ID: 1179311905

View in Genome Browser
Species Human (GRCh38)
Location 21:40203509-40203531
Sequence GCATATTGCAGAAGCAGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 156}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179311893_1179311905 24 Left 1179311893 21:40203462-40203484 CCCTCCCCTACCCGTCACCCAGA 0: 1
1: 0
2: 2
3: 46
4: 360
Right 1179311905 21:40203509-40203531 GCATATTGCAGAAGCAGCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 156
1179311901_1179311905 6 Left 1179311901 21:40203480-40203502 CCAGAGCCTTGTTTTCTAGTACC 0: 1
1: 0
2: 0
3: 13
4: 91
Right 1179311905 21:40203509-40203531 GCATATTGCAGAAGCAGCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 156
1179311897_1179311905 18 Left 1179311897 21:40203468-40203490 CCTACCCGTCACCCAGAGCCTTG 0: 1
1: 0
2: 0
3: 15
4: 166
Right 1179311905 21:40203509-40203531 GCATATTGCAGAAGCAGCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 156
1179311900_1179311905 7 Left 1179311900 21:40203479-40203501 CCCAGAGCCTTGTTTTCTAGTAC 0: 1
1: 0
2: 0
3: 10
4: 156
Right 1179311905 21:40203509-40203531 GCATATTGCAGAAGCAGCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 156
1179311902_1179311905 0 Left 1179311902 21:40203486-40203508 CCTTGTTTTCTAGTACCCTGCGT 0: 1
1: 0
2: 0
3: 2
4: 84
Right 1179311905 21:40203509-40203531 GCATATTGCAGAAGCAGCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 156
1179311898_1179311905 14 Left 1179311898 21:40203472-40203494 CCCGTCACCCAGAGCCTTGTTTT 0: 1
1: 0
2: 0
3: 29
4: 200
Right 1179311905 21:40203509-40203531 GCATATTGCAGAAGCAGCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 156
1179311895_1179311905 20 Left 1179311895 21:40203466-40203488 CCCCTACCCGTCACCCAGAGCCT 0: 1
1: 0
2: 1
3: 15
4: 235
Right 1179311905 21:40203509-40203531 GCATATTGCAGAAGCAGCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 156
1179311896_1179311905 19 Left 1179311896 21:40203467-40203489 CCCTACCCGTCACCCAGAGCCTT 0: 1
1: 0
2: 1
3: 5
4: 160
Right 1179311905 21:40203509-40203531 GCATATTGCAGAAGCAGCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 156
1179311894_1179311905 23 Left 1179311894 21:40203463-40203485 CCTCCCCTACCCGTCACCCAGAG 0: 1
1: 0
2: 0
3: 33
4: 277
Right 1179311905 21:40203509-40203531 GCATATTGCAGAAGCAGCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 156
1179311899_1179311905 13 Left 1179311899 21:40203473-40203495 CCGTCACCCAGAGCCTTGTTTTC 0: 1
1: 0
2: 2
3: 24
4: 316
Right 1179311905 21:40203509-40203531 GCATATTGCAGAAGCAGCTCAGG 0: 1
1: 0
2: 0
3: 11
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179311905 Original CRISPR GCATATTGCAGAAGCAGCTC AGG Intronic
901123754 1:6914973-6914995 GCTTATTCTTGAAGCAGCTCCGG - Intronic
902242033 1:15095752-15095774 GTAATTTGCAGAAGCAGCTTAGG + Intronic
906718088 1:47985245-47985267 TCATAGTGCAGACTCAGCTCAGG - Intronic
907867683 1:58414283-58414305 TCATCCTGCAGAAGCAGCTCAGG + Intronic
909111799 1:71488428-71488450 TCAAATTGCAGAAACTGCTCTGG - Intronic
910257154 1:85259572-85259594 GCATACGGGAGCAGCAGCTCAGG - Exonic
910696641 1:90025453-90025475 GCATATTTAAGAAGCATTTCGGG - Intronic
911234493 1:95396713-95396735 GCATTTTGCAGAACCAGATGGGG + Intergenic
915894161 1:159798329-159798351 GCATCTTTCAGAAGCATCTATGG + Intergenic
916169385 1:161989158-161989180 GCATCTTGGAAAAGCAGCACAGG - Intronic
917074464 1:171189592-171189614 TCATTGTGCAGAAGCAGCTAGGG + Intronic
920582642 1:207125996-207126018 ACATAGTGCAGAGGCAGCCCAGG - Intronic
920699043 1:208203942-208203964 GCTTCTTGCAGTAGCAGCTTAGG - Intronic
921329795 1:214024165-214024187 GCAGATTGCAGAATGAACTCGGG - Intronic
924300023 1:242627535-242627557 GCATAGTGCAGTAGCTGCTTTGG - Intergenic
1068288738 10:54973441-54973463 GCTTGTTGCAGAAGCAACACTGG + Intronic
1070966208 10:80532844-80532866 GCATCTCTTAGAAGCAGCTCTGG - Exonic
1074711073 10:116177952-116177974 GGATATGGCAGAATTAGCTCAGG - Intronic
1084216912 11:67652486-67652508 GCATTTTGCAGAAGAAACCCTGG + Intergenic
1084571689 11:69963543-69963565 GGATTTTGCAGAACCAGATCAGG - Intergenic
1084892954 11:72245324-72245346 GCATACTGCAGATGGAGCTGAGG - Intronic
1088864434 11:113833951-113833973 TCACATTGCCTAAGCAGCTCAGG + Intronic
1090957733 11:131528506-131528528 GCATATTGGTGAAGCATCTGTGG - Intronic
1091078466 11:132643305-132643327 GCCTCTTGCTGAAGGAGCTCAGG + Intronic
1091104638 11:132907172-132907194 TCATATTGCAAAAGGAGCTGCGG - Intronic
1091254199 11:134169364-134169386 TCTGATTGCAGAAGCAGCTTTGG - Intronic
1095626841 12:44325211-44325233 GCATATTGTACAACCACCTCAGG + Intronic
1103235956 12:119372594-119372616 GCATTTTCCAGAAGCAGCTTTGG - Intronic
1105662099 13:22507925-22507947 GCATATATCAGACTCAGCTCTGG + Intergenic
1106073358 13:26435402-26435424 GCACACTCCAGAAGTAGCTCTGG - Intergenic
1109375501 13:61486648-61486670 GCATAGTGCGGTAGCAGCTCTGG + Intergenic
1109873552 13:68367498-68367520 GGAAATTGCAGAAGCCACTCTGG + Intergenic
1109959501 13:69612585-69612607 GCATAATGCAGAAGAGACTCAGG + Intergenic
1113720854 13:112554976-112554998 GGAAATTACAGAAGCAGCTCTGG - Exonic
1115600893 14:34954908-34954930 GCATTTTGCAGAAGTAAATCTGG + Intergenic
1115930729 14:38490154-38490176 GCATCTTGCAAAAGAAGCTGGGG + Intergenic
1120979131 14:90275575-90275597 GCAAACTGGAGAAGCAGCTGGGG - Exonic
1123999292 15:25741254-25741276 GCTTATTTCAGAAGGATCTCAGG + Intronic
1124238099 15:28006692-28006714 ACATATTGCATAAGTAGCACTGG - Intronic
1124545738 15:30625416-30625438 TCAGACTGCAAAAGCAGCTCAGG + Intronic
1124779257 15:32614802-32614824 TCAGACTGCAAAAGCAGCTCAGG + Intergenic
1125745170 15:41992815-41992837 GCAAATTCCAGGAGGAGCTCCGG - Exonic
1126309400 15:47298733-47298755 GGTTATTGCAGAAGGAGCTAAGG - Intronic
1128066857 15:64770564-64770586 GCATATAGCAGTAGGAGGTCAGG - Intronic
1129101688 15:73270809-73270831 GCAAACTGCAGAGGCAGCTTTGG - Intronic
1129700271 15:77763690-77763712 GCATGATGCAGATGCAGCCCTGG - Intronic
1130361725 15:83193895-83193917 GCGTATAGCAGCAGCAGCACAGG - Intronic
1130935415 15:88466446-88466468 GAATAAGGCAGAAGTAGCTCTGG - Intronic
1133572948 16:7059799-7059821 GCAGCTGGCAGAAGCAGCCCTGG - Intronic
1134330872 16:13250155-13250177 GCAATTTGCAGAAGAAGCTTTGG - Intergenic
1135606386 16:23828720-23828742 GAAGATTGCAGAGGTAGCTCAGG + Intergenic
1136552430 16:30988894-30988916 GCAGAGTGCAGAGGCGGCTCTGG + Exonic
1137396954 16:48122974-48122996 GCATGTGGCAGAAACAGCTGGGG + Intronic
1138833962 16:60410877-60410899 TCATATTGCACAAGGAGCTGTGG - Intergenic
1139546383 16:67651808-67651830 GCATCTTGCAGCAGCTGCTCTGG - Exonic
1140950540 16:79812701-79812723 GAATTTTGCAGGAGCAACTCAGG + Intergenic
1141422314 16:83925193-83925215 GCATAGCTCAGCAGCAGCTCAGG + Exonic
1143119713 17:4599265-4599287 CCTAATTGCAGAAACAGCTCTGG + Intronic
1143385310 17:6526014-6526036 GTGTGCTGCAGAAGCAGCTCTGG + Intronic
1144838332 17:18170084-18170106 GCTGACTGCAGAAGCAGATCTGG - Intronic
1153158692 18:2178700-2178722 GCATAATGCAGAAGCATCATAGG - Intergenic
1155605353 18:27599602-27599624 GCATATTAAAGAAGCAAGTCTGG - Intergenic
1159707525 18:71709963-71709985 ACATTTTGCAGCATCAGCTCAGG + Intergenic
1159997018 18:74975163-74975185 GCATATTTCAGCAGAAGCCCAGG - Intronic
1160329496 18:77978562-77978584 GCATATTATAGAAGCAACACGGG - Intergenic
1160329559 18:77978967-77978989 GCATATTATAGAAGCAACACAGG - Intergenic
1161099048 19:2411352-2411374 GTATACAGCAGAAGCAGCTTTGG - Intronic
1161675077 19:5641923-5641945 GCATGTTCCTGAAGCTGCTCCGG - Exonic
1161798907 19:6404441-6404463 GCATTTTGGTGAAGCAGGTCTGG + Intergenic
1163062754 19:14772267-14772289 GGATGCTGCAGAAACAGCTCTGG + Intronic
925551007 2:5074397-5074419 TCATCTTGCAGAGCCAGCTCTGG + Intergenic
925926027 2:8671324-8671346 GCTTAGTGCAGAAGCAGGTGAGG + Intergenic
930200499 2:48548261-48548283 GCATGTAGCAGAAGCAGCCAAGG - Intronic
931105817 2:59054116-59054138 ACATATTTCAGAAGCAAATCTGG - Intergenic
932851053 2:75187278-75187300 GCAGAGTGCAGTAGCACCTCAGG + Intronic
933581565 2:84132560-84132582 GCAGATGGCAGGAGCAGCTGTGG + Intergenic
934573812 2:95388244-95388266 GCGTTTCGCAGAAGCAGTTCTGG - Intergenic
935575150 2:104701533-104701555 GCATGTTGCTAAAGCAGCCCAGG - Intergenic
936263420 2:110981030-110981052 GCATATAGCAGGTGCAGCTTAGG + Intronic
937203318 2:120219763-120219785 GCATTTTGCAAAAGCTGCACTGG + Intergenic
942254613 2:174084205-174084227 TCATAATGCAGAAGCAGAGCTGG + Intronic
943265730 2:185729338-185729360 TTATATTCCAGGAGCAGCTCAGG + Intergenic
946681204 2:222218466-222218488 TCACCTTGCAGAAGCAGCTAGGG + Intronic
946876478 2:224134613-224134635 GCATGTTGAGGAAGCAGCCCAGG - Intergenic
948405450 2:237714791-237714813 GTATTTTGTAGAAGCAGCTGAGG + Intronic
1169023406 20:2347703-2347725 ACATATTGCAGAATCAGATGAGG - Intergenic
1169894440 20:10487825-10487847 GCATATTGCAGAAATATTTCAGG + Intronic
1175304184 20:57964775-57964797 GCATTTTTCAGAAGTAGGTCTGG + Intergenic
1176189240 20:63800084-63800106 CCAAACTGCAGAGGCAGCTCAGG + Intronic
1176372304 21:6069409-6069431 GGAGGTAGCAGAAGCAGCTCTGG - Intergenic
1177298027 21:19202402-19202424 CCAGATTGCAGAATCAGCTGTGG - Intergenic
1179311905 21:40203509-40203531 GCATATTGCAGAAGCAGCTCAGG + Intronic
1179376539 21:40854311-40854333 GCAGAATGAGGAAGCAGCTCAGG + Intergenic
1179751214 21:43469130-43469152 GGAGGTAGCAGAAGCAGCTCTGG + Intergenic
1184032244 22:41901957-41901979 GCATGCTGCAGAAGCACCTGTGG - Intronic
1184554892 22:45227813-45227835 CCCTAAAGCAGAAGCAGCTCCGG + Intronic
951383536 3:22015855-22015877 CCATCTTGCAGATGCAGCCCTGG - Intronic
952557627 3:34550951-34550973 GATCCTTGCAGAAGCAGCTCAGG + Intergenic
953297043 3:41729426-41729448 GCATTATGCAGTAGCAGCTTGGG - Intronic
954528081 3:51291139-51291161 GAATGTAGCAAAAGCAGCTCTGG + Intronic
958967008 3:100570342-100570364 CCTCATTGCTGAAGCAGCTCTGG + Intronic
959648668 3:108730501-108730523 ACATGTTGCAGAAGCAGCTGAGG - Intergenic
961237112 3:125376100-125376122 GCAGTATGCAGAAGCACCTCAGG - Intergenic
961319136 3:126060917-126060939 GCCTGTTGCAGAAGCTCCTCAGG - Intronic
964333645 3:155631814-155631836 GAATAATGCAGAAGCACCTGTGG + Intronic
964921816 3:161906230-161906252 CCATTTTGAAGAAGCATCTCAGG - Intergenic
969458680 4:7315739-7315761 GCAGATGGCAGAAGCAGCCAAGG - Intronic
969720381 4:8890256-8890278 CCATTTTACAGAAGCAGCTCAGG + Intergenic
971714257 4:30154922-30154944 TCATATTGCAGAAGAGGATCAGG - Intergenic
972429265 4:38964664-38964686 GCAGATTGTAGAAGCTGCACAGG + Intergenic
972933558 4:44104339-44104361 GCACATTGCACCAGCAGCTCAGG + Intergenic
973659014 4:53083182-53083204 CAATATTTCAAAAGCAGCTCTGG + Intronic
974088272 4:57284042-57284064 GCACATTGCAGAGCCAGCACAGG + Intergenic
975584341 4:75935782-75935804 CCATATTCCAGAAGCAGCCTGGG + Intronic
976844598 4:89473685-89473707 GCTTATTGCAGAAGCAGAGGGGG - Intergenic
979691089 4:123559280-123559302 CCATTTTGCAGATGAAGCTCAGG + Intergenic
981699773 4:147595879-147595901 GCACCGTGCAGAAGCAGCACTGG + Intergenic
983561202 4:169103405-169103427 GCAAAATGCAGAAGGAGCCCAGG - Intronic
983846535 4:172526939-172526961 ACATAGTGCAGCACCAGCTCTGG - Intronic
983989208 4:174097379-174097401 GCACACTGCAGAAGTAGCTCTGG + Intergenic
986759415 5:10866438-10866460 GCATCTTACAGAAGCATCTGTGG - Intergenic
990973282 5:61533458-61533480 GCATATTGAACAAGCACCTCTGG + Intronic
991999055 5:72417706-72417728 CCATAAAGCAGCAGCAGCTCAGG + Intergenic
993020727 5:82587146-82587168 GCCTCATGCAGAAGCAGCTGTGG + Intergenic
994451403 5:99949537-99949559 GCTTCATGCAGCAGCAGCTCAGG + Intergenic
994821132 5:104652516-104652538 GCACAATGCAGCAGCTGCTCAGG - Intergenic
996127384 5:119741889-119741911 GCATATTGCATAAGCACATATGG + Intergenic
996399283 5:123043675-123043697 GCTGATTGCTGAAGGAGCTCAGG - Intergenic
998056009 5:139078026-139078048 CCATATTGCACAAGTGGCTCAGG - Intronic
998238788 5:140423694-140423716 GTATATTGCATAAACATCTCAGG + Intronic
999881432 5:155868812-155868834 GAATATGGGAGAAGCAGGTCAGG + Intergenic
1001984276 5:176060867-176060889 GCAGTTTGCAGTTGCAGCTCAGG - Intronic
1002196124 5:177502579-177502601 GCATATTGGGGAAACAGGTCGGG - Intronic
1002233200 5:177783198-177783220 GCAGTTTGCAGTTGCAGCTCTGG + Intronic
1002262779 5:178006583-178006605 GCAGTTTGCAGTTGCAGCTCAGG - Intronic
1002438681 5:179251788-179251810 GCTGTGTGCAGAAGCAGCTCTGG + Intronic
1002576168 5:180175317-180175339 GCATTTTCCAGAAGCTCCTCTGG - Intronic
1005513580 6:26533580-26533602 GCATTTTTAAGAAGCAACTCTGG - Intergenic
1007055371 6:38877941-38877963 GCAGTTTCTAGAAGCAGCTCAGG + Intronic
1007796220 6:44350149-44350171 GGATATTTAAGAAGCACCTCAGG - Intronic
1012535189 6:100287565-100287587 CCATATTGGAGAGGCAGCTGGGG + Intergenic
1019107869 6:169683963-169683985 GCATGTTGGAGAGGCAGCTCTGG - Intronic
1019555094 7:1625314-1625336 GCATGTTGCAGGGCCAGCTCGGG - Intergenic
1019918332 7:4147671-4147693 TTACATTGCAGAAGCACCTCGGG - Intronic
1021592669 7:22280798-22280820 TCATACTGCAGCATCAGCTCAGG - Intronic
1022323998 7:29313472-29313494 GAAAAATGCAGAAGCAGCCCTGG + Intronic
1028190217 7:87840361-87840383 GTATATTGAATAAGCACCTCAGG + Intronic
1030074373 7:105723778-105723800 GCATAATGGAGCAGCAGCTTGGG - Intronic
1035138912 7:156737559-156737581 GAATATTAGAGAACCAGCTCAGG - Intronic
1037943519 8:22972579-22972601 GGGAAGTGCAGAAGCAGCTCAGG - Intronic
1038023201 8:23567473-23567495 ACATATTGCAGAAACAGTGCAGG - Intronic
1038056087 8:23859086-23859108 GCTTATTACAGAAACAACTCTGG + Intergenic
1040420817 8:47239059-47239081 GCACAGGGTAGAAGCAGCTCAGG + Intergenic
1041856194 8:62458173-62458195 GCCTGTTTCAGAAGCAGCTGGGG - Intronic
1042117707 8:65450259-65450281 GCATTTTGGAGAAGCTTCTCAGG - Intergenic
1044935937 8:97293374-97293396 GCATATTATAGAAGAAGCTGGGG + Intergenic
1049087806 8:140491703-140491725 GCAGATTCCAGACGCACCTCAGG - Intergenic
1049312715 8:141941978-141942000 GCACATCCCAGAAGCAGCTTGGG + Intergenic
1049843322 8:144787808-144787830 GTTTGTTCCAGAAGCAGCTCAGG - Intergenic
1050837916 9:10107421-10107443 GAATTTTACAGAAGCAGCCCTGG + Intronic
1057036238 9:91813650-91813672 GAATCTTCCAGAAGCTGCTCTGG - Intronic
1185845439 X:3433397-3433419 CCATCTTGCAGACGCAGCTGTGG + Intergenic
1186083734 X:5963033-5963055 TAAAAATGCAGAAGCAGCTCTGG + Intronic
1187687548 X:21830694-21830716 GCCTGTTACAGCAGCAGCTCTGG - Intergenic
1190902772 X:54694760-54694782 GCATTTTGCAGATAAAGCTCAGG - Intergenic
1195009282 X:100719544-100719566 ACATATTGCAGGAGGAGGTCAGG - Intronic
1196641641 X:118069022-118069044 GCAGAGTGCAGATTCAGCTCAGG - Intronic
1200140594 X:153900937-153900959 GATTATTGCAGCAGCTGCTCCGG - Intronic