ID: 1179306333

View in Genome Browser
Species Human (GRCh38)
Location 21:40156710-40156732
Sequence CACAATGGTGGTAGTGATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 9, 3: 78, 4: 331}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179306330_1179306333 3 Left 1179306330 21:40156684-40156706 CCAGAGACTTGTTAAATTGTTAT 0: 2
1: 7
2: 11
3: 52
4: 413
Right 1179306333 21:40156710-40156732 CACAATGGTGGTAGTGATATAGG 0: 1
1: 0
2: 9
3: 78
4: 331
1179306329_1179306333 4 Left 1179306329 21:40156683-40156705 CCCAGAGACTTGTTAAATTGTTA 0: 4
1: 79
2: 139
3: 743
4: 2745
Right 1179306333 21:40156710-40156732 CACAATGGTGGTAGTGATATAGG 0: 1
1: 0
2: 9
3: 78
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179306333 Original CRISPR CACAATGGTGGTAGTGATAT AGG Intronic
900785560 1:4647553-4647575 GATAATGGTGGTGGTGATGTTGG + Intergenic
900827496 1:4938591-4938613 CACACTAGTAGTAGTGAAATAGG + Intergenic
905333331 1:37224845-37224867 CACAATTGTATTAGTGGTATGGG - Intergenic
905965723 1:42093577-42093599 CACAATGGTGGTACAGGCATTGG - Intergenic
906760401 1:48372250-48372272 CACAATGGGGGTACAGGTATTGG + Intronic
908687626 1:66739725-66739747 CACAATGGTGGAAGTGCTAAAGG + Intronic
908862297 1:68503124-68503146 AACAATGGTGGTATTTTTATGGG - Intergenic
908919180 1:69169587-69169609 CAAAATGCTGATAATGATATAGG + Intergenic
909054308 1:70804363-70804385 CACAATGGGGGTATAGACATTGG - Intergenic
909056086 1:70822875-70822897 CACAATTGTGGAAGTGAAATTGG + Intergenic
909104434 1:71391347-71391369 CAAAATGCTGATAGTGATACAGG + Intergenic
909542475 1:76806429-76806451 CAGAATGTTGGTAGAGATATAGG + Intergenic
910624591 1:89292937-89292959 CCCAAAGGTGGTTGTGATCTGGG - Intergenic
912267508 1:108173766-108173788 CAAAATGCTGATAGTAATATGGG + Intronic
916263193 1:162862705-162862727 CACAAATGTGGCAGTTATATAGG + Intronic
917771951 1:178289112-178289134 CACAATTCTGGCAGTGATGTGGG - Intronic
919409787 1:197228546-197228568 CAAAATGCTGATAGTAATATTGG - Intergenic
920580442 1:207102093-207102115 CACAATGTTGGTTGTAGTATTGG + Intergenic
921521774 1:216165066-216165088 GACAATGGAGGTATTGATGTTGG - Intronic
922425285 1:225486411-225486433 CACAATGGTGCAAGTGCTTTGGG - Intergenic
924806685 1:247366965-247366987 TACAATGGGGGTACTGGTATTGG - Intergenic
1063578259 10:7281294-7281316 AACAATGGTGGTGGTGTTAGTGG + Intronic
1065142795 10:22735687-22735709 CAAACTGGTGGTCGTGATATAGG + Intergenic
1066273398 10:33845185-33845207 CAAAATGCTGATAATGATATGGG - Intergenic
1066508563 10:36070068-36070090 GAAAATTGTGGAAGTGATATTGG + Intergenic
1067181952 10:43994695-43994717 GATAATGGTGATGGTGATATTGG - Intergenic
1067361231 10:45581181-45581203 CACAATTGTGGTGGTGCTAATGG + Intronic
1067783216 10:49224039-49224061 CAAAATGCTGATAATGATATGGG - Intergenic
1072866578 10:99068105-99068127 CAAAATGCTGATAGTGATATGGG - Intronic
1073629570 10:105134978-105135000 TACAATGGTGGGAGAGGTATGGG + Intronic
1073942464 10:108714071-108714093 CACAATGGTGGTACAGGCATTGG - Intergenic
1075677520 10:124305944-124305966 GATAATGGTGGTGGTGATAATGG - Intergenic
1078393275 11:10955140-10955162 CAAAATGCTGATAGGGATATGGG + Intergenic
1079707443 11:23638295-23638317 CAAATTGCTGATAGTGATATGGG - Intergenic
1079838742 11:25367547-25367569 CAAAATGGTGATAATTATATGGG - Intergenic
1079998377 11:27320399-27320421 CACAAAGGTGGTGGTGGTAGAGG + Intergenic
1081162629 11:39768667-39768689 AACAATAGTTGTAATGATATTGG - Intergenic
1082733212 11:56825391-56825413 CAAAATGCTGATAGTAATATGGG - Intergenic
1084913023 11:72406579-72406601 CAAAATGATGGAAGTGAGATAGG - Intronic
1085869360 11:80331137-80331159 CTCAGTGTTGGTAGTGATGTGGG + Intergenic
1086827358 11:91516001-91516023 CAAAATGGGGGTCGTAATATCGG + Intergenic
1086992082 11:93314431-93314453 TAAAATGCTGATAGTGATATGGG - Intergenic
1087511045 11:99094090-99094112 CTTAATGGTGGTAGTGATAAGGG - Intronic
1087877389 11:103374582-103374604 CAAAATGCTGATAGTGATATGGG + Intronic
1089225123 11:116913081-116913103 CAGAATTGTGGTAGTGACAAAGG + Intronic
1089781528 11:120876322-120876344 GATAGTGGTGGTAGTGATAATGG - Intronic
1091982647 12:4878973-4878995 TACAATGGGGGTACAGATATTGG + Intergenic
1092486003 12:8902533-8902555 CAAAATGCTGATAGCGATATAGG - Intergenic
1093387372 12:18574539-18574561 CACAATTGGGGCAGTGGTATGGG - Intronic
1093974025 12:25401304-25401326 CACAATGGGGGTATGGACATTGG - Intergenic
1094250099 12:28349866-28349888 CAGAATGGTAGAAGTGATCTGGG + Intronic
1094421250 12:30273439-30273461 CAAAATGCTGATAGTAATATGGG - Intergenic
1094489164 12:30947951-30947973 TACAATGGTGGTACAGGTATTGG + Intronic
1095252398 12:39994501-39994523 TATTATGGTGGTAGTGATATGGG - Intronic
1095345992 12:41149041-41149063 CAAAATGCTGATAGTGATATGGG - Intergenic
1095447042 12:42292963-42292985 CACAAAAGTGGTAGATATATGGG + Intronic
1097343751 12:58468239-58468261 AAAAATGGTGATAGTGATATGGG - Intergenic
1098188693 12:67925248-67925270 CACAAGGGTGTTTGCGATATGGG - Intergenic
1099487693 12:83248739-83248761 CAAAATGCTGATAGTGATATGGG + Intergenic
1099495611 12:83342710-83342732 CAAAATGCTGATAGTGGTATGGG + Intergenic
1099635286 12:85204719-85204741 TACAATGGGGGTACAGATATTGG - Intronic
1099655168 12:85479921-85479943 CAAAATGCTGGTAGTGATATGGG - Intergenic
1099658609 12:85526953-85526975 CAAAATGCTGATAGTGATATGGG + Intergenic
1099746113 12:86707193-86707215 CAAAATTGTGGTAGTGACTTTGG + Intronic
1100068011 12:90674342-90674364 GGCAATGGTGGTAGTGTTATTGG - Intergenic
1101190359 12:102326181-102326203 TAAAATGCTGATAGTGATATGGG + Intergenic
1101372439 12:104141621-104141643 AACCATGGTGGTAGTAGTATGGG - Intergenic
1101526465 12:105535651-105535673 CAAAATGCTGATAGGGATATGGG - Intergenic
1101742676 12:107513188-107513210 GATAATGGTGGTAGTGATGAAGG - Intronic
1101927175 12:108981840-108981862 GACAATGGTGGTGATGATGTTGG - Intronic
1102018061 12:109661556-109661578 AATAATGGTGGTAGTTATAATGG - Intergenic
1102018094 12:109661763-109661785 AATAATGGTGGTAGTAATAGTGG - Intergenic
1102018153 12:109662128-109662150 AATAATGGTGGTAGTAATAGTGG - Intergenic
1102018169 12:109662248-109662270 AATAATGGTGGTAGTAATAGTGG - Intergenic
1103113379 12:118302860-118302882 CAAAATGGTAGTCGTGATATTGG - Intronic
1104116035 12:125749572-125749594 TACAATGGGGGTACTGGTATTGG - Intergenic
1104142609 12:126003367-126003389 CAAAATGCTGATAGTGATGTAGG + Intergenic
1104974155 12:132544743-132544765 GACAATGGTGATAGTGATTATGG + Intronic
1105259244 13:18766673-18766695 TACAATGATGGTACAGATATTGG + Intergenic
1105264282 13:18802581-18802603 TACAATGATGGTACAGATATTGG + Intergenic
1105528997 13:21201293-21201315 CAAAATGCTGATAGTGATATAGG - Intergenic
1106754465 13:32809109-32809131 CACAATGGAAGTATTGATACAGG - Intergenic
1108829844 13:54464190-54464212 CACAATAGTGGGAGTGGTAGTGG - Intergenic
1109359703 13:61280214-61280236 CAAAATGCTAATAGTGATATTGG + Intergenic
1109522277 13:63529736-63529758 TACAATGGGGGTAGAGGTATTGG - Intergenic
1110007662 13:70293249-70293271 CAAAATGTTGATGGTGATATGGG + Intergenic
1110381398 13:74855685-74855707 GACAATGGTGATAATGATAATGG + Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1111313170 13:86516814-86516836 TACAATGGGGGTACTGATATTGG + Intergenic
1111457957 13:88508428-88508450 CACAATGGTGGTACAGGCATTGG + Intergenic
1111703986 13:91725117-91725139 CAGAATGGTGGAAGTGATATGGG + Intronic
1112095666 13:96129232-96129254 GAAAATGTTGGTGGTGATATAGG + Intronic
1112755289 13:102625505-102625527 CACCATGGTGGGAGTGAAAAGGG - Intronic
1112859015 13:103807793-103807815 CAAAATGCTGGTAGTTACATGGG + Intergenic
1112929023 13:104712902-104712924 CACAATGGTGGTACAGGCATTGG + Intergenic
1114217064 14:20664935-20664957 CACAATGGGGGTACAGGTATTGG + Intergenic
1114383519 14:22233166-22233188 CAAAATGCTGATAGTGATATGGG - Intergenic
1116364159 14:44039474-44039496 TACAATGGAGGTACAGATATTGG - Intergenic
1116759804 14:48998159-48998181 CACAAATCTAGTAGTGATATTGG - Intergenic
1116784036 14:49268240-49268262 CAAAATGCTGATAGTGATTTGGG + Intergenic
1119167084 14:72503530-72503552 TACAATGGTGGGAGAGGTATAGG + Intronic
1120485805 14:85112289-85112311 TACAATGGTGGTACAGGTATTGG + Intergenic
1120654240 14:87169935-87169957 CAAAATGCTGATAGTGATATGGG - Intergenic
1120745343 14:88146824-88146846 CAGCATGGTAGTAGTGAAATGGG - Intergenic
1121935977 14:98018991-98019013 CACAATGTTGGTATTTATAAAGG + Intergenic
1123140449 14:106072517-106072539 CAAAATGCTGATAGTGATATGGG + Intergenic
1123827176 15:24093734-24093756 CACAATGCTGATAGTGACATGGG - Intergenic
1123841782 15:24254613-24254635 CACAATGCTGATAGTGACATGGG - Intergenic
1123861159 15:24468067-24468089 CACAATGCTGATAGTGACATGGG - Intergenic
1124794383 15:32762775-32762797 TACAATGGGGGTACAGATATTGG + Intergenic
1125989989 15:44096779-44096801 CACATTTGTGGTTGTGAAATGGG - Intronic
1126512954 15:49501292-49501314 CAAAATGCTGATACTGATATGGG + Intronic
1126825159 15:52541051-52541073 CAAAATGCTGATAGTGATATAGG - Intergenic
1128194156 15:65735702-65735724 CACAATGGTTGTCTTGATTTTGG + Intronic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1131470130 15:92689377-92689399 CACAATGGTGGTACAGGCATTGG - Intronic
1132261115 15:100425565-100425587 CACAATGGGGGTATAGGTATTGG - Intronic
1133746297 16:8689255-8689277 GACAATGGAGGCAGTGATACTGG - Intronic
1133815142 16:9191417-9191439 GACAATGGTGGTAATGATGATGG + Intergenic
1133894423 16:9912267-9912289 AGCAATGGTGGTAGTGATTATGG + Intronic
1134011763 16:10859232-10859254 CATGATGGTGGTAGTGATGGTGG + Intergenic
1134595955 16:15496119-15496141 GATAATGGTGATAGTGATAATGG + Intronic
1134809232 16:17153115-17153137 CACAATGGTGGTGGTAGTAGTGG - Intronic
1135429681 16:22373089-22373111 CACAATAGAGGTAGTAATGTTGG - Intronic
1135498330 16:22971966-22971988 CACAATGGTGGTGGTGGTGGCGG - Intergenic
1136662808 16:31780059-31780081 CAAAATGCTGGTAGTGATATGGG + Intronic
1138335401 16:56249052-56249074 AACTACGGTGGTAGTGATTTAGG + Intronic
1138763131 16:59567768-59567790 CTCAATGGTGGTAGAGCTCTGGG - Intergenic
1139083983 16:63561904-63561926 CAAAATGCTGATAATGATATGGG - Intergenic
1139091396 16:63652296-63652318 CACAATGGTGCTAGGGATAGCGG - Intergenic
1141881281 16:86861370-86861392 GACAATGGTGGTAATGATGATGG + Intergenic
1141881312 16:86861598-86861620 GACAATGGTGGTAATGATGATGG + Intergenic
1141881326 16:86861697-86861719 GACAATGGTGGTAATGATGATGG + Intergenic
1143213116 17:5203933-5203955 TACAATGGTGGGACTGACATAGG - Intergenic
1143827515 17:9622769-9622791 TACCAGGGTGGTAGTCATATAGG - Intronic
1144160420 17:12552318-12552340 GATAATCGTGATAGTGATATTGG - Intergenic
1145323126 17:21778427-21778449 CACAATGTTGGCACTGAAATGGG + Intergenic
1146530045 17:33600810-33600832 CAGAATGTTGGTAGAAATATGGG + Intronic
1149399228 17:56277013-56277035 CACAATGGTAGTAGTGTTTATGG + Intronic
1150687475 17:67332181-67332203 TACAATGGGGGTACAGATATTGG - Intergenic
1152009640 17:77704232-77704254 CACAATGGGAGTACTGCTATGGG + Intergenic
1153138238 18:1941977-1941999 TACAATGGTGGTACGGGTATTGG - Intergenic
1154236736 18:12612931-12612953 CATAATGGTGGTAGTGATGGTGG - Intronic
1154349634 18:13572212-13572234 TACATTGGGGGTAGTGAAATGGG + Intronic
1155851780 18:30783152-30783174 CACAATGGAGGTACAGACATTGG - Intergenic
1155896222 18:31330301-31330323 CACAATGGTGGCAGAGGCATCGG + Intronic
1156207986 18:34906702-34906724 CAAAATGCTGATAGTGATATGGG - Intergenic
1160042041 18:75353995-75354017 TACAATGGGGGTAGAGACATTGG - Intergenic
1161145080 19:2672819-2672841 CACACTGGTGGTGTTGACATTGG - Intronic
1162183580 19:8887614-8887636 TACAATGGTGGTGGTGATTATGG - Intronic
1163067254 19:14806969-14806991 CACAATGGTTGAACTAATATAGG + Intronic
1167711844 19:51116534-51116556 GAGAATGGTGGTGGTGATCTTGG - Intergenic
1168496303 19:56854379-56854401 CACAATGGGGGTACAGGTATTGG - Intergenic
1168702307 19:58448257-58448279 CAAAATGCTGATAATGATATGGG + Intergenic
925638535 2:5965658-5965680 CAAAATGCCGATAGTGATATGGG - Intergenic
925891815 2:8440456-8440478 CACCATGGTGGCAGTGATAGGGG - Intergenic
926947526 2:18204063-18204085 TACAATGGTGGTACTGGTATTGG - Intronic
929081501 2:38126948-38126970 CAAAATGCTCATAGTGATATGGG + Intergenic
929271031 2:39972029-39972051 CACAATGGTTGGGGAGATATTGG + Intergenic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
930280340 2:49362172-49362194 CACAATGGAGGTACAGGTATTGG + Intergenic
930869069 2:56151568-56151590 CAGAATGGAGGCAGTGATTTTGG - Intergenic
930939890 2:57000050-57000072 CAAAATGCTGATAGTGATATGGG - Intergenic
931549054 2:63422503-63422525 CCCAATGGTTGTACTTATATAGG - Intronic
931577743 2:63737184-63737206 AACAGTGGTGGTAGTGCTTTTGG - Intronic
932317930 2:70798546-70798568 TACAATGGGGGTACAGATATTGG + Intergenic
932847663 2:75152028-75152050 CACAATGGGGGTACAGATATTGG - Intronic
933046104 2:77539308-77539330 CAAAATGCTGATTGTGATATGGG + Intronic
935131802 2:100266228-100266250 CACAATGGTGGCAGGGATGGAGG - Intergenic
935322762 2:101905226-101905248 CATGATGTTGGTAGTGTTATTGG + Intergenic
936227906 2:110674662-110674684 CCTCATGGTGGTAGTGACATTGG - Intronic
936850889 2:116896334-116896356 AAAAATGCTGATAGTGATATAGG - Intergenic
936940785 2:117882293-117882315 CAAAATGCTGATAGTGATATGGG + Intergenic
937615995 2:123922937-123922959 CACAATGGTGGTTCTGGCATTGG + Intergenic
937877185 2:126834658-126834680 AATGATGGTGGTGGTGATATTGG - Intergenic
939482770 2:142770371-142770393 CAAAATGCTGATAGTGACATGGG + Intergenic
940288836 2:152058427-152058449 CAAAATGCTGATAGTGATATGGG + Intronic
940426904 2:153540827-153540849 TACAATGGGGGTACAGATATTGG - Intergenic
940621644 2:156120989-156121011 CAAAATGCTAATAGTGATATGGG + Intergenic
941578647 2:167267894-167267916 CAAAATGCTGATAATGATATGGG + Intergenic
941614735 2:167706544-167706566 CTCAATGGTGATAGTGAGATGGG + Intergenic
942987990 2:182164612-182164634 GACCATGGTGGTAGGGATAGAGG + Intronic
944100394 2:196019998-196020020 CATGGTGGTGGTAGTGATAGAGG - Intronic
945347072 2:208731429-208731451 CACACTAGTGGTAGTGATAATGG + Intronic
945515967 2:210763542-210763564 CAAAATGCTGATAGTGATATGGG - Intergenic
946480861 2:220055384-220055406 TACAATGGGGGTACAGATATTGG - Intergenic
946838220 2:223794288-223794310 CGCAATAGTGTTAGTGTTATAGG - Intronic
947443079 2:230140392-230140414 CAAAATGCTGATAGTGATATGGG + Intergenic
947903188 2:233739642-233739664 CACAATGGGGGTACAGAAATTGG - Intronic
947904603 2:233751307-233751329 CACAATGGGGGTACAGAAATTGG - Intronic
948183229 2:235999454-235999476 GACAATGGTAGTAGTGATTGTGG + Intronic
1170725164 20:18919682-18919704 CACAATGCTGATAGTGATATGGG + Intergenic
1171380276 20:24729394-24729416 CACATGGGTGGTGGTTATATGGG + Intergenic
1176518578 21:7806823-7806845 CTAAATGGTGGTGGTGATAATGG - Intergenic
1176657789 21:9603282-9603304 CAAAATGCTGATAATGATATGGG - Intergenic
1176845250 21:13871700-13871722 TACAATGATGGTACAGATATTGG + Intergenic
1177394180 21:20511550-20511572 TAAAATGCTGATAGTGATATGGG - Intergenic
1177554602 21:22672804-22672826 TACAATGGGGGTACAGATATTGG - Intergenic
1177614664 21:23501168-23501190 CAAAATGCTGGTAGTGATATGGG + Intergenic
1177628697 21:23699757-23699779 CAAAATGCTGATAGTGATATGGG + Intergenic
1178004009 21:28196398-28196420 TACAATGGTGGTACAGGTATTGG + Intergenic
1178240499 21:30894194-30894216 CACCATGGTGGCAGGGATAAAGG + Intergenic
1178652606 21:34436836-34436858 CTAAATGGTGGTGGTGATAATGG - Intergenic
1179306333 21:40156710-40156732 CACAATGGTGGTAGTGATATAGG + Intronic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1182069925 22:27456316-27456338 CACCAAGCTGGTAGTGATTTTGG + Intergenic
1183696275 22:39425025-39425047 CAGAATGGTTGTAGGGGTATGGG - Intronic
949292541 3:2483311-2483333 TACAATGGGGGTACAGATATTGG - Intronic
950972369 3:17202083-17202105 CAAAATGCTGATAGTGATATAGG + Intronic
951199626 3:19862690-19862712 TACAATGGGGGTACTGGTATTGG + Intergenic
951843659 3:27062368-27062390 CACAATGAAGGTAGAAATATAGG - Intergenic
955153512 3:56392757-56392779 GACAATGGTGGTTGTGGTAAAGG + Intronic
955573971 3:60338737-60338759 CATAATGGTGGTACTGTGATGGG + Intronic
956810652 3:72861210-72861232 CACAATGGTGGTGGTGGTGGTGG - Intronic
957148639 3:76457246-76457268 AACAATGGAGGTACAGATATTGG + Intronic
958175210 3:89988865-89988887 CAAAATGCTGATAGTGATATGGG + Intergenic
958637545 3:96763997-96764019 TACAATGGTGGTACAGACATTGG - Intergenic
959229615 3:103631667-103631689 CAAAATGCTGATAGTGATATGGG + Intergenic
959317119 3:104822484-104822506 TACAATGGGGGTAGAGATATTGG - Intergenic
959795456 3:110422560-110422582 GACAATGATGATAGTGATAGTGG + Intergenic
961503732 3:127356319-127356341 TACAATGGTGGTAGAGGCATTGG + Intergenic
962301132 3:134244156-134244178 AACAGTGGTGGTGGTGATAGGGG - Intronic
962946354 3:140174337-140174359 CAAAATGCTGATAGTGATATGGG - Intronic
963539566 3:146567790-146567812 CAAAATGATGATAGTGATATGGG - Intergenic
964296458 3:155239581-155239603 CACAGTGGTGGTAGTGGTGGTGG + Intergenic
964520830 3:157564453-157564475 CAAAATGCTGATAGTGATACGGG - Intronic
964686867 3:159404874-159404896 CCCAGTGGTGGTAGTGACATAGG + Intronic
965349305 3:167594280-167594302 CAAAATGTTCATAGTGATATGGG + Intronic
966075783 3:175935602-175935624 CAAAATGCAGGTAGTGATATGGG + Intergenic
966741890 3:183241868-183241890 CAAAATGCTGATAGTGATATGGG + Intronic
967048093 3:185755784-185755806 TACAATGGTGGTACAGACATTGG - Intronic
967282741 3:187837753-187837775 AACAATGGTGGAAGTGAGAGTGG - Intergenic
967634931 3:191790412-191790434 TACAATGTGGGTAGAGATATTGG + Intergenic
968283070 3:197491636-197491658 CTGAATGGTGGTAGTGATGATGG + Intergenic
968592836 4:1467682-1467704 GACAATGGTGATGGTGATAATGG + Intergenic
969152176 4:5178814-5178836 CAAAATGCTGATAGTGATATGGG - Intronic
969529817 4:7724440-7724462 GACAATGGTGGTGGTGATGGTGG + Intronic
969529830 4:7724497-7724519 GACAATGGTGGTGGTGATGGTGG + Intronic
970344116 4:15136635-15136657 CAAAATGCTGATAGTGATATGGG - Intergenic
970659329 4:18266179-18266201 CAAAATGCTGATAGTGATATTGG - Intergenic
971107098 4:23538408-23538430 CAGAATGGTGGAAGTGAATTTGG - Intergenic
971241614 4:24894319-24894341 CATAGTGGTTGTAGTGATAGTGG + Intronic
971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG + Intergenic
971546637 4:27894725-27894747 CAGAATGTTGGTAGATATATGGG - Intergenic
972192230 4:36608920-36608942 TGCAATGGTGGTGGTGATAATGG - Intergenic
972896022 4:43620928-43620950 CAAAATGCTGATAGTAATATGGG - Intergenic
973072045 4:45873891-45873913 GACAATGCTGGTACTGAAATGGG - Intergenic
973131451 4:46653509-46653531 CACAATGGTGGTACTGGTATTGG + Intergenic
973542180 4:51945708-51945730 CAAAATGCTGATAGTGATATGGG + Intergenic
973639248 4:52886664-52886686 CATAATGGAGGTAGTGATGCAGG - Intronic
973665248 4:53152778-53152800 TACAATGGTGGTATAGAAATTGG + Intronic
974637921 4:64589675-64589697 CAGAATGCTGATAGTGATATGGG + Intergenic
974963265 4:68730248-68730270 TACAATGGGGTTACTGATATTGG + Intergenic
975445829 4:74463985-74464007 CACAGTGGTGGCAGTGAAAATGG + Intergenic
975819658 4:78257024-78257046 CAAAATGGTGGTAGTGATGGTGG - Intronic
975952418 4:79789522-79789544 AACAATGGGGGTACTGACATTGG - Intergenic
977378230 4:96236707-96236729 CAAAATGCTGATAGTGATATGGG + Intergenic
977512530 4:97979459-97979481 TACAGTGGTGGGAGAGATATAGG - Intronic
977707287 4:100086177-100086199 TACAATGGTGGTAGAGGCATTGG + Intergenic
978206786 4:106089641-106089663 TACAATGGTGCTACAGATATTGG + Intronic
978659367 4:111105679-111105701 CACAATGGTGTTAATCATATAGG - Intergenic
978758509 4:112329812-112329834 CACAAGGGTGGGAGGGGTATAGG + Intronic
979778686 4:124622776-124622798 CACAATGGTGGAACAGGTATAGG + Intergenic
980614043 4:135194946-135194968 CACAATGGAGGTAGAGTCATTGG - Intergenic
980731818 4:136833585-136833607 CAAAAGCCTGGTAGTGATATGGG + Intergenic
981237010 4:142429870-142429892 CACATTGTGGGAAGTGATATGGG + Intronic
981343249 4:143647051-143647073 TAAAATGTTGATAGTGATATGGG + Intronic
981355372 4:143783941-143783963 CAAAATGCTGGTAGAAATATGGG + Intergenic
981391464 4:144196361-144196383 CAAAATGCTGATAGTGATACAGG + Intergenic
981503193 4:145474189-145474211 CAAAATGCTAATAGTGATATGGG - Intergenic
981842887 4:149132918-149132940 TAAAATGCTGATAGTGATATGGG + Intergenic
982599778 4:157432998-157433020 CACAAAGATTCTAGTGATATGGG + Intergenic
983379032 4:166967892-166967914 CAAAATGCTGATAGTGATGTGGG + Intronic
983766276 4:171488843-171488865 CAAAATGCTGATAGTGATATGGG + Intergenic
985201511 4:187489379-187489401 TACAATGGGGGTACTGGTATTGG - Intergenic
985417621 4:189752804-189752826 CAAAATGCTGATAATGATATGGG + Intergenic
986205828 5:5624076-5624098 CACAATGGTGGTATAGGCATTGG - Intergenic
986537426 5:8805375-8805397 CAAAATGCTGATAGTAATATGGG + Intergenic
987460121 5:18198677-18198699 TACAATGGTGGTACAGATATTGG - Intergenic
988009510 5:25464379-25464401 CATAATGCTGATAGTAATATGGG + Intergenic
988038849 5:25861985-25862007 CAAAATGCTGATAGTAATATGGG - Intergenic
988456307 5:31390007-31390029 CAAAATGCTAATAGTGATATGGG - Intergenic
989817323 5:45751751-45751773 CAAAATGCTGATAGTGATAATGG - Intergenic
990484143 5:56241635-56241657 CAAAATGCTGATAGTGATATGGG + Intergenic
991186487 5:63814842-63814864 CAAAATGCTGATAGTGACATGGG + Intergenic
991335179 5:65539407-65539429 TACAATGGTGGGAGCGACATAGG + Intronic
991993226 5:72362093-72362115 AACAATGTTGGTGGTCATATTGG + Intergenic
992885753 5:81158274-81158296 GACAGTGGTGGTAGGGAAATTGG + Intronic
993001036 5:82380593-82380615 CAAAATGCTGATAATGATATGGG - Intronic
994283608 5:97937540-97937562 CAAAATGCTGATAGTGATATGGG + Intergenic
994477525 5:100290127-100290149 CATAATGGTGGTGGTGACAGGGG - Intergenic
994828625 5:104747655-104747677 TACAATGGGGGTACAGATATTGG - Intergenic
994895511 5:105697613-105697635 TACAATGGTGGTACCGGTATTGG + Intergenic
995379700 5:111518258-111518280 CACAATGGCTGTAGTGGAATTGG - Intergenic
995779893 5:115763660-115763682 CAAAATGGTTTTAGTGATATGGG - Intergenic
996526778 5:124488702-124488724 TACAATGGTGGTACAGGTATTGG + Intergenic
997028806 5:130098111-130098133 CACAATCAAGGTATTGATATTGG + Intronic
997338026 5:133121622-133121644 CACAGTGGTGGAGGTGAAATGGG + Intergenic
998836107 5:146203954-146203976 CACAATGGTGATAGTACTACAGG - Intronic
999418261 5:151418612-151418634 CACAATGGTGGTACAGACATTGG - Intergenic
1000043507 5:157502771-157502793 CACAATGGTGCTAGTGGGAGGGG - Intronic
1000564796 5:162834439-162834461 TACAATGGAGGTACAGATATTGG + Intergenic
1000609540 5:163359281-163359303 CAAAATGCTGATAGTGATAATGG + Intergenic
1000768416 5:165319765-165319787 CAAAAAGCTGATAGTGATATGGG - Intergenic
1002693318 5:181066058-181066080 CTCTTTGGTGGTAGTGTTATGGG + Intergenic
1003654297 6:7991416-7991438 GACAATGCTGGAAGTGAAATGGG + Intronic
1003979629 6:11377571-11377593 TACAATGATGGTACAGATATTGG - Intronic
1004324043 6:14657468-14657490 CACAATGCTGATAGGGCTATTGG - Intergenic
1004809427 6:19243347-19243369 CAAAATGGTGCTAGTGAAACTGG + Intergenic
1005350299 6:24927514-24927536 GATAGTGGTGGTAGTGGTATTGG - Intronic
1007186006 6:39972773-39972795 CACAATGGGGGTACAGGTATTGG - Intergenic
1007248331 6:40478342-40478364 AACCATGGTGGTGGTGATAATGG - Intronic
1008284012 6:49627405-49627427 CAAAATGGTGATAGTGAGATGGG - Intronic
1008776577 6:55046733-55046755 CACAATATTGGTAGTCTTATTGG - Intergenic
1008952966 6:57181080-57181102 CAGAATGTTGGTAGGGATATGGG + Intronic
1009605012 6:65856850-65856872 CACAATGGGGGTACAAATATTGG + Intergenic
1009710119 6:67307579-67307601 CACAACGCTGATAGTGATAATGG + Intergenic
1009710304 6:67309145-67309167 CACAATGGAGGTACAGGTATTGG - Intergenic
1010631899 6:78208182-78208204 CAAAATGCTGATAGTGATATGGG - Intergenic
1011919077 6:92548179-92548201 CACAATGGGGGTACAGATATTGG - Intergenic
1012120993 6:95366685-95366707 CAAAATACTGATAGTGATATGGG - Intergenic
1012765499 6:103362467-103362489 CAAAATGCTCATAGTGATATGGG + Intergenic
1013096185 6:106947180-106947202 AACAATGGTAAGAGTGATATTGG + Intergenic
1013112925 6:107078806-107078828 TAGCATGCTGGTAGTGATATGGG + Intronic
1013890608 6:115021850-115021872 CAAAATGCTGATAATGATATGGG - Intergenic
1014245670 6:119065774-119065796 GACAATAGTGGTAGAGAGATAGG - Intronic
1014348575 6:120309189-120309211 GTCAATGGTGGTATTGCTATTGG + Intergenic
1015239511 6:131007621-131007643 CAAAATGCTGATAGTAATATGGG + Intronic
1015793144 6:136983919-136983941 CAGATTGGTGGTAGTGATCATGG + Intergenic
1018041093 6:159922682-159922704 CACAATGGGGGTACAGACATTGG - Intergenic
1019098759 6:169610087-169610109 CAAAATGCTGATAGTGATATGGG - Intronic
1019765896 7:2849957-2849979 GACAATGGTGATAGTGATGGTGG - Intergenic
1020668152 7:11073281-11073303 TACAATGGTGGTACAGACATTGG + Intronic
1020933269 7:14427337-14427359 CAAACTGCTGATAGTGATATGGG - Intronic
1021746470 7:23745774-23745796 GACAATGGTGGTTGTGGGATGGG + Intronic
1024278707 7:47700185-47700207 AGTAATGGTGGTAGTGATAATGG - Intronic
1024832228 7:53474049-53474071 CTAAGTGGTGGCAGTGATATTGG + Intergenic
1024982140 7:55166590-55166612 CACAATGGTGGTGTTGATGGTGG + Intronic
1024982168 7:55166725-55166747 CACAATGGTGGTAGTGATGATGG + Intronic
1024982187 7:55166822-55166844 CACAATGGTGGCAGTGTTGGTGG + Intronic
1024982194 7:55166860-55166882 CACAATGGTGGTAGTGATGATGG + Intronic
1024982244 7:55167156-55167178 CACAATGGTGGTGGTGATGACGG + Intronic
1024982262 7:55167247-55167269 CACAATGGTGGTGGTGGTGATGG + Intronic
1024982273 7:55167297-55167319 CACAATGGTGGTGGTGTTGATGG + Intronic
1024982284 7:55167347-55167369 CACAATGGTGGTGGTGTTGATGG + Intronic
1024982296 7:55167397-55167419 CACAGTGGTGGTGGTGATGAGGG + Intronic
1024982315 7:55167497-55167519 CACAATGGTGGTGGTGGTGATGG + Intronic
1027549632 7:79574550-79574572 TACAATGGGGGTACAGATATTGG - Intergenic
1027785473 7:82574272-82574294 CACAATGGGGGTAGAGGCATTGG + Intergenic
1027789534 7:82621190-82621212 TACAATGGTGATACAGATATAGG - Intergenic
1028072559 7:86469767-86469789 CAGAATGGTGGTAGAAATCTAGG - Intergenic
1028987933 7:97022481-97022503 AGCAAAGGTGGTGGTGATATGGG - Intronic
1029876787 7:103762657-103762679 AACAATGGTTTTAGTAATATTGG - Intronic
1029997673 7:105024058-105024080 CAAAATGTTGGTAGTGAATTTGG + Intronic
1030784202 7:113640412-113640434 CGCAATGGTGGTACAGATATTGG + Intergenic
1031287355 7:119886618-119886640 CAAAATGCTGATAGTGATATGGG - Intergenic
1033414242 7:141148164-141148186 AACAGTGGTTGGAGTGATATGGG - Intronic
1034510823 7:151533198-151533220 CAAAATGCTGATAATGATATGGG - Intergenic
1035380933 7:158440583-158440605 AACAATGGTGGTGGTGATGGTGG + Intronic
1041541961 8:58995114-58995136 GATATTGGTGGTGGTGATATTGG - Intronic
1042412608 8:68481778-68481800 CACAATGGGGGTACAGGTATTGG - Intronic
1043694665 8:83203887-83203909 CAAAATGCTGATGGTGATATGGG + Intergenic
1044006066 8:86938238-86938260 CAAAATGCTGATAGTGATATGGG - Intronic
1044110096 8:88262570-88262592 CAATATAGTGGTAGTTATATAGG + Intronic
1044127104 8:88472209-88472231 CAAAATGCTGAGAGTGATATGGG - Intergenic
1044164626 8:88966871-88966893 CAGAATGTTGGTAGAAATATTGG + Intergenic
1044234040 8:89809604-89809626 CACAATGGAGGTACAGGTATTGG - Intergenic
1044861013 8:96523946-96523968 CACAATGGTGGTGTTGTTTTAGG + Intronic
1045849198 8:106673177-106673199 CAAAATGCTGATAGTGATAATGG + Intronic
1046134129 8:110004471-110004493 CAAAATGCTGATAGTGATGTGGG - Intergenic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1048206037 8:132416029-132416051 CACAGTGGTGGCACTGAAATAGG + Intronic
1048699932 8:137077441-137077463 CAAAATGTTGATAATGATATGGG + Intergenic
1048726231 8:137388068-137388090 CACAATGCTGATAGTGATATGGG - Intergenic
1048806452 8:138245905-138245927 CAAATTGCTGATAGTGATATGGG + Intronic
1050029299 9:1368183-1368205 GACAAGGGTGGTAGTGGCATAGG + Intergenic
1050148082 9:2591460-2591482 TACAATGGTGGTACAGACATTGG + Intergenic
1050589641 9:7148610-7148632 CCAAATGGTGGGAGTGAAATGGG - Intergenic
1050897368 9:10900201-10900223 CAAAATGATGATAGTGATATGGG - Intergenic
1051569089 9:18535343-18535365 CAAAATGCTGATAGTGATACAGG - Intronic
1051844552 9:21436878-21436900 CAAAATGGTAGAAGGGATATAGG - Intronic
1053604119 9:39639865-39639887 CACAATGGTGGTATAGGTGTGGG + Intergenic
1053861934 9:42395916-42395938 CACAATGGTGGTATAGGTGTGGG + Intergenic
1054249421 9:62702549-62702571 CACAATGGTGGTATAGGTGTGGG - Intergenic
1054375229 9:64444509-64444531 TACAATGATGGTACAGATATTGG - Intergenic
1054563532 9:66737081-66737103 CACAATGGTGGTATAGGTGTGGG - Intergenic
1055800655 9:80032394-80032416 GACAATGGTGGTACTGGCATTGG + Intergenic
1055840303 9:80495235-80495257 CAGAATGTTGGTAGAAATATGGG - Intergenic
1057285435 9:93749742-93749764 CAAACTGCTGATAGTGATATGGG - Intergenic
1057732245 9:97620473-97620495 CAAAAAGGTGGAAGTGATTTTGG + Intronic
1059581816 9:115557151-115557173 CAAAATGCTGATAGTGATATGGG - Intergenic
1059967314 9:119627875-119627897 CACAGTGGTGGTGGTGGTAGTGG - Intergenic
1059986378 9:119824183-119824205 CACAATGGGGGTACAGATATTGG - Intergenic
1060456354 9:123802390-123802412 CAGAATGGTGGTGGTGGTGTTGG - Intronic
1203635517 Un_KI270750v1:106856-106878 CAAAATGCTGATAATGATATGGG - Intergenic
1189071390 X:37867288-37867310 CAGAATGCTGATAGTGATATGGG - Intronic
1189637292 X:43024275-43024297 CAAAATGCTGATAATGATATGGG - Intergenic
1189886162 X:45546664-45546686 CACAATGGAGGTATAGACATTGG - Intergenic
1190240841 X:48656811-48656833 CAGATTGGTGGTAGAAATATGGG - Intergenic
1191052379 X:56207635-56207657 CAAAATGCTGATAGTGATATGGG - Intergenic
1191747914 X:64510208-64510230 CACAGTAGTAGTAGTGATAGTGG + Intergenic
1191760806 X:64646452-64646474 CAAAATGTTGATAGTAATATGGG + Intergenic
1192285327 X:69728919-69728941 CCCAATGGAGGTAGGGATAAGGG + Intronic
1192412657 X:70948204-70948226 CAAAATGCTGATAGTGATATGGG + Intergenic
1193273263 X:79554184-79554206 CAAAATGCTGATAGTGATATGGG + Intergenic
1193639398 X:83993756-83993778 TACATTGGTGGTATTGATATTGG - Intergenic
1194025010 X:88740274-88740296 CACAATGGTGCTAGAAATGTGGG - Intergenic
1194064096 X:89240894-89240916 CAAAATGCTGATAGTGATAGGGG + Intergenic
1194418948 X:93649034-93649056 CCAAATGGTGATGGTGATATGGG + Intergenic
1194625907 X:96226901-96226923 TACAATGGGGGTACAGATATTGG + Intergenic
1195929812 X:110063403-110063425 AACAATGGTGGCAGTGAACTTGG + Intronic
1197342462 X:125289299-125289321 CACAATGGTGGGACTGTCATAGG - Intergenic
1197385343 X:125795037-125795059 CAAAATGCTGATAGTAATATGGG + Intergenic
1197472758 X:126883123-126883145 CACAATGGTGGTACAGACCTTGG - Intergenic
1199069981 X:143464617-143464639 CACAGTGTTGGTAGTGGCATGGG - Intergenic
1199156840 X:144559771-144559793 CTAAATGGTGTTATTGATATGGG - Intergenic
1199551546 X:149066745-149066767 GACCATGGTGGTAGTGACAGAGG - Intergenic
1200718271 Y:6574993-6575015 CAAAATGCTGATAGTGATAGGGG + Intergenic
1201317307 Y:12660431-12660453 TAAAATGGTGGTAGTAACATCGG + Intergenic