ID: 1179309107

View in Genome Browser
Species Human (GRCh38)
Location 21:40181147-40181169
Sequence CACAAACAGAAATGTATGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 452
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 424}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179309107_1179309111 12 Left 1179309107 21:40181147-40181169 CCATGCATACATTTCTGTTTGTG 0: 1
1: 0
2: 2
3: 25
4: 424
Right 1179309111 21:40181182-40181204 GAACTTTTTTATTGGGTCAATGG 0: 1
1: 0
2: 2
3: 12
4: 176
1179309107_1179309108 4 Left 1179309107 21:40181147-40181169 CCATGCATACATTTCTGTTTGTG 0: 1
1: 0
2: 2
3: 25
4: 424
Right 1179309108 21:40181174-40181196 ACGCCTAAGAACTTTTTTATTGG 0: 1
1: 0
2: 0
3: 2
4: 99
1179309107_1179309109 5 Left 1179309107 21:40181147-40181169 CCATGCATACATTTCTGTTTGTG 0: 1
1: 0
2: 2
3: 25
4: 424
Right 1179309109 21:40181175-40181197 CGCCTAAGAACTTTTTTATTGGG 0: 1
1: 0
2: 0
3: 5
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179309107 Original CRISPR CACAAACAGAAATGTATGCA TGG (reversed) Intronic
900352455 1:2241935-2241957 CACACACAGACAGGCATGCACGG - Intronic
902568266 1:17330127-17330149 CACACACACAGATGTAGGCATGG - Intronic
904881666 1:33702556-33702578 TAAAAACATAAATTTATGCAAGG - Intronic
905635440 1:39548258-39548280 CCCAAACAGAAATATGTGAAAGG + Intergenic
907185509 1:52606072-52606094 CACAAACACAAACGCCTGCATGG - Intronic
908678768 1:66635335-66635357 CACAAACTCTAATTTATGCAGGG + Intronic
909297975 1:73975222-73975244 CAGAAACAGACATGTATGGAGGG - Intergenic
909837221 1:80271636-80271658 AACAAAGTGAAATATATGCAGGG + Intergenic
910099557 1:83561467-83561489 CACAAACACAAATATACACACGG - Intergenic
911974456 1:104473702-104473724 CACAAACATATACATATGCATGG - Intergenic
912672337 1:111642338-111642360 CTCAAACAGTATTTTATGCATGG + Intronic
916126364 1:161575053-161575075 CACAAAGAGAAATGGATGATGGG + Intergenic
916136283 1:161656893-161656915 CACAAAGAGAAATGGATGATGGG + Intronic
916692693 1:167205948-167205970 CACAAACACATATACATGCAGGG - Intergenic
918145568 1:181752970-181752992 CACTAACAGCAAAGTATGCGGGG - Intronic
918436719 1:184521760-184521782 CACAAACAAAAATGAAAGCCTGG + Intronic
919067509 1:192712094-192712116 CTCTTATAGAAATGTATGCATGG + Intergenic
919161917 1:193841093-193841115 TACAAACAGTAAAGTATTCAAGG - Intergenic
921193711 1:212732118-212732140 CAAAAAAAGAAATGTAATCATGG - Intronic
922992624 1:229927772-229927794 CACAATCAGAAGAGTATACAAGG + Intergenic
924290999 1:242536231-242536253 CACCACCAGAAATGCTTGCATGG - Intergenic
924473078 1:244360547-244360569 CACACACACACATGCATGCATGG + Intronic
1063777161 10:9276554-9276576 CATAAAAAGAAAAATATGCAGGG - Intergenic
1064581895 10:16802218-16802240 TACAAACAGAAATGAAAGAAGGG + Intronic
1065058650 10:21874118-21874140 CACAAAAAGAAATGAAGGCCAGG + Intronic
1065071976 10:22034517-22034539 AACAGACTGAAATTTATGCAGGG - Intergenic
1065251198 10:23816260-23816282 AACAAAAAGAAATGTGAGCATGG - Intronic
1065486689 10:26242557-26242579 CACAAATAGAAAGGAATCCATGG - Intronic
1066331096 10:34424182-34424204 TACATACAGCAATGCATGCAGGG + Intronic
1066473138 10:35718772-35718794 TGAAAACAGAAATGTAGGCAGGG + Intergenic
1067085558 10:43236297-43236319 CACAAACACACATGGATGCGCGG - Intronic
1067167463 10:43877138-43877160 CACAAACTGAAATGGAAGCCGGG + Intergenic
1067733551 10:48831314-48831336 CACTAACAGAATAGAATGCAAGG - Intronic
1068268015 10:54679776-54679798 CACAAACTGAAATGAATCCCTGG + Intronic
1068475968 10:57525639-57525661 CAAAAACACAAATGTACACATGG + Intergenic
1068981969 10:63071813-63071835 CACAAACTGAAATACATGAATGG + Intergenic
1071252839 10:83838462-83838484 CATAAATAGAAATCTATGGATGG + Intergenic
1071839923 10:89459643-89459665 GACAAAAAGAAATGTAGGCCGGG + Intronic
1071951381 10:90706436-90706458 CACACACATAAAAGAATGCATGG + Intergenic
1072093165 10:92149486-92149508 CACAAAAAGAATTTTCTGCATGG + Intronic
1074833461 10:117266135-117266157 CAGAAACATAAATGTCTGCCTGG - Intronic
1075118769 10:119649256-119649278 AACAAACAAAAAAGTATGCAGGG - Intergenic
1075444369 10:122503530-122503552 CACAGGCAGAAATCTTTGCAAGG - Intronic
1077734859 11:4780182-4780204 CCCCAACAGAAATGTGTTCATGG - Intronic
1079160406 11:17987231-17987253 CACATACACAAATGCATACAAGG - Intronic
1079631573 11:22684102-22684124 CAGAAATAGAAAGGTCTGCAAGG + Intronic
1079640245 11:22796099-22796121 CAGAAACAGAAATGTCTGACTGG - Intronic
1080183861 11:29455953-29455975 AGAAAACAGAAATGTGTGCATGG - Intergenic
1080286885 11:30625167-30625189 CACAAGCAGAAACCTTTGCAGGG - Intergenic
1081276642 11:41157597-41157619 GATAAACAGAAATTTTTGCAAGG - Intronic
1081310217 11:41561579-41561601 CATATACACAAATGCATGCAGGG + Intergenic
1081530703 11:43957235-43957257 CAAAAACATAAATCAATGCATGG + Intergenic
1081560596 11:44211782-44211804 CACAAAGAAATAAGTATGCAAGG + Intronic
1082721982 11:56689790-56689812 TACAAAAAGAAAGGTATGCAAGG + Intergenic
1082921662 11:58501811-58501833 AATAAACAGAAATGAATACATGG - Intergenic
1086186176 11:84019687-84019709 CAGAAACAGACATGCATACAGGG + Intronic
1086482445 11:87256904-87256926 CACACACACAAATGTGTGGAAGG - Intronic
1089836613 11:121376038-121376060 AAAAAACAGAAAAGAATGCATGG + Intergenic
1091330025 11:134725003-134725025 CACAAATAGGAATGTACTCAGGG + Intergenic
1092475076 12:8811565-8811587 CAGAAAAAGAAATCTATGAAAGG - Intergenic
1092655920 12:10685529-10685551 CACAAACACAAATGTATTCATGG + Intergenic
1092921762 12:13237980-13238002 CACAAACATAATTGTATAAAAGG + Intergenic
1093673937 12:21911894-21911916 CATGAACACTAATGTATGCAAGG + Intronic
1093708794 12:22305679-22305701 TGCAAACAAAAATGTATGCTAGG - Intronic
1093733988 12:22597979-22598001 CACATACTCAAATGCATGCAAGG - Intergenic
1093761772 12:22918981-22919003 CACAAACACAAATGCCTACATGG + Intergenic
1094116076 12:26914784-26914806 CTCAAACATAAATGCATTCATGG + Intronic
1095833334 12:46610752-46610774 AACAAACACATGTGTATGCATGG + Intergenic
1096172510 12:49484116-49484138 CACACACATGAATGTATTCACGG + Intronic
1098792904 12:74848555-74848577 CAAAAACGAAAATGTTTGCATGG + Intergenic
1098816892 12:75176930-75176952 AAAAAACAGAAATATATGAATGG + Intronic
1098928969 12:76387501-76387523 CAAAAGCAGAATTGTATGGAGGG - Intronic
1098996966 12:77131777-77131799 CACACACAAAAATCTATGCATGG - Intergenic
1099373939 12:81872721-81872743 GACAAAAAGAAAACTATGCAGGG - Intergenic
1099569297 12:84295330-84295352 TTCAAATTGAAATGTATGCAAGG - Intergenic
1100012980 12:89976082-89976104 CAAAAACAGATAAGTATGTAAGG - Intergenic
1100816795 12:98394706-98394728 CACAAACAAAAATGGAGGGAAGG + Intergenic
1102116155 12:110404462-110404484 CGCAAACTCAAATGTATACAGGG + Intergenic
1104054940 12:125222384-125222406 CAGCACCAGAAATGTATGCCAGG + Intronic
1104169359 12:126265157-126265179 CCCAAACAGAAATGTCTGTAGGG + Intergenic
1104222936 12:126803351-126803373 CCCAAACAGAAATGTCTGTAGGG + Intergenic
1105273120 13:18895779-18895801 CAAAGTCAAAAATGTATGCAAGG - Intergenic
1106507721 13:30385947-30385969 GACAAACTGGAGTGTATGCAGGG + Intergenic
1107924120 13:45241383-45241405 CACAAACTCAAATGTCTACAGGG - Intronic
1108433789 13:50381342-50381364 AACAAACAGAAAGGTAAACATGG + Intronic
1108945158 13:56013677-56013699 CACAAACAGCAATCTGTGAATGG - Intergenic
1110144285 13:72170433-72170455 AACAAACAGAAATGAATGCTGGG + Intergenic
1110289306 13:73785822-73785844 CAGGAACAGAGATGGATGCATGG - Intronic
1111340250 13:86876137-86876159 AACAGACAGAAATGTAAACATGG + Intergenic
1111416305 13:87949823-87949845 CACCTACAAAAATGAATGCAGGG + Intergenic
1112120319 13:96403170-96403192 CACAAACAAAGATGTTTGCAGGG - Intronic
1112250717 13:97776680-97776702 CAAAAACAGAAATAAATACATGG - Intergenic
1112413545 13:99185367-99185389 TGCAAACAAAAATGTATGCTGGG + Intergenic
1112482848 13:99792756-99792778 CCCAAACAGAAATTCCTGCAAGG + Intronic
1112970609 13:105257393-105257415 CAATGAAAGAAATGTATGCAGGG - Intergenic
1113261661 13:108571699-108571721 CACACACACACATATATGCAAGG - Intergenic
1113365580 13:109672608-109672630 CCCAGAGAGGAATGTATGCATGG - Intergenic
1113815152 13:113164433-113164455 AACACACAGAACTGTGTGCAAGG + Intronic
1114028011 14:18546370-18546392 CACACACAGAAAGGGTTGCAAGG - Intergenic
1115041242 14:28931692-28931714 CACAAGCAAAAATGGATGCCTGG + Intergenic
1115067491 14:29282413-29282435 CACAATCAGAAATAAAAGCAAGG + Intergenic
1116662959 14:47735736-47735758 CAAAAACAGAAATGTTTAAATGG - Intergenic
1116970830 14:51063595-51063617 CACAAAAAGACATATATACAGGG + Intronic
1117850311 14:59961223-59961245 CATAAACAGAAATGTATAGGCGG - Intronic
1117954443 14:61111691-61111713 CACAAACAGAAATGGCTAGATGG - Intergenic
1119209921 14:72823953-72823975 GACAAACAGGAATGGATGGAAGG + Intronic
1119980446 14:79074882-79074904 CCCAAGCAGAAATCAATGCAGGG - Intronic
1120332876 14:83115881-83115903 CACAAAGGAAGATGTATGCATGG - Intergenic
1120514046 14:85449221-85449243 TACCACCACAAATGTATGCAAGG - Intergenic
1120735484 14:88047412-88047434 AATAAATAGAAAAGTATGCAGGG - Intergenic
1121573514 14:94965095-94965117 CACCAACAGAAGTGCTTGCAAGG + Intergenic
1124433187 15:29624859-29624881 CACACACACAAATTAATGCAGGG - Intergenic
1124876238 15:33597240-33597262 TGCAAACAAAAATGTATGCTGGG + Intronic
1125415685 15:39449981-39450003 AACAAACAGAGCTGAATGCAAGG + Intergenic
1125668543 15:41452436-41452458 CAAAAACAAAAATCTATGCCAGG + Intronic
1126236056 15:46385851-46385873 AACAAACAGTGATGTATGAAGGG + Intergenic
1126240126 15:46432531-46432553 TACAAAAAGAAAAGCATGCAAGG - Intergenic
1126674656 15:51149559-51149581 CACCAACAGATATGTCTGGATGG + Intergenic
1126694580 15:51315162-51315184 CACAACCAGCAAGGTAGGCAGGG - Intronic
1127624037 15:60762980-60763002 CATAAACAAAAATGTTTTCAGGG + Intronic
1130334260 15:82945475-82945497 CACACACAGACATATATACATGG + Intronic
1130470797 15:84224709-84224731 TACAAACAGAAATATTTACATGG + Intergenic
1130478286 15:84339277-84339299 TACAAACAGAAATATTTACATGG + Intergenic
1130493479 15:84448853-84448875 TACAAACAGAAATATTTACATGG - Intergenic
1130538114 15:84801503-84801525 AAGAAAAAGAAAAGTATGCATGG + Intronic
1130593086 15:85229336-85229358 TACAAACAGAAATATTTACATGG + Intergenic
1130607021 15:85327041-85327063 CAGAAAATGAAATCTATGCATGG - Intergenic
1132016701 15:98324272-98324294 CACACACAGAGTTGTTTGCAGGG + Intergenic
1132095246 15:98979575-98979597 CATAAAAAGAAATGTATTAATGG + Intronic
1133341413 16:5038853-5038875 CATAAAAAGAAATGAATGAATGG + Intronic
1134038867 16:11052636-11052658 CACAAACAGAATCGTGTGCCTGG - Intronic
1134705305 16:16298579-16298601 CACAACTAGAAATGCATCCATGG - Intergenic
1134962236 16:18413535-18413557 CACAACTAGAAATGCATCCATGG + Intergenic
1134966533 16:18496134-18496156 CACAACTAGAAATGCATCCATGG + Intronic
1136110204 16:28059774-28059796 CACAAACAGAAAGGGAAGCGTGG - Intronic
1137540987 16:49361495-49361517 CACAAACACAAATGTCTTCAAGG + Intergenic
1137923975 16:52521989-52522011 CAGAAACGGAAATGGAAGCATGG - Intronic
1138764142 16:59579868-59579890 CACAAACAGATATTTGTTCATGG + Intergenic
1138898948 16:61244883-61244905 CGCAAACAGAAATGGGTGCTCGG - Intergenic
1139030449 16:62874687-62874709 CACACACAGACATGTATATATGG + Intergenic
1139274534 16:65715193-65715215 GACATACAGAGATATATGCAAGG + Intergenic
1140454507 16:75097130-75097152 CACAAACAGAGATGTTAGAAAGG - Intronic
1140702309 16:77592306-77592328 AGCAAACACAAATGTCTGCAAGG + Intergenic
1140786793 16:78349900-78349922 CACAAACCGAAATGTTAACAGGG - Intronic
1141468685 16:84223773-84223795 AGCTAACAGAAATGTATGGAGGG + Intronic
1141924655 16:87160183-87160205 CAAACACAGAAATGTAGCCATGG - Intronic
1143049362 17:4111244-4111266 CACACACGGAAAGGTCTGCAAGG + Intronic
1143603515 17:7966266-7966288 TAAAAACAGAAAGGGATGCATGG - Intergenic
1143664498 17:8348725-8348747 CACAAACTCAAATGCATACAGGG + Intergenic
1143698448 17:8638580-8638602 CACAGAGAGAAAAGAATGCAGGG + Intergenic
1144067041 17:11633976-11633998 CACACACAGACATGTTTTCATGG - Intronic
1144445571 17:15324404-15324426 CCCAAACAAAAATTTGTGCATGG - Intronic
1147553200 17:41459797-41459819 CAGAGACAGACATGTTTGCAAGG + Exonic
1148658025 17:49302974-49302996 AACAAACAAAAAAGCATGCATGG + Intronic
1148816565 17:50332237-50332259 CACAATCAGAAATCAAAGCAGGG + Intergenic
1149173080 17:53836144-53836166 CACAACCAGGAATGTGAGCATGG + Intergenic
1153943470 18:9996986-9997008 CACAAACTCACATGCATGCATGG + Intergenic
1155260711 18:24039366-24039388 CACAAAGAGAAGTGTATTCAAGG + Intronic
1155844648 18:30690397-30690419 AATAAACTGAAATGTAGGCAAGG - Intergenic
1156202522 18:34850818-34850840 CACAAACAGATATATATATATGG + Intronic
1156323369 18:36049235-36049257 CACACACAAAAATGTACTCAAGG + Intronic
1156535860 18:37863809-37863831 GAAAAGCAGAAATGGATGCAGGG + Intergenic
1158666830 18:59439893-59439915 TACAAAGAGAAATGGCTGCAGGG - Intronic
1159211543 18:65328461-65328483 TACAAAGATAAATGTATACAAGG - Intergenic
1159230135 18:65596304-65596326 CACAGACAGAAATGTTTGGGAGG - Intergenic
1159615137 18:70571140-70571162 CAACAACAGAAGTATATGCATGG - Intergenic
1161791652 19:6363567-6363589 CACAAACACAAATGCTTCCAGGG - Intronic
1163599759 19:18241899-18241921 AACAAATAGGAATGTGTGCAGGG - Intronic
1164380265 19:27730214-27730236 CACAAAGATAAATCTTTGCATGG - Intergenic
1165098095 19:33421180-33421202 CTCAACCAGAGATGCATGCATGG - Intronic
1166607022 19:44152414-44152436 CACAAACCAAAATGAATGAAGGG + Intronic
1166624927 19:44342980-44343002 CAAAAACAGATTTGTAAGCAGGG + Intronic
1167173694 19:47850806-47850828 TACTAACAGAAATGCATACATGG + Intergenic
1167564528 19:50248151-50248173 CACAGTCAGAAATGTCAGCAAGG + Intronic
925652943 2:6111450-6111472 CACACACACAAGGGTATGCAAGG + Intergenic
928707645 2:33967699-33967721 CCCAAAAAGAAATAAATGCAAGG - Intergenic
928739332 2:34331635-34331657 CACACACACACATGCATGCACGG - Intergenic
929059626 2:37910216-37910238 CACAGAAAGAAATGTCTGGAAGG + Intergenic
931659119 2:64541599-64541621 CTCAAGCAGAAATGTAGGCTGGG + Intronic
932078125 2:68685648-68685670 CACAAAAGAAAATGTATGAATGG + Intronic
933046327 2:77541206-77541228 TACAATCTGAAATGCATGCAAGG - Intronic
933061239 2:77739726-77739748 CAAAAACAAAAATGTGTGAAAGG + Intergenic
933223064 2:79713669-79713691 CACCAATAGAAAGGTAAGCAGGG + Intronic
933408545 2:81894867-81894889 CTCATACAGAAAAGTATGTAAGG + Intergenic
934484958 2:94698084-94698106 CATAAAAAGAAATGAATTCATGG - Intergenic
934800973 2:97158885-97158907 CAACAAGGGAAATGTATGCATGG + Intronic
936477920 2:112856622-112856644 TCCAAACAAAAATGTATGCTGGG - Intergenic
936596045 2:113849029-113849051 CAGAAACTAAAATGTCTGCAAGG - Intergenic
938618961 2:133029882-133029904 GACAAAAAGAAATGTTTACAAGG + Intronic
938622718 2:133073290-133073312 CAAGAACTGAAAAGTATGCAAGG + Intronic
939071758 2:137552691-137552713 CACAAACAGATATGAATGCATGG + Intronic
939413349 2:141860701-141860723 CACTAAGGGAAATGTTTGCATGG + Intronic
940518380 2:154711499-154711521 GAAAAACAGAAATGAATGAACGG - Intronic
941019935 2:160397180-160397202 TTCAAACAGAAATGAGTGCAAGG - Intronic
941138680 2:161748628-161748650 CAAAAACAGACATGTATCAATGG - Intronic
941159733 2:162022913-162022935 CATAAATAGAAATATATGAATGG - Intronic
941416239 2:165224812-165224834 CACAAACAGCAATATATATATGG - Intergenic
942122796 2:172794668-172794690 CACAAACACAAATGCCTGCAGGG - Intronic
943377721 2:187100566-187100588 CACAAACAAAAATGAAAGAATGG - Intergenic
943926640 2:193791981-193792003 AACAATCAGAAAAGAATGCAAGG + Intergenic
944119171 2:196222358-196222380 CAGAAACAAATATGTAGGCATGG + Intronic
945485785 2:210394376-210394398 CTGAAACAGAAATGGATTCATGG - Intergenic
946555918 2:220857117-220857139 CACAGAGAGAAATCTATGCCAGG + Intergenic
946962119 2:224996568-224996590 CACAGACAGAATGGAATGCACGG + Intronic
947980051 2:234400787-234400809 CACGAACAGAAAACTATCCATGG - Intergenic
948065080 2:235072297-235072319 CACAAAAAGGAATGAATGAATGG + Intergenic
948546652 2:238736429-238736451 CACACACATAAATGAATGGATGG - Intergenic
1169157566 20:3345714-3345736 TAAAAACAAAAATGTTTGCATGG + Intronic
1169538802 20:6577806-6577828 ATCCAACAGAAATGCATGCATGG + Intergenic
1170398240 20:15951694-15951716 AACAAACACAAATATGTGCAAGG + Intronic
1170615898 20:17950704-17950726 CACACACAGATAGGTATCCAAGG - Intronic
1171205274 20:23274094-23274116 CACAAAGAAAAATGTATTTATGG - Intergenic
1172161163 20:32869169-32869191 CACCAACAGAGCTGTTTGCAAGG + Intronic
1174860000 20:54082254-54082276 CACAAACTCAAGTGTCTGCAGGG - Intergenic
1175239551 20:57536876-57536898 CACACACACAAATGTGTGCAGGG - Intergenic
1175517541 20:59578566-59578588 GACAACCAGAAATGTCTTCAAGG - Intronic
1175680875 20:60987773-60987795 AACAGACTGAACTGTATGCATGG - Intergenic
1176712572 21:10166115-10166137 CACACACAAATATGTATACATGG + Intergenic
1176729038 21:10471629-10471651 CACAAAAAGAAACTTTTGCATGG - Intergenic
1177732572 21:25047018-25047040 GACAAACAGACATGATTGCATGG + Intergenic
1177915081 21:27079341-27079363 CACACACACACATGCATGCATGG + Intergenic
1177930543 21:27277647-27277669 CACACACACAAATGAATTCAAGG - Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1179275843 21:39891067-39891089 TACAGACAGAAATGGATCCAAGG + Intronic
1179309107 21:40181147-40181169 CACAAACAGAAATGTATGCATGG - Intronic
1180452136 22:15473425-15473447 CACACACAGAAAGGGTTGCAAGG - Intergenic
1181334829 22:22120550-22120572 CAAAGGCAAAAATGTATGCAAGG - Intergenic
1182308157 22:29385735-29385757 GAGAAAAAGAAATGTCTGCAAGG + Intronic
1182350913 22:29698942-29698964 CGAAAACAGAAATGTCTGGAAGG - Intergenic
1184748667 22:46471936-46471958 CACACACAGAAATGAAACCACGG - Intronic
949412724 3:3783397-3783419 CACAAACCCAGATGTCTGCAGGG - Intronic
949625037 3:5855870-5855892 CACCAACAGATTTGTATTCAAGG - Intergenic
949659696 3:6264068-6264090 CACAAACAGAACTATGTGAAGGG + Intergenic
950496210 3:13335969-13335991 CCCAAACAGAATAGTCTGCAGGG - Intronic
950931150 3:16789978-16790000 AAGGAACAGAAAAGTATGCATGG - Intergenic
951785245 3:26411706-26411728 CACAAATAGACACTTATGCAGGG - Intergenic
952629914 3:35453654-35453676 CAGCAAAAGAAATGTAGGCAAGG + Intergenic
953873031 3:46644218-46644240 CACACACAGCATTGTATACAGGG - Intergenic
953944419 3:47134064-47134086 CAGAAACAGAAATATTGGCAGGG + Intronic
955611805 3:60765569-60765591 CACAGAGAGAAATGTAATCAGGG + Intronic
957023038 3:75145421-75145443 CACATACATACATGTGTGCATGG + Intergenic
957031846 3:75251138-75251160 CACAAACCTAAATGTTTACAGGG + Intergenic
957742378 3:84288136-84288158 CACAAAAACAAATGTATCTATGG - Intergenic
957803188 3:85112570-85112592 CACATACTAAAATGTTTGCAAGG - Intronic
958420839 3:93928741-93928763 CCAATACAGAAATGCATGCACGG + Intronic
959394601 3:105821528-105821550 AACAAAAAGAAATCTTTGCAGGG + Intronic
959573868 3:107913058-107913080 CATAAACACAAATCAATGCATGG + Intergenic
960123092 3:113967365-113967387 AAGAAAGAGAAATGTAGGCAAGG - Intronic
960465329 3:117990677-117990699 AACAAATAGAAAGTTATGCAAGG - Intergenic
961975325 3:131018417-131018439 CACAAACAAAAAAGTATTCTTGG - Intronic
962755608 3:138463594-138463616 TATAAAAAGACATGTATGCAAGG - Intronic
964833746 3:160914200-160914222 CACAAAAATACATGTATGAATGG - Intronic
965937089 3:174127832-174127854 CACAAACACAAATGTTTATAGGG + Intronic
966830035 3:183999963-183999985 AACAAGCAGAAATGTATCAAAGG + Intronic
967488914 3:190066305-190066327 CATAAAAAGGAATGAATGCATGG + Intronic
967684517 3:192404660-192404682 CACAAACAGAAATGTTCTAAAGG + Intronic
968264012 3:197348751-197348773 CACAGACACACACGTATGCAAGG - Intergenic
969889107 4:10243299-10243321 CACAAACAGGAATGTCTGACAGG - Intergenic
970405818 4:15762239-15762261 TACACACACATATGTATGCATGG - Intergenic
971047853 4:22826075-22826097 CACAGACACATATGTATGTATGG - Intergenic
971776586 4:30974269-30974291 CAAAGACAGAAATTTATGAAAGG - Intronic
972049944 4:34718092-34718114 CACCAACAGAAATGAGTGAATGG - Intergenic
972595456 4:40526032-40526054 GACAAACTGAAATGCAAGCATGG + Intronic
973330168 4:48904947-48904969 CACAACATGAAAAGTATGCATGG + Intronic
973961235 4:56111943-56111965 GGCAAACTGTAATGTATGCATGG - Intergenic
974490733 4:62560546-62560568 GTTAAACAGAAATGTATGCCAGG + Intergenic
974946942 4:68540129-68540151 CACAACCAGAGATATATGTATGG + Intronic
974956657 4:68649624-68649646 CACAACCAGAGATATATGTATGG + Intronic
975380358 4:73693247-73693269 GAAAAAGAGAAATGTATGAAAGG + Intergenic
975665566 4:76731801-76731823 AACAAACAGAAATTTAAGCTTGG + Intronic
975845585 4:78521767-78521789 CAAAAAAAGATATGTATGGATGG - Intronic
976737066 4:88320924-88320946 AACAAACAGAAAGATCTGCAGGG - Intergenic
976843692 4:89462109-89462131 GACAAATAGAAATGGATCCATGG - Intergenic
977123475 4:93133730-93133752 TACCAACAGAAAGCTATGCACGG + Intronic
977849479 4:101808245-101808267 AAAAAACAGAAATGTCTACACGG - Intronic
978146691 4:105382701-105382723 TACAAAAAGAAATGTAGGCTGGG + Intronic
978764048 4:112386255-112386277 CACAGACAGAAATTTATGGCAGG + Intronic
978778855 4:112529225-112529247 CAGAAACATAAATGTAAACAGGG + Intergenic
979278295 4:118836797-118836819 CCCAAACAGGAATCTCTGCATGG + Intronic
979707189 4:123734489-123734511 GACAAACACAAATGTTGGCAAGG + Intergenic
980103346 4:128563801-128563823 CATAAACAAAAGTGTAAGCATGG - Intergenic
982491993 4:156041196-156041218 CATAAAAAGAAATGAATGAATGG + Intergenic
982551316 4:156803308-156803330 CAGAAACGGAAATGTAGTCATGG + Intronic
982589317 4:157284909-157284931 AACACTTAGAAATGTATGCAAGG - Intronic
983448123 4:167878874-167878896 CACAAACAGTTATGGAGGCAAGG - Intergenic
984092771 4:175395319-175395341 CACCAAGAGCAATGGATGCAAGG + Intergenic
984982711 4:185298412-185298434 GACAGAAAGAAATGTATGCTAGG - Intronic
984992186 4:185391745-185391767 CAGAATCAGCAATGTCTGCAAGG + Intronic
986037732 5:3957025-3957047 GACAAAGAGAAATGCATGGACGG - Intergenic
986106197 5:4661792-4661814 CAGTAACAGAAATGTAAGCCAGG - Intergenic
986462860 5:7991108-7991130 CACAAAAAGAAATGAAGGCAAGG - Intergenic
987681607 5:21143471-21143493 CAAAGAAAGAGATGTATGCAAGG + Intergenic
988274185 5:29059394-29059416 CTGAAACTGAAATGTATGCAGGG - Intergenic
989799509 5:45519584-45519606 AACAAAAAGAAATATATGTAGGG + Intronic
990240651 5:53813172-53813194 CACTAAAAGAAATGCATTCAGGG - Intergenic
991409715 5:66333933-66333955 CACAAACAGAGATATTAGCAAGG + Intergenic
992432344 5:76721248-76721270 AACAAACAGAAAATTATGAATGG - Intronic
992835346 5:80635572-80635594 CACAGACAGAACTGAATGAATGG + Intronic
992981327 5:82176601-82176623 CACATACACATATGCATGCATGG + Intronic
993021273 5:82594562-82594584 CCCAACCTGAAATGTTTGCAGGG - Intergenic
996571521 5:124936971-124936993 CACAAAGAGAAATGCACGGATGG + Intergenic
996690014 5:126330329-126330351 AACAAACATGAATGTAAGCAGGG - Intergenic
996937725 5:128967195-128967217 CAAAAAAAGAAAAGGATGCATGG - Intronic
996980935 5:129493939-129493961 AACAAACAGAAATGTAACTAGGG - Intronic
997083920 5:130773929-130773951 CACAGACAGGAATCTATGGATGG - Intergenic
998616474 5:143745745-143745767 AGCACACAAAAATGTATGCATGG - Intergenic
998661529 5:144244045-144244067 CATAAATAGAAAAGTATTCATGG - Intronic
998831646 5:146166011-146166033 TAAAAACAGATGTGTATGCATGG + Intronic
999080356 5:148837862-148837884 AACACACACAAATGCATGCATGG - Intergenic
999392409 5:151203212-151203234 CACAAAAGGAAATGTAGGCCAGG + Intronic
1000565664 5:162843843-162843865 CAAAAACAGTAATGTGGGCATGG - Intergenic
1000674827 5:164107765-164107787 CAAAACCAGAAATCTAAGCATGG + Intergenic
1000764751 5:165273114-165273136 CACAAACATATATGTATATATGG - Intergenic
1001670937 5:173473297-173473319 CACTAACAGAAATCTGTGCCGGG - Intergenic
1003260824 6:4513967-4513989 CACAGGCAGAAATATGTGCAGGG + Intergenic
1003976622 6:11350942-11350964 GACAAACACAAATTTATACATGG + Intronic
1004523443 6:16383568-16383590 CACAAACAGAAAAGTGTGTGTGG - Intronic
1005020873 6:21417521-21417543 CACAAACAGAAATATCTGCCAGG - Intergenic
1005215650 6:23524793-23524815 CATCAACAGATATGTATACATGG + Intergenic
1005859778 6:29891284-29891306 CACAATGAGATTTGTATGCAGGG - Intergenic
1005867353 6:29946083-29946105 CACAAGGAGATTTGTATGCAGGG - Intergenic
1005997670 6:30941148-30941170 AACAAATAGAAATGAATGAAGGG + Intronic
1006237408 6:32646401-32646423 CACAAAAATAAATTAATGCATGG + Intronic
1006379156 6:33687732-33687754 CCCAGACAGAAATGGAAGCAAGG + Intronic
1007098819 6:39230661-39230683 CACACACGGAAATGTCTGCTGGG + Intergenic
1007231706 6:40352773-40352795 CAGAAATAGAGATGTCTGCAGGG - Intergenic
1007908755 6:45491350-45491372 AAAAAACAGAAATGTAAGCAGGG - Intronic
1008002030 6:46370696-46370718 CACACACTGAAATGCAGGCAGGG - Intronic
1008584509 6:52936616-52936638 AACAAACAAAAATGGCTGCAAGG + Intergenic
1008802960 6:55392454-55392476 CAGAACCAGAAATGAATTCATGG - Intronic
1009496768 6:64358917-64358939 ATCAAAGAGAAATTTATGCATGG + Intronic
1009849256 6:69174424-69174446 CACAAAAAGAAATGAAGTCATGG - Intronic
1012135138 6:95546136-95546158 CTCACACACATATGTATGCATGG + Intergenic
1014972729 6:127837551-127837573 CACAAATAGAAATTTAGGCTGGG - Intronic
1015332350 6:131995252-131995274 CACACACATATATGTATACATGG + Intergenic
1018290445 6:162287756-162287778 CACAAATAGAAATTTGTGAAGGG + Intronic
1018650581 6:165988561-165988583 CTCCAACAGAAATGTATGAATGG - Intergenic
1018771069 6:166971885-166971907 TAAAAACAGAAATGTAGGAAGGG - Intergenic
1019147014 6:169982115-169982137 CACACACAGAGGTGTCTGCAGGG + Intergenic
1020478440 7:8627019-8627041 CATAAACAGAAATATAAACAAGG - Intronic
1020784921 7:12561676-12561698 CACAAAGAAAGATGTATGGAAGG + Intergenic
1020871514 7:13636081-13636103 CACAAAAGGAAATATATGAATGG + Intergenic
1021232819 7:18106445-18106467 AAAAAAAAGAAATGTGTGCATGG - Intronic
1022203395 7:28139480-28139502 CACAGACAGACATGCATACAAGG + Intronic
1022427470 7:30283249-30283271 CACAAACACACATATATACATGG - Intergenic
1023681496 7:42691983-42692005 CACACACAGACATATATGAAAGG - Intergenic
1023711190 7:42994629-42994651 CATAAAAAGAAGTGTAAGCATGG - Intergenic
1024142034 7:46471401-46471423 CAGAACCAGACATGTCTGCAAGG - Intergenic
1024417447 7:49123380-49123402 CAAAAACAAAAATGAATGGATGG + Intergenic
1024499605 7:50090457-50090479 CACAAACATAAATATATATATGG - Intronic
1024618922 7:51140518-51140540 CACAAACATTTATGTATGCATGG + Intronic
1024710372 7:52008823-52008845 GACAAACAGGACTGAATGCAAGG - Intergenic
1024915292 7:54492309-54492331 CAGCAACAGAAATGGCTGCAGGG - Intergenic
1025271337 7:57521435-57521457 CATACAAAAAAATGTATGCAAGG - Intergenic
1025786033 7:64644084-64644106 CACAATATGCAATGTATGCAAGG - Intergenic
1025786826 7:64651522-64651544 CACAATGTAAAATGTATGCAGGG - Intergenic
1026306999 7:69150991-69151013 CACAAAGAGTATTGCATGCAAGG - Intergenic
1026764619 7:73152720-73152742 CCCAAACAGAAATGCATTCAGGG - Intergenic
1027041089 7:74962488-74962510 CCCAAACAGAAATGCATTCAGGG - Intergenic
1027046862 7:74996656-74996678 CAAAACCAGAAATGGATGCATGG + Intronic
1027082548 7:75239885-75239907 CCCAAACAGAAATGCATTCAGGG + Intergenic
1027580717 7:79991545-79991567 CACATAATGAAATGTTTGCAAGG + Intergenic
1027593610 7:80144896-80144918 CAGATCAAGAAATGTATGCAAGG + Intronic
1027675438 7:81152060-81152082 TACAAACGGAACTATATGCAGGG + Intergenic
1028225854 7:88251526-88251548 CACAAGCAGAAATGGATAAATGG - Intergenic
1028235266 7:88353640-88353662 CACACACACAAATATATGCTTGG - Intergenic
1028557173 7:92136580-92136602 CACAAAAAGGAATGAATGAATGG + Intronic
1028571149 7:92288721-92288743 CACAAATCAAGATGTATGCATGG + Intronic
1029461829 7:100698875-100698897 AAAAAAAAGAAATGCATGCAAGG + Intergenic
1029874529 7:103735541-103735563 CACAACCAGAGATTTATGAATGG + Intronic
1031257171 7:119467885-119467907 CACAAATAGATATGCATGAAGGG + Intergenic
1031263086 7:119547945-119547967 AACAAAAAGATATGTATGCCTGG - Intergenic
1031740706 7:125426557-125426579 CACAAACACAAATCTATTCATGG - Intergenic
1031877784 7:127161554-127161576 CGCACACATAAGTGTATGCATGG - Intronic
1032367421 7:131313290-131313312 TATAAACAGACATGTATACATGG + Intronic
1032550934 7:132783581-132783603 CACAAAAACAAATGTTTACATGG - Intergenic
1032936767 7:136741668-136741690 CACACACACATATGTATGGAGGG + Intergenic
1032973378 7:137192296-137192318 CAAAAAAAGAAATGAATGAATGG - Intergenic
1034137910 7:148788497-148788519 CAAAAATACAAATGTATACAAGG - Intronic
1034293949 7:149955142-149955164 CTCCAACAGAAATGCATGCTAGG + Intergenic
1034812122 7:154141718-154141740 CTCCAACAGAAATGCATGCTAGG - Intronic
1035700482 8:1635484-1635506 CACATACACACATGTATACATGG - Intronic
1037608718 8:20458784-20458806 CGAAAAGAGAAATGAATGCAGGG + Intergenic
1038030708 8:23636729-23636751 CACAAACTGGAACATATGCAAGG + Intergenic
1039231576 8:35454446-35454468 CACAAAGGGAAATTTATGCCTGG - Intronic
1039869861 8:41536783-41536805 CACAAACTCAAATGTTTGCAGGG - Intronic
1040694162 8:49976316-49976338 CACAAACAGAAAGGATTGGATGG + Intronic
1041053760 8:53961672-53961694 GACAAGCAGAAATGTATGTGAGG - Intergenic
1041792047 8:61707605-61707627 AACACTCAGACATGTATGCATGG + Intronic
1043074227 8:75675596-75675618 CACAATCAGCAATGAATGAATGG + Intergenic
1043486773 8:80705588-80705610 CACACACACAAATGCATACACGG - Intronic
1044861866 8:96531819-96531841 CACACACATAAATATATGTAAGG - Intronic
1045708350 8:104954534-104954556 CACCTACAGAAATGGATGGAGGG + Intronic
1046865678 8:119147584-119147606 TACAAACAGACATGTGTGCAGGG - Intergenic
1047239277 8:123071798-123071820 AAAAAACAGAAATGTATTCTTGG - Intronic
1047529900 8:125665146-125665168 TCCTAACCGAAATGTATGCAGGG - Intergenic
1047763231 8:127969546-127969568 AACAAACAGGAATGTTTGAATGG - Intergenic
1048314897 8:133354673-133354695 CACAAACAGGAATCCAGGCAGGG + Intergenic
1050103633 9:2143729-2143751 CACAAAGAGAAATATTTGCTTGG + Intronic
1050733866 9:8740464-8740486 CACATTCTTAAATGTATGCAGGG + Intronic
1050775010 9:9248795-9248817 CACAAACTCAAATGCTTGCAGGG + Intronic
1051014633 9:12460221-12460243 CAGAGACAGAAAGGTAGGCAGGG - Intergenic
1051209923 9:14730526-14730548 CACCAACAGAAATGAGTGTAGGG + Intergenic
1052039029 9:23716992-23717014 ATCAGACAGAAATGTATGGAAGG + Intronic
1053524973 9:38819284-38819306 CACAGACACAAATGTGTACATGG - Intergenic
1053649575 9:40151916-40151938 CACACACAAATATGTATACATGG + Intergenic
1053756175 9:41312031-41312053 CACACACAAATATGTATACATGG - Intergenic
1054197204 9:62043699-62043721 CACAGACACAAATGTGTACATGG - Intergenic
1054330089 9:63743679-63743701 CACACACAAATATGTATACATGG + Intergenic
1054535006 9:66224288-66224310 CACACACAAATATGTATACATGG - Intergenic
1054641204 9:67544995-67545017 CACAGACACAAATGTGTACATGG + Intergenic
1054878796 9:70123736-70123758 CACAGAGAGAAATGTACACAGGG + Intronic
1055135993 9:72829556-72829578 TACATACATAAATGCATGCAGGG - Intronic
1055394042 9:75854465-75854487 CATAGACAGAGATGGATGCATGG - Intergenic
1055786925 9:79881257-79881279 TACCAACTGAAATGTAAGCAAGG + Intergenic
1057748860 9:97773773-97773795 GACACACAGAAAGGTAAGCAGGG - Intergenic
1059238203 9:112780165-112780187 AAAATACAGACATGTATGCATGG - Intronic
1059822349 9:117987141-117987163 TAGAAAGAGAAATGTATGTATGG - Intergenic
1060239816 9:121893338-121893360 CACACACACATATGCATGCATGG - Intronic
1060496009 9:124118928-124118950 CACATACCCACATGTATGCACGG - Intergenic
1060773831 9:126353844-126353866 CACACCCAGAGATGTATGAATGG - Intronic
1060895509 9:127214665-127214687 CATAAAGAGAAATGTAAACACGG - Intronic
1061347264 9:130036722-130036744 CCCAAACAGAAATCTCTGAAGGG + Intronic
1062252914 9:135607323-135607345 CACAAACAGAAATGTGTCTGTGG + Intergenic
1202797319 9_KI270719v1_random:135105-135127 CACACACAAATATGTATACATGG + Intergenic
1203585212 Un_KI270746v1:62448-62470 CACAAAAAGAAACTTTTGCATGG + Intergenic
1185547863 X:960158-960180 CAGAAACATAAAAGTTTGCATGG - Intergenic
1186046451 X:5541917-5541939 CACACACACACATGTGTGCATGG - Intergenic
1186432901 X:9520177-9520199 CACAAACTGGAATATGTGCATGG + Intronic
1186873911 X:13798457-13798479 TGCATACAGAGATGTATGCAGGG - Intronic
1188259177 X:28002252-28002274 AACAAACAAAAAAATATGCACGG - Intergenic
1188371868 X:29379236-29379258 CCCACACAGGAATGTATACATGG - Intronic
1189357365 X:40321138-40321160 CACAAAGATAAATGAATGGAGGG - Intergenic
1189380971 X:40501835-40501857 CAAAATCAGAAATCTATGCCGGG + Intergenic
1190503746 X:51104623-51104645 TACAAACAAGAATGTATGAAGGG + Intergenic
1190783363 X:53620399-53620421 AACAAATAAAAATGTTTGCAGGG - Intronic
1191837585 X:65480911-65480933 CACATACATAAAGGTATGCTAGG + Intronic
1191851138 X:65587359-65587381 GACAAACACAAAGGTATACAGGG - Intergenic
1192690082 X:73353656-73353678 CACGAGCACAAATGTGTGCATGG - Intergenic
1193576457 X:83203860-83203882 CAAAAGCAGACATGTATACAGGG - Intergenic
1193829455 X:86271297-86271319 TACAAATAGAAATTTAAGCAGGG - Intronic
1195120865 X:101750695-101750717 CACAAACATAAATTTATTTAAGG + Intergenic
1195525675 X:105887460-105887482 TACCAAGAGCAATGTATGCAGGG - Intronic
1196456039 X:115892424-115892446 GTGAAACAGAAATGAATGCAAGG + Intergenic
1196687291 X:118522444-118522466 CACAGTCAGAAGTGTAGGCATGG + Intronic
1197390752 X:125861007-125861029 CTGAGACAGAAATGTCTGCATGG - Intergenic
1197667470 X:129239378-129239400 AGCACACAGAGATGTATGCATGG + Intergenic
1197758146 X:130010477-130010499 GACAAACAGAAATGACTGTAAGG - Intronic
1197992619 X:132334360-132334382 CAAAAACAGAAATATAGGGATGG - Intergenic
1198036809 X:132808968-132808990 AACAAACAAAAATGAATGCCAGG - Intronic
1200735277 Y:6787425-6787447 CACATTAAGAAATTTATGCAGGG - Intergenic
1200818547 Y:7558105-7558127 CACACACAGAAAGATGTGCATGG + Intergenic