ID: 1179305860

View in Genome Browser
Species Human (GRCh38)
Location 21:40153554-40153576
Sequence GTACAAGCACAGATGAAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179305856_1179305860 4 Left 1179305856 21:40153527-40153549 CCATGGTGATCACAGGGGTGGGG 0: 1
1: 1
2: 3
3: 21
4: 227
Right 1179305860 21:40153554-40153576 GTACAAGCACAGATGAAGCTAGG 0: 1
1: 0
2: 1
3: 9
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179305860 Original CRISPR GTACAAGCACAGATGAAGCT AGG Intronic
906513046 1:46422496-46422518 GTAAAAGCACAGACGAGGCCAGG - Intergenic
907983697 1:59509526-59509548 GTTGAAGGACAGAGGAAGCTGGG - Intronic
909496642 1:76286290-76286312 GTAAAATCACAGTGGAAGCTTGG + Intronic
909496826 1:76288201-76288223 GTAAAATCACAGCGGAAGCTTGG + Intronic
910315484 1:85877656-85877678 TTAAAAACACACATGAAGCTGGG - Intronic
912517463 1:110225315-110225337 GCAGTAGCACAGGTGAAGCTGGG - Intronic
912590411 1:110813251-110813273 GGACAAGCACACATGGAACTGGG + Intergenic
912963985 1:114221162-114221184 TTACAGGCACAGATGCAGGTAGG - Intergenic
914316974 1:146522588-146522610 GTCCACCCACAGATAAAGCTTGG + Intergenic
914497381 1:148210772-148210794 GTCCACCCACAGATAAAGCTTGG - Intergenic
917887683 1:179402449-179402471 ATATAAGCACAGATGCAGGTGGG - Intronic
922218379 1:223539252-223539274 GCACAATCACAGAAGCAGCTTGG - Intronic
1063730004 10:8685754-8685776 GTACAGGCACAGTTGAATGTAGG - Intergenic
1065754485 10:28918763-28918785 TAAGAAGGACAGATGAAGCTGGG - Intergenic
1065933741 10:30501918-30501940 GAAAAATCACAGAAGAAGCTGGG - Intergenic
1068567083 10:58588293-58588315 GGACAAACACAGTTGAACCTTGG + Intronic
1069809769 10:71149666-71149688 GAACAAGGACAAATGAAGCAAGG + Intergenic
1070554341 10:77516362-77516384 GCACAAGCACAAATGAAACAGGG - Intronic
1073539289 10:104305382-104305404 GGACACGCACAGATGAACCTAGG + Intergenic
1074692527 10:116019224-116019246 GTTCAAGTCCAGCTGAAGCTGGG - Intergenic
1076896486 10:133315325-133315347 TTCCAGGCAGAGATGAAGCTAGG - Intronic
1085706722 11:78793071-78793093 GTGCAAGCCCAGATGAAGCCTGG + Intronic
1086243080 11:84720039-84720061 CTACAAGAGCAGATGCAGCTCGG - Intronic
1086451146 11:86918216-86918238 GTAAATGCAGAGATGAAGCTTGG + Intronic
1087123584 11:94600207-94600229 TTAGAAGCAAAGATGAAGCCAGG - Intronic
1087222783 11:95564509-95564531 GTTTAGGCACAAATGAAGCTGGG + Intergenic
1087757991 11:102074433-102074455 ACACAAGCACAGAAGGAGCTGGG - Intronic
1089657327 11:119959634-119959656 ATACAGTCACTGATGAAGCTAGG + Intergenic
1097852477 12:64426493-64426515 GTACACACAGATATGAAGCTGGG + Intronic
1101049001 12:100841490-100841512 CTACAAAGAAAGATGAAGCTGGG + Intronic
1101229567 12:102726254-102726276 GAACAAGCACTGATGTGGCTGGG - Intergenic
1101521903 12:105491602-105491624 GTGAAAACACAGATGAACCTGGG - Intergenic
1103575716 12:121875823-121875845 CCAAAAGCACAGATGAGGCTGGG + Intergenic
1104363073 12:128152224-128152246 GGACCAGGACAGATGAAGCAGGG + Intergenic
1110527559 13:76556491-76556513 CTATAAGCATAGATGAAACTTGG - Intergenic
1111454483 13:88462491-88462513 GTTCTAGAAAAGATGAAGCTAGG - Intergenic
1112887969 13:104196912-104196934 GTACAAGTCAAGATGAAACTTGG + Intergenic
1116020011 14:39448834-39448856 GAACAAGAACAGATGTAGCATGG - Intergenic
1116381774 14:44277608-44277630 GTACACACACATATGAACCTGGG + Intergenic
1121652689 14:95571347-95571369 ATACAAGCAAAGTTGAGGCTGGG - Intergenic
1124720351 15:32106138-32106160 GGACATGCACAAGTGAAGCTGGG + Intronic
1128221440 15:65971512-65971534 ACACAGGCACAGATGAAGGTGGG + Intronic
1133017250 16:2949758-2949780 GTACAAGCAGAGGAGAAGCAGGG - Exonic
1135110253 16:19685334-19685356 ATACCAACACAGATGAATCTTGG - Intronic
1140901776 16:79374404-79374426 ACAAAAGCAGAGATGAAGCTTGG - Intergenic
1141327225 16:83072674-83072696 CTCCATGCACAGATCAAGCTTGG - Intronic
1145302440 17:21650062-21650084 GAACAGGCAGAGTTGAAGCTGGG - Intergenic
1145347879 17:22053246-22053268 GAACAGGCAGAGTTGAAGCTGGG + Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1149282363 17:55121807-55121829 GGATAAGGACAGATGGAGCTGGG + Intronic
1149481662 17:57008456-57008478 TCACCTGCACAGATGAAGCTAGG + Intergenic
1151413066 17:73943800-73943822 ATACAAGCAGAGTTGAAGGTGGG - Intergenic
1153706024 18:7746897-7746919 GTACACGTACACTTGAAGCTGGG - Intronic
1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG + Intergenic
1164986160 19:32650177-32650199 GGACAAGCCCAGATGAAGAGAGG + Intronic
1167813359 19:51854885-51854907 GAATAAGCAAATATGAAGCTAGG - Intergenic
925879309 2:8338588-8338610 GAATGAGCTCAGATGAAGCTCGG - Intergenic
926753040 2:16214249-16214271 GTAAAAGCAAAGATCAAGCCTGG - Intergenic
927058967 2:19395942-19395964 GTGCAATAACAGATGAAGATGGG + Intergenic
927909228 2:26884867-26884889 ACACAAGTACAGATCAAGCTTGG - Intronic
928424763 2:31168843-31168865 TTCCAAGCAGAGCTGAAGCTCGG + Intergenic
941179287 2:162238476-162238498 TTAAAATCACAGATGAATCTTGG - Intronic
945344651 2:208698877-208698899 AAACATGCACAGATGAAGCAAGG - Intronic
1169683314 20:8241910-8241932 GTAAAGGCACAGATGAAGACAGG + Intronic
1170537917 20:17359835-17359857 GTACAAAGACACATGAAGATTGG + Intronic
1171519024 20:25761489-25761511 GAACAGGCAGAGTTGAAGCTGGG - Intergenic
1171557899 20:26095016-26095038 GAACAGGCAGAGTTGAAGCTGGG + Intergenic
1172796323 20:37541515-37541537 GAACAAGCACAGCTGACTCTTGG - Intergenic
1174739352 20:52997219-52997241 GAACCAGGGCAGATGAAGCTGGG - Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1174892124 20:54406718-54406740 GCACAAGCACAGAAAAAGGTAGG + Intergenic
1176653172 21:9567892-9567914 GAACAGGCAGAGTTGAAGCTGGG - Intergenic
1177725458 21:24961061-24961083 ATACAAGCAGAGAGGGAGCTAGG - Intergenic
1178092800 21:29182293-29182315 GTACAGGCAAATAAGAAGCTGGG - Intergenic
1179287770 21:39992821-39992843 GTCTTAGCACAAATGAAGCTAGG - Intergenic
1179305860 21:40153554-40153576 GTACAAGCACAGATGAAGCTAGG + Intronic
1181149888 22:20875613-20875635 GTAAAAGCACAGGGGAAGCCGGG + Intronic
949240109 3:1860948-1860970 ATATAATCACAGATGAACCTCGG - Intergenic
952079987 3:29746395-29746417 GTACAAACACAGCTGTAGTTTGG - Intronic
953441939 3:42925715-42925737 GGTGAAGCACAGATGAATCTAGG - Intronic
955035480 3:55263185-55263207 GTGCAAAGACAGATGAATCTTGG + Intergenic
956811493 3:72867866-72867888 GCAAAGGCACGGATGAAGCTTGG + Intergenic
958806758 3:98820516-98820538 GCACAATCACATATGAAACTGGG - Intronic
959496107 3:107053733-107053755 AGACAAGCAGAGCTGAAGCTAGG + Intergenic
964548523 3:157861060-157861082 ATATAAGCCCAGATAAAGCTGGG - Intergenic
964620350 3:158715014-158715036 GTACATGTACAGATGTTGCTGGG + Intronic
964989078 3:162784418-162784440 GTACAGTTACACATGAAGCTGGG + Intergenic
966839461 3:184076855-184076877 GGACAAGCACAGAGGAAGATGGG + Intergenic
967319755 3:188183864-188183886 GTATAAGCACATATCCAGCTAGG - Intronic
970260792 4:14222397-14222419 TTACAGGCACAGATAATGCTTGG - Intergenic
970271030 4:14347814-14347836 GTAGAAGCACAGATGTAGGAAGG - Intergenic
971068940 4:23068233-23068255 GTGCAAGCTCAGGTGAAGATTGG + Intergenic
972370831 4:38421787-38421809 ATAAAAGAACACATGAAGCTGGG + Intergenic
977411956 4:96677695-96677717 GTATAAGCACATATCTAGCTTGG + Intergenic
978540733 4:109813978-109814000 GTAGAAGCACAGATCAGGCCAGG - Intergenic
979392513 4:120143277-120143299 TTGGAAGCACAGATAAAGCTTGG - Intergenic
981025627 4:140074312-140074334 GTACAAGGAAGGAAGAAGCTGGG - Intronic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
983671327 4:170241159-170241181 GTATAAGCACAGAAGATACTTGG - Intergenic
983760543 4:171400900-171400922 CTACAAGGACATATGAAGCTAGG + Intergenic
984923129 4:184783303-184783325 GTATAAGCACAAAGGAAGCTGGG - Intronic
986677431 5:10198705-10198727 GTAGAAACACAGATGAAAATTGG - Intergenic
987871093 5:23617641-23617663 GTTCGAGCACAGAAGAAGGTGGG - Intergenic
992536278 5:77707207-77707229 GTACAGGTACAGATGCAGATAGG + Intronic
994056122 5:95417989-95418011 GTGAAACCACAGATGAAGGTGGG - Intronic
995756011 5:115504885-115504907 AGACAAGAACAGATGATGCTAGG + Intergenic
995965543 5:117903179-117903201 TTACTGGCACAGCTGAAGCTTGG - Intergenic
996759174 5:126969918-126969940 GACCAAGCAAACATGAAGCTAGG + Intronic
999128757 5:149266587-149266609 CTGCAGCCACAGATGAAGCTAGG + Intergenic
1000624774 5:163526583-163526605 GCACAAGCACACATCTAGCTAGG + Intergenic
1004638960 6:17495570-17495592 CTACAAGCACTGATAAGGCTTGG + Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005565612 6:27090545-27090567 GTTCATGCATAGATGGAGCTGGG - Intergenic
1005657006 6:27949665-27949687 GTAGAAGCTCAGATAAAACTTGG - Intergenic
1006456374 6:34134301-34134323 TTACAAGCTCAGATAAAGCTTGG + Intronic
1009594055 6:65711528-65711550 GTACAAACAAAAATGGAGCTGGG - Intergenic
1015528635 6:134198119-134198141 GTGGGAGCAGAGATGAAGCTAGG - Intronic
1016749918 6:147621154-147621176 GTAAAAGCATACAGGAAGCTTGG - Intronic
1020999977 7:15316536-15316558 GGCCAAGCAAAGATGAACCTAGG - Intronic
1022908853 7:34881033-34881055 GCACAAGCAGGGATGAAGGTAGG - Intergenic
1025279519 7:57616622-57616644 GAACAGGCAGAGTTGAAGCTGGG - Intergenic
1025305212 7:57848878-57848900 GAACAGGCAGAGTTGAAGCTGGG + Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1026652015 7:72223951-72223973 GTACACGCAGACATGAAGATGGG + Intronic
1027999277 7:85470430-85470452 ATAGAAACACTGATGAAGCTAGG + Intergenic
1028415662 7:90577973-90577995 GTAGAAGCAGAAATGAGGCTGGG + Intronic
1035175502 7:157047167-157047189 GAAGAAGCACAGATGACCCTCGG + Intergenic
1040062416 8:43115253-43115275 GTACAAGCACAGAAGACGAGAGG - Intronic
1040891455 8:52321238-52321260 GGAGGAGCACAGAGGAAGCTGGG + Intronic
1044954796 8:97468768-97468790 GTACATACACAGAGAAAGCTAGG - Intergenic
1046858442 8:119063168-119063190 GCACAAGAACAGATGTTGCTGGG + Intronic
1047628317 8:126679088-126679110 ATCCAAGCACTGAGGAAGCTAGG - Intergenic
1050536906 9:6638508-6638530 AAAGAAGCAAAGATGAAGCTGGG - Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1055766487 9:79669038-79669060 ATACATGCACAAATGAAGCCTGG - Intronic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056991011 9:91410999-91411021 ATACAAGCACAGATGAGGCATGG + Intronic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1061224683 9:129274049-129274071 GTGCAGTCAGAGATGAAGCTGGG - Intergenic
1203630903 Un_KI270750v1:71432-71454 GAACAGGCAGAGTTGAAGCTGGG - Intergenic
1185644146 X:1605161-1605183 GTACAAGCAGAGGGGAAGCTGGG - Intergenic
1188002571 X:24995992-24996014 GTGGAGGCACAGAGGAAGCTGGG - Exonic
1188712320 X:33415835-33415857 GTACAAGCATAAATGCTGCTTGG - Intergenic
1189911152 X:45811557-45811579 ATAAAGGCACAGATGTAGCTAGG - Intergenic
1191105578 X:56770178-56770200 GTGGAAGCACAGATGAAGACAGG - Intergenic
1191106571 X:56775580-56775602 GTGGAAGCACAGATGAAGACAGG - Intergenic
1191108198 X:56785392-56785414 ATGGAAGCACAGATGAAGATGGG - Intergenic
1191109849 X:56795942-56795964 ATGCAAGCACAGATGAAGACAGG - Intergenic
1191110519 X:56800223-56800245 ATAGAAGCACAGATGAAGACAGG - Intergenic
1191712161 X:64161566-64161588 GGATAAGGACAGATGAAACTGGG + Intergenic
1193630699 X:83883838-83883860 GTATAAACACAGCTGGAGCTAGG + Intronic
1198053690 X:132973279-132973301 GCACAAGCACAGTAGGAGCTGGG - Intergenic
1200012333 X:153128094-153128116 GCAGCAGCACAGACGAAGCTCGG - Intergenic
1200027267 X:153271825-153271847 GCAGCAGCACAGACGAAGCTCGG + Intergenic