ID: 1179309968

View in Genome Browser
Species Human (GRCh38)
Location 21:40186573-40186595
Sequence GCTCTGGGCCGAGTGGTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179309961_1179309968 6 Left 1179309961 21:40186544-40186566 CCTGGCAGCAGGGTCAGTTTTAT No data
Right 1179309968 21:40186573-40186595 GCTCTGGGCCGAGTGGTCCTGGG No data
1179309957_1179309968 17 Left 1179309957 21:40186533-40186555 CCTGCAGCGGCCCTGGCAGCAGG No data
Right 1179309968 21:40186573-40186595 GCTCTGGGCCGAGTGGTCCTGGG No data
1179309960_1179309968 7 Left 1179309960 21:40186543-40186565 CCCTGGCAGCAGGGTCAGTTTTA No data
Right 1179309968 21:40186573-40186595 GCTCTGGGCCGAGTGGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179309968 Original CRISPR GCTCTGGGCCGAGTGGTCCT GGG Intronic