86379649-86379671 AAAGACAAGCTATATTTTGAAGG - Intergenic
1120604508 14:86557731-86557753 GCAGAAAAACTGTATTATGAAGG - Intergenic
1124783339 15:32656624-32656646 GCTGAGAAACTATAATGTGCTGG + Intronic
1125180772 15:36879404-36879426 ACATAGACAATGTATTGTGAGGG - Intergenic
1125268544 15:37912878-37912900 AAAGAGAAACTATTTCATGAGGG + Intergenic
1127517878 15:59713786-59713808 ACAGAGAAACTGTATGTTGAAGG - Intergenic
1128010104 15:64285791-64285813 ACAGAAAAACTACATTTTGGAGG + Intronic
1131786318 15:95915597-95915619 CCAGATAAACTATATTATTATGG + Intergenic
1131994223 15:98119009-98119031 AGAAAGGAACTATATTTTGAAGG - Intergenic
1133735639 16:8613208-8613230 AAAGCTAAACTATATTGTGAGGG + Intergenic
1135698724 16:24612822-24612844 ACAGAGACACTCTATTCTCATGG + Intergenic
1136914449 16:34170409-34170431 TCTGAGAAACTTTTTTGTGATGG + Intergenic
1137988971 16:53132325-53132347 ATTGAGAAACTAAATTCTGACGG - Intronic
1138042732 16:53691298-53691320 ACAGAGAAACTTTATTATAATGG - Intronic
1138603489 16:58071992-58072014 ACAGAGAAAATCTATTTTCATGG + Intergenic
1138665631 16:58565413-58565435 TCATAGAAAATATATAGTGAAGG - Intronic
1139324944 16:66145453-66145475 ACAAACAAACAAGATTGTGAGGG - Intergenic
1140742516 16:77954129-77954151 ACAGAAAAACAATATCCTGAAGG + Intronic
1144812221 17:18007748-18007770 ACAGAGATACTATGTTGTCAGGG + Intronic
1144812225 17:18007776-18007798 ACAGAGATACTATGTTGTCAGGG + Intronic
1147540682 17:41356159-41356181 ACAGACAAGCTAGAATGTGAAGG + Intergenic
1148035957 17:44659962-44659984 ACAGAAAAATTATAATGTGTGGG + Intronic
1148890840 17:50806043-50806065 ACAGAGTTATTATATTGTGGGGG + Intergenic
1149366583 17:55951518-55951540 AAAGAGAAAATAAATTGTGCAGG - Intergenic
1150617828 17:66785697-66785719 ACAGAGCAACTCTCTTGGGAGGG - Intronic
1150846596 17:68665184-68665206 AGAGAGAAACTATCTCATGAAGG - Intergenic
1151200557 17:72464811-72464833 ACAGAGATACAATATTTTAAAGG + Intergenic
1153034796 18:750767-750789 ACATATTAACTATATTTTGAAGG + Intronic
1153502033 18:5759637-5759659 ACATATAACCTATATTCTGAAGG - Intergenic
1155121947 18:22830105-22830127 ATAGAGAAACCAAATTCTGAAGG + Intronic
1155196559 18:23480341-23480363 ACTGAGCAACTGTATTGTGCTGG - Intronic
1155701040 18:28744089-28744111 ACAGAGAAAATATATACTGATGG - Intergenic
1156088607 18:33439674-33439696 ACCAAGAAACAATATTTTGAGGG + Intronic
1156218878 18:35030754-35030776 ACAGAGAAACCAGAATGTGCAGG - Intronic
1158413036 18:57224582-57224604 ACAGAAAAAATCTGTTGTGAAGG + Intergenic
1159062892 18:63534691-63534713 ACAGAGAAACTATATTAGAATGG - Intergenic
1164337655 19:24345901-24345923 ATCGAGAAACTGTTTTGTGATGG + Intergenic
1164368173 19:27611287-27611309 TCAGAGAAACTGTTTTGTGTTGG + Intergenic
1166209383 19:41296444-41296466 ACAGAGAACCTAAACTCTGAAGG + Intronic
1166234624 19:41446561-41446583 ACAGAGGAAGTATAATCTGAGGG + Intergenic
1167736446 19:51297214-51297236 ACAGAGAGACTAGACTTTGAGGG - Intergenic
1167945336 19:52983861-52983883 ATAGAGAAACTATATTAAAATGG + Intergenic
925936816 2:8771790-8771812 ACACAGAAATTATATTTTCATGG + Intronic
927075757 2:19575383-19575405 ACAGAGACAGTATATTTTTAAGG - Intergenic
930421346 2:51156954-51156976 ACAGAGGAAATATAGTGGGAAGG + Intergenic
931563578 2:63589713-63589735 ACAGAGTAACCATTTTGTCATGG + Intronic
931981420 2:67697284-67697306 ACAGAGAAACTATTTGGGGGAGG - Intergenic
933403903 2:81833447-81833469 AAAGAGAATCTAAATTGGGAAGG + Intergenic
934915190 2:98295735-98295757 AGAGAGAAACTATAGGGTAAGGG + Intronic
935414815 2:102804123-102804145 AAAAAGAAACTAAAATGTGAAGG - Intronic
938624893 2:133097436-133097458 CCAAAGAAACTAAATTGCGATGG - Intronic
938808979 2:134834361-134834383 AGAGAGAACCTATATTGTCTTGG + Intergenic
939234223 2:139470288-139470310 ACAGAGAATCTAGATTCTTATGG + Intergenic
939535809 2:143426726-143426748 ACAGAGAATCTATGTTGTGGTGG + Intronic
939994077 2:148903745-148903767 ACATAGCTACTAAATTGTGAAGG + Intronic
940252646 2:151696436-151696458 ACAGTGAAACAATTCTGTGAAGG - Intronic
940523736 2:154784972-154784994 AAAGTGAGATTATATTGTGATGG + Intronic
940597418 2:155812979-155813001 ACTGAGAACCTATTTTGTAAGGG + Intergenic
941558037 2:167008398-167008420 ATAAAGAAGCTATAATGTGATGG + Intronic
943280878 2:185931138-185931160 ACAGAGAAACCGAATTGAGAAGG - Intergenic
943895246 2:193349366-193349388 TCAGAGGAACCATATTGAGAAGG - Intergenic
945307040 2:208268394-208268416 GGAGAGAAACGATAATGTGATGG - Intronic
945427257 2:209722033-209722055 ACAGAGAAATTATTTTCTAAAGG - Intronic
946993369 2:225361494-225361516 GCAGAGGAACTCTATTCTGAGGG - Intergenic
947143179 2:227038974-227038996 ACAGTGTCACTATATGGTGATGG + Intronic
947412725 2:229858528-229858550 ACACAGACACTAAAATGTGATGG + Intronic
947460153 2:230297125-230297147 ACAGAGAAACTATATTTAATGGG + Intronic
948758992 2:240178942-240178964 GCAAAGAAACTATGTTCTGAGGG + Intergenic
1170134515 20:13058257-13058279 CCAGAGAAACTTTCTTCTGAAGG + Intronic
1170917679 20:20643357-20643379 ATTGAGAAATTATATTGTTAGGG - Intronic
1170927707 20:20741110-20741132 AAAGAGAAGCTATATTATGCTGG + Intergenic
1171737680 20:28814487-28814509 TCTGAGAAAATATTTTGTGATGG - Intergenic
1171766694 20:29290112-29290134 TCTGAGAAACTTTTTTGTGATGG - Intergenic
1171809659 20:29734715-29734737 TCTGAGAAACTTTTTTGTGATGG - Intergenic
1171821019 20:29839259-29839281 TCAGAGAAACTTCTTTGTGATGG + Intergenic
1174418065 20:50380543-50380565 AGGGAGAAGCTCTATTGTGAGGG + Intergenic
1174982884 20:55417187-55417209 TGAGAGAAACTATATTTTGGAGG + Intergenic
1175544067 20:59766748-59766770 ACTGAGAAACAATCCTGTGAGGG + Intronic
1176758875 21:10753197-10753219 TCTGAGAAACTACTTTGTGATGG + Intergenic
1176911453 21:14570055-14570077 ACACAGAAAATATTTTGTGGTGG + Intronic
1177596615 21:23251387-23251409 ACAGAGAAACTAAACTTTTATGG + Intergenic
1178205505 21:30459716-30459738 GCAGAGAACCTATAGTGAGATGG - Intergenic
1178390091 21:32191212-32191234 ATAGAGAAAAGATATTGTGGGGG - Intergenic
1179305230 21:40147907-40147929 ACAGAGAAACTATATTGTGAAGG - Intronic
1179356085 21:40661461-40661483 ACAGAGCAGATATTTTGTGAGGG - Intronic
1180427102 22:15205474-15205496 TCTGAGAAACTTTTTTGTGATGG - Intergenic
1180504091 22:15975004-15975026 TCTCAGAAACTACATTGTGATGG + Intergenic
1180505946 22:16003685-16003707 TCAGAGAAACTTCTTTGTGATGG - Intergenic
1180526931 22:16275924-16275946 TCAGAGAAACTTCTTTGTGATGG + Intergenic
1182382152 22:29900257-29900279 CCAAAGAAACAATAATGTGAAGG - Intronic
1182470182 22:30543675-30543697 ACAGAACATCTATATTGTGGTGG + Intronic
1183976421 22:41515028-41515050 CCAGAGAAACTGTCCTGTGATGG - Intronic
1184571018 22:45325041-45325063 AGAGAGAAAATATTTTGAGATGG - Intronic
1184709697 22:46241710-46241732 CCAGAGAAACCCTTTTGTGAGGG + Exonic
1203332711 22_KI270739v1_random:18362-18384 TCAGAGAAACTTCTTTGTGATGG + Intergenic
1203334486 22_KI270739v1_random:47508-47530 TCTCAGAAACTACATTGTGATGG - Intergenic
949214462 3:1548990-1549012 AAACAGAAATTATATTGGGATGG - Intergenic
950192844 3:10990082-10990104 ATAGGGACACTATATTGTGAAGG - Intergenic
950774959 3:15341400-15341422 ACAGCCAAACTATATAGAGAGGG - Intergenic
951186735 3:19722254-19722276 AAAGAAACCCTATATTGTGAGGG + Intergenic
952113357 3:30150237-30150259 ACACAGAAACTCATTTGTGATGG + Intergenic
952271048 3:31831757-31831779 ACAGAGAAACGAGTTTGTGGAGG + Intronic
953231762 3:41071659-41071681 ACAGAGATATTATAATTTGAAGG + Intergenic
954948431 3:54447231-54447253 TCTGAGAAATTATATTGTGATGG + Intronic
955422891 3:58757462-58757484 AAAGACAAACTATAAAGTGAGGG - Intronic
955511291 3:59682955-59682977 TCAGAAAAACCATCTTGTGAAGG - Intergenic
955746736 3:62148161-62148183 ACAGAGAAAACATACTGAGATGG + Intronic
955884147 3:63579369-63579391 CCAGGGAAACTTTATTGAGAAGG - Intronic
956442709 3:69295796-69295818 AGAAAGAAACCATATTGTGAAGG - Intronic
957120590 3:76085980-76086002 ACAGAGAAACTATTTTATCAGGG + Intronic
957261453 3:77907354-77907376 ACAAAAAAAAAATATTGTGAAGG - Intergenic
958199275 3:90287756-90287778 TCTGAGAAACTATTATGTGATGG - Intergenic
958202942 3:90344790-90344812 TCAGAGAAACTTCTTTGTGATGG - Intergenic
958403280 3:93716992-93717014 TCTCAGAAACTACATTGTGATGG - Intergenic
959748157 3:109801687-109801709 AGAGAGAATTTACATTGTGAAGG - Intergenic
959792786 3:110384352-110384374 ACAGAGAAAATCTCTTTTGAGGG - Intergenic
959925003 3:111911106-111911128 AAAAAGAAACTATTTTGGGAAGG + Intronic
960223451 3:115144586-115144608 AAAGAGAAACTTTCATGTGAGGG - Intronic
960521796 3:118663439-118663461 AAAGAGAAAATATGTTGAGAAGG - Intergenic
961142255 3:124565404-124565426 ACACAGAAGGTAGATTGTGAGGG + Intronic
961777898 3:129302946-129302968 ACGGAGAAACAATATGGTCAAGG - Intronic
962036240 3:131654617-131654639 ACAGTGAAATTATATTCTGATGG + Intronic
962088389 3:132216639-132216661 AAAGTGAAAATATATTGGGAAGG - Intronic
963823222 3:149922840-149922862 ACAGAGAAACTATACTATAGGGG - Intronic
965210691 3:165783160-165783182 ACAGAAAAATAATAATGTGATGG - Intronic
967247623 3:187503879-187503901 AAGGAGAAAGTGTATTGTGAAGG - Intergenic
968392467 4:204844-204866 ACACAGAATGGATATTGTGATGG - Intergenic
970150618 4:13086051-13086073 ACAGAGATACTTTATTGTGGTGG + Intergenic
970179347 4:13373561-13373583 ACACAGTAACCATATTTTGAGGG - Intronic
970852754 4:20620943-20620965 ACAGAGAAACAACATTGTCTGGG + Intergenic
972527239 4:39926584-39926606 AGAGATAAAGTATATTCTGATGG - Intronic
972731037 4:41795511-41795533 ACACAAAAACTAACTTGTGAAGG + Intergenic
973287536 4:48436025-48436047 CCAGAGAAGCTCTATTGTAAAGG - Intergenic
974559011 4:63493177-63493199 ACAAAGAAGATATATTTTGAAGG - Intergenic
975043365 4:69772158-69772180 ACAGAGAAATTATTTTATCAAGG + Intronic
975168926 4:71211157-71211179 AAAGATAAACTGTTTTGTGAAGG - Intronic
976071268 4:81242489-81242511 CTAGAGAGACTATATTGTCAGGG - Intergenic
976887508 4:90003900-90003922 GCAGAGAAACTCAAGTGTGAAGG + Intergenic
978018670 4:103781277-103781299 ACAGAGGAACTCTCTTGTTAGGG - Intergenic
978250770 4:106628925-106628947 ACAGACACACTATATTATGCAGG + Intergenic
978325225 4:107546163-107546185 AGATAGAAAGTAGATTGTGAAGG - Intergenic
979029704 4:115627153-115627175 ACAAATAAACTATAGAGTGAAGG - Intergenic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
979422024 4:120516122-120516144 AGAGAGAAAACATATTTTGAGGG - Intergenic
979565283 4:122147799-122147821 ACAGAGAAAGTATAAATTGAAGG + Intergenic
980932247 4:139193132-139193154 AAAGAGAAACTACAGTGTCATGG - Intergenic
982906930 4:161086195-161086217 ACAGAGAAACTAAAATGGCATGG - Intergenic
984096664 4:175443534-175443556 TCAGAGAAAATAGATTGTAAAGG + Intergenic
985031648 4:185796259-185796281 ACAGAGAAACTATCTTATAAAGG + Intronic
985263494 4:188136919-188136941 ATAGAGGAACTATATTATTATGG - Intergenic
986095582 5:4550561-4550583 ACAGAGAAACAGTATTAGGAGGG + Intergenic
987236741 5:15950328-15950350 ACAGCAAAACCATATCGTGAGGG + Intergenic
987592523 5:19949110-19949132 CCTGAGAAAATATAGTGTGATGG - Intronic
987939489 5:24514310-24514332 ACAGAGGATCTAAATTATGACGG - Intronic
989085336 5:37670484-37670506 ACAGCAAAATTATATTGTAAAGG + Intronic
989440076 5:41460441-41460463 TCAGAGAAACTTTAGAGTGAGGG + Intronic
989841994 5:46087448-46087470 TCTGAGAAACTAATTTGTGATGG + Intergenic
989954286 5:50338481-50338503 ACAGAGAAAATATAGTGCTATGG - Intergenic
990491234 5:56304963-56304985 ACAGAGAGACGATCATGTGAAGG - Intergenic
991220125 5:64204716-64204738 TAAGAAAATCTATATTGTGAGGG + Intronic
992607290 5:78471636-78471658 ACAGAAAAACTGTATCGTGTGGG - Intronic
992692588 5:79255774-79255796 AGAGAGAAACTCTGTTGTTAAGG - Intronic
993290760 5:86066874-86066896 ACAGAAAAACAATTTTGTCAGGG - Intergenic
993591183 5:89797043-89797065 ACAGAGAGACTCTATTGTCCAGG + Intergenic
996343355 5:122462793-122462815 AGAGAGGAGCTATATTCTGAGGG - Intronic
997656734 5:135560794-135560816 ACAAAGAAACTATAATGTATCGG - Intergenic
998727111 5:145030245-145030267 ACAGAGAAGCGAAATTGTGGAGG - Intergenic
998840329 5:146246696-146246718 AAAGAGAAAACATATTATGATGG + Intronic
999030662 5:148287352-148287374 ACAGGGAAAATATATTCTGATGG + Intergenic
1003001778 6:2342300-2342322 ACAGAGAAAGTTTAGAGTGAGGG - Intergenic
1003494812 6:6654453-6654475 ACAGAGAAACTTTTATGTGCTGG - Intronic
1004304527 6:14487894-14487916 ACAGAGAGACAACATTGGGATGG + Intergenic
1005237048 6:23776627-23776649 ATAGAAAAACTAAATTGAGAGGG + Intergenic
1007796762 6:44355107-44355129 ACAGTGAAACCATAATGTGCTGG - Intronic
1008060804 6:46994704-46994726 ACAATGTAACTATATTGAGAAGG - Intergenic
1008228552 6:48954672-48954694 ACAGAGAAAATAAAGTGTGTAGG + Intergenic
1008247937 6:49202233-49202255 ACTGTTAAACTATATTGTCAGGG + Intergenic
1008319995 6:50099697-50099719 ATCTAGAAACTAGATTGTGAAGG - Intergenic
1008457285 6:51725775-51725797 ACAGAGATATTAGTTTGTGATGG - Intronic
1009259801 6:61470828-61470850 TCAGAGAAACTGCTTTGTGATGG + Intergenic
1009659090 6:66586822-66586844 ACAGAGAAAGTGTACTGTGAGGG + Intergenic
1010047131 6:71458326-71458348 AGAAAGAAACTAAATAGTGAGGG - Intergenic
1011676640 6:89741244-89741266 ACACAAAAACTAAATTGTGATGG + Intronic
1012117411 6:95320032-95320054 ACAGAAAAAATATATAGAGATGG - Intergenic
1012763916 6:103339840-103339862 ACAGAGAGAAAATAATGTGATGG - Intergenic
1013093769 6:106925226-106925248 GCAGATAAACTATGTTATGAGGG + Intergenic
1014190499 6:118490353-118490375 AAAGAGAAAATATAATGGGATGG + Intronic
1014646960 6:123985689-123985711 ACAGCTAAAATATATTGTGACGG + Intronic
1015275344 6:131378266-131378288 ACAGAATTACTTTATTGTGATGG + Intergenic
1015511484 6:134042277-134042299 GAACATAAACTATATTGTGAAGG + Intronic
1015797615 6:137028494-137028516 GCAGAGAAAGTATATATTGATGG - Intronic
1016126591 6:140411516-140411538 ACAGACAAACCATATTGTGGTGG - Intergenic
1016381768 6:143491411-143491433 AAAGATACACTAAATTGTGAAGG - Intergenic
1017137238 6:151158862-151158884 AAAGAGACACAATTTTGTGAGGG + Intergenic
1017451651 6:154559800-154559822 AGAGAGAAAATACATTGTGTTGG - Intergenic
1017662238 6:156686480-156686502 ACAGAGAAAATAGATTGCTAAGG + Intergenic
1020653173 7:10899464-10899486 AAAGAGAAACTTTACAGTGAAGG + Intergenic
1020828891 7:13067836-13067858 ACAGAGAAGCTACATTTTGGAGG + Intergenic
1020984662 7:15118392-15118414 ACAGAGAAGCTATATTCTCCAGG + Intergenic
1021972245 7:25976823-25976845 ACAGAGAAATTAAAGTGTGCAGG - Intergenic
1022779060 7:33559770-33559792 ACACAGGAACTAGATTATGAAGG - Intronic
1022944219 7:35266083-35266105 AGAGAGAAACTATTTTCTAATGG - Intergenic
1023362642 7:39432081-39432103 ACATAGAGACCATATTGTTAGGG - Intronic
1023686421 7:42739854-42739876 ACAGAGAAACAATTTAGTGTTGG + Intergenic
1025571057 7:62567920-62567942 TCTGAGAAACTACTTTGTGATGG - Intergenic
1026069885 7:67109379-67109401 ACAGAGAAACAAGATTTTTAAGG - Intronic
1026136111 7:67662490-67662512 ACACAGGGACAATATTGTGAGGG - Intergenic
1026418140 7:70204467-70204489 ACAGAGAAAATATGTTTTGTCGG + Intronic
1026707026 7:72702884-72702906 ACAGAGAAACAAGATTTTTAAGG + Intronic
1027289864 7:76695104-76695126 GCAGAGAAACTGTATTCTGAAGG + Intergenic
1027650820 7:80866270-80866292 AAAGACAAACTATCTTCTGAGGG + Intronic
1028240475 7:88414090-88414112 AAGCAGAAACTATTTTGTGAGGG + Intergenic
1028442257 7:90877418-90877440 ACTGAGAAACTAACTTGTGGTGG + Intronic
1030294279 7:107905601-107905623 ACTGAAATACTATATTTTGATGG + Intronic
1031580524 7:123468649-123468671 ATAGAGAAATTAAATTGTGGTGG - Intronic
1035565579 8:638592-638614 ACAGTGAAACTGTCTTGCGATGG + Intronic
1037532839 8:19794865-19794887 ACAGAGAAACTATTTAGCAATGG + Intergenic
1037642143 8:20755504-20755526 ACAGAGCAACTTTATGGTAAGGG - Intergenic
1039534557 8:38296749-38296771 ACAGAGAATATATTTTGAGACGG + Intronic
1039727699 8:40237556-40237578 ACACAGAAATAGTATTGTGAGGG - Intergenic
1039740193 8:40375749-40375771 TCAGAGAAACAATATTACGAGGG + Intergenic
1040774939 8:51030871-51030893 AAAATGAAACTATATTGTGTGGG - Intergenic
1040789762 8:51212849-51212871 ACAGATAAACTTTATGTTGAAGG + Intergenic
1042808766 8:72800977-72800999 ACAGAGCAAACATAATGTGAGGG - Intronic
1046833089 8:118768635-118768657 ACACACAAACTATATTTTAAGGG - Intergenic
1047360186 8:124162065-124162087 ACGGAGAGACTATATGGGGAAGG + Intergenic
1048648924 8:136453226-136453248 ACAGAGAAACTATGTTTCCATGG - Intergenic
1050207237 9:3210087-3210109 ACAGAGAAACTCTTTTGTCTAGG + Intergenic
1050212625 9:3279877-3279899 AGAGATAAACTATATTATGTGGG + Intronic
1051168517 9:14293392-14293414 ACAGAGAAAATATTTCATGAAGG - Intronic
1053654714 9:40205254-40205276 CCAGAGAAACTATATTGACCAGG + Intergenic
1054363209 9:64199720-64199742 TCAGAGAAACTGCTTTGTGATGG + Intergenic
1054366829 9:64351471-64351493 CCAGAGAAACTATATTGACCAGG + Intergenic
1054674457 9:67841213-67841235 CCAGAGAAACTATATTGACCAGG + Intergenic
1055428666 9:76221169-76221191 ACAGAGAAAATAAATTTGGAGGG + Intronic
1056154448 9:83820126-83820148 AAAGGGAGACTAAATTGTGATGG - Intronic
1056412657 9:86346779-86346801 ACAGAAAAATTATACTCTGAAGG + Intronic
1057021140 9:91698602-91698624 AGAGAGAGACTGTTTTGTGAGGG - Intronic
1057408866 9:94798651-94798673 ACAGAGAAACTGGAGTGTGCAGG - Intronic
1058580346 9:106449605-106449627 GCAGAAACACTATTTTGTGAGGG + Intergenic
1058764022 9:108164068-108164090 AGAGAGAAACAATTCTGTGATGG - Intergenic
1059804737 9:117786600-117786622 ATAGAGAAAATATTGTGTGATGG - Intergenic
1060289637 9:122289553-122289575 AGAGAGAATCTCCATTGTGAAGG - Intronic
1060317187 9:122523312-122523334 AGACAAAGACTATATTGTGAGGG + Intergenic
1060616588 9:125021547-125021569 ACAGATAAAATATATTGTAAGGG - Intronic
1061449066 9:130659069-130659091 ACAGAGAGACTGGAGTGTGAGGG - Intergenic
1062701378 9:137906329-137906351 ACAGAAAAGCTATAAGGTGAAGG + Intronic
1203396659 Un_KI270519v1:22984-23006 TCAGAGAAACTTCTTTGTGATGG + Intergenic
1203413402 Un_KI270589v1:19787-19809 TCAGAGAAACTTCTTTGTGATGG - Intergenic
1203684912 Un_KI270757v1:39425-39447 TCAGAGAAACTTCTTTGTGATGG + Intergenic
1185985265 X:4825684-4825706 AAAGAGGAACTAGATTGTGTAGG - Intergenic
1189066128 X:37811014-37811036 AAAAAGAAACTATAATGTAATGG + Exonic
1189645992 X:43132531-43132553 AGAGAGAGAATATATTGTGCTGG - Intergenic
1190032146 X:46984282-46984304 ACAAAGCTCCTATATTGTGAAGG - Intronic
1190588675 X:51974746-51974768 AAAGAGACACTCTATTATGAGGG + Intergenic
1191267324 X:58411569-58411591 TCTGAGAAACTGCATTGTGATGG - Intergenic
1191568269 X:62570190-62570212 ACTGAGAAACTTCTTTGTGACGG + Intergenic
1191873508 X:65770575-65770597 ACAAAGAAAACAGATTGTGAAGG - Intergenic
1193555677 X:82951237-82951259 AGAGAGACACCATTTTGTGAGGG - Intergenic
1194469540 X:94275707-94275729 ACAGAGACACTAAATTTTGTAGG + Intergenic
1195437080 X:104856976-104856998 ACAGAGAAAGTAAAGTTTGAGGG - Intronic
1195916237 X:109938871-109938893 ACAGAGAAACTTATGTGTGAAGG + Intergenic
1197148292 X:123192430-123192452 CCAGAGATACTATTTAGTGACGG - Intronic
1198851793 X:140972508-140972530 ACAAAGATACAATATTATGAAGG + Intergenic
1201078451 Y:10207392-10207414 TCTGAGAAACTTTTTTGTGATGG + Intergenic