ID: 1179314398

View in Genome Browser
Species Human (GRCh38)
Location 21:40228789-40228811
Sequence CCTATTAGAAACCAAGATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 663
Summary {0: 1, 1: 2, 2: 20, 3: 128, 4: 512}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179314395_1179314398 0 Left 1179314395 21:40228766-40228788 CCTGGTTCATTTTATTGGAAAAT 0: 1
1: 16
2: 91
3: 267
4: 852
Right 1179314398 21:40228789-40228811 CCTATTAGAAACCAAGATTTGGG 0: 1
1: 2
2: 20
3: 128
4: 512

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179314398 Original CRISPR CCTATTAGAAACCAAGATTT GGG Intronic
901343949 1:8521895-8521917 CCTATTGGACATCAAGCTTTTGG - Intronic
903386840 1:22932646-22932668 CCTCTTAGAAACCAAATTTCTGG + Intergenic
904100542 1:28022936-28022958 GGTATTCAAAACCAAGATTTGGG - Intronic
904320268 1:29692955-29692977 GATATTAGAAACCAAGATTTGGG + Intergenic
904345179 1:29863314-29863336 AGTATTAGAAACCAAGATCTGGG - Intergenic
904406518 1:30293758-30293780 GATATAAGAAACCAAGATCTGGG - Intergenic
905086279 1:35380624-35380646 CATATTAAAAACCAATTTTTCGG - Intronic
905487235 1:38310745-38310767 AGTATTAGAAACCAAGATCTAGG + Intergenic
905512906 1:38536931-38536953 CCAATTAGAAAGCCAGATTGAGG + Intergenic
905628178 1:39502448-39502470 AGATTTAGAAACCAAGATTTGGG - Intronic
906758656 1:48348630-48348652 TCTTTTAGAAACCAAGATCTGGG + Intronic
906833132 1:49056037-49056059 ACTTTTAGAAGCCCAGATTTGGG - Intronic
907014102 1:50994463-50994485 AGTATTAGAAACCAAGATCTGGG - Intergenic
907071280 1:51537432-51537454 GTATTTAGAAACCAAGATTTGGG + Intergenic
908011271 1:59779707-59779729 GGTATCAGAAACCAAGATCTGGG + Intergenic
908303731 1:62789511-62789533 ATTCTTAGAAACCAAGATCTGGG + Intronic
909614924 1:77597000-77597022 GGTATTAGAAACCAAAATTTGGG - Intronic
909830269 1:80180075-80180097 AATATTAGAAACCAAAATTTGGG - Intergenic
910300486 1:85701394-85701416 CCTTTCAGAAGTCAAGATTTTGG - Intronic
910866726 1:91795171-91795193 ACTGTTTGAAAACAAGATTTTGG - Intronic
911419460 1:97621669-97621691 GGTATTAGAAATCAAGATCTGGG - Intronic
911474193 1:98356213-98356235 GCTATTGGAAAACAAGAATTGGG + Intergenic
911989162 1:104670310-104670332 CTTATTAGATACCTAGATTCTGG - Intergenic
912111793 1:106351309-106351331 AGTATTAGAAACAAAGATCTGGG - Intergenic
912613485 1:111073335-111073357 AGTATTAGAAATCATGATTTGGG + Intergenic
913142293 1:115953541-115953563 CCTTCTAAAAACCAAGTTTTGGG + Intergenic
914257570 1:145973149-145973171 TGTATGAGAAACCAAGATCTGGG + Intronic
914324289 1:146596326-146596348 GCATTTAGAAACCAAGCTTTGGG - Intergenic
915034981 1:152914405-152914427 GGTATTAGAAACCAAGAACTTGG + Intergenic
916257045 1:162799461-162799483 GTTATTAGAAACCAAGATCTGGG + Intronic
916332220 1:163629576-163629598 AGTATTAGAAACCAAGATCTGGG + Intergenic
916478178 1:165189906-165189928 GATATTAGAAACCAAGATCTAGG + Intergenic
917540754 1:175911682-175911704 CCTATTAGAAATGCAAATTTAGG - Intergenic
918792895 1:188853514-188853536 GGTATTGGAAACCAAGATCTGGG + Intergenic
918928828 1:190825987-190826009 GGTATTAGAAACCAAGAACTGGG - Intergenic
919300621 1:195759008-195759030 GATGTTAGAAATCAAGATTTGGG - Intergenic
919572999 1:199271701-199271723 GCCATTAGAAACCAAGAAATTGG + Intergenic
919713904 1:200755181-200755203 GGTATTAGAAACCAAGATACAGG + Intronic
921969039 1:221124706-221124728 GGTATTAGAAAGCAAGATCTTGG + Intergenic
922007547 1:221547359-221547381 AGTATTAGAAGCCAAGATATGGG - Intergenic
922301435 1:224304650-224304672 CATATTAGAAACAAAGAGGTAGG + Intronic
922403626 1:225287679-225287701 GGTATTAGAAACCAAGATCTGGG - Intronic
923195755 1:231665701-231665723 CCTATTAGTAGGTAAGATTTTGG + Intronic
924918615 1:248601927-248601949 GCATTTAGAAACCAAGATCTAGG - Intergenic
1062835776 10:634903-634925 CCAATTAGAAATAAGGATTTAGG - Intronic
1063018684 10:2104324-2104346 GGTATTAGAAACCAAGATCTGGG - Intergenic
1063043704 10:2370974-2370996 GGTGTTAGAAATCAAGATTTGGG - Intergenic
1063293511 10:4776938-4776960 GGTATTAGAAACCAAGATCTAGG - Intergenic
1063697465 10:8350805-8350827 CCTGTCTGAAAGCAAGATTTTGG + Intergenic
1063799643 10:9559738-9559760 TCTATTAAATAGCAAGATTTTGG - Intergenic
1064199544 10:13273035-13273057 ACTGTTGGAAACCAAGATCTGGG - Intergenic
1064480256 10:15733638-15733660 GGTATTAGAAACCAAGATCTGGG - Intergenic
1064624439 10:17247966-17247988 TCTATAAGAAACCAAACTTTGGG + Intergenic
1066339639 10:34518343-34518365 GGTATTAGAAACCACGATCTGGG - Intronic
1066510018 10:36084740-36084762 AATACTAGAAACCAAGATCTGGG + Intergenic
1066691668 10:38034822-38034844 GGTATTAGAAACCAAGATAGGGG + Intronic
1066723504 10:38365153-38365175 GTTATTAGAAACCAAGATCTGGG + Intergenic
1067001035 10:42613837-42613859 GGTATTAGAAACCAAGATAGGGG - Intronic
1067049488 10:43004511-43004533 GGTATTAAAAACCAAGATATGGG + Intergenic
1067196560 10:44124705-44124727 GGTTTTAGAAACCAAGATATGGG + Intergenic
1067671480 10:48326513-48326535 GGTATTAGAAACAAAGATCTAGG + Intronic
1068000892 10:51332759-51332781 CCTAGAAGGAACCACGATTTGGG + Intronic
1068143283 10:53032139-53032161 AATATTAAAAATCAAGATTTAGG - Intergenic
1068170738 10:53390699-53390721 TCTATGAGCAACCAAAATTTAGG - Intergenic
1068646050 10:59469756-59469778 AGTATTAGAAACCAAGATTTGGG - Intergenic
1068982859 10:63079666-63079688 GGTATTAGAATCCAAGATCTGGG - Intergenic
1069668309 10:70180125-70180147 GGTATTAGAAACCAAGATCTGGG - Intergenic
1069846844 10:71378023-71378045 CCTAGTAGGAACACAGATTTAGG - Intergenic
1069941618 10:71959939-71959961 ACTATTAGAGGCCAGGATTTAGG - Intergenic
1070242927 10:74701402-74701424 GGTATTAGAGACCAAGATCTGGG - Intronic
1070913160 10:80135637-80135659 GCTAAAAGAAACCAAGACTTGGG - Intronic
1071012762 10:80956957-80956979 AGTTTTAGAAACCAAAATTTTGG - Intergenic
1072320263 10:94242609-94242631 GGTATTAGAAACCAAGATCTGGG - Intronic
1072749514 10:97967451-97967473 GGTATTAGAAACCAAGATCTGGG + Intronic
1072875115 10:99164532-99164554 ATATTTAGAAACCAAGATTTAGG + Intronic
1073024717 10:100479464-100479486 CATCTTAGAAAACAACATTTTGG - Intronic
1073122288 10:101130159-101130181 CCTTTTAGAAGCCAAGCTTTGGG - Intronic
1073697323 10:105884711-105884733 GCTATTAGAAACCAAGATCTAGG + Intergenic
1074218582 10:111412481-111412503 GATATTAGAAACCAAGACCTGGG + Intergenic
1074261584 10:111859006-111859028 GGTATTAGAAACCAAAATCTGGG + Intergenic
1074304767 10:112266679-112266701 ATTATTAGAAACCATTATTTTGG - Intergenic
1074365653 10:112855508-112855530 CCAATTAAAAACCAAGAAATAGG + Intergenic
1074643287 10:115413805-115413827 CATATTAGAGACCAAGATCTTGG + Intronic
1074653868 10:115559337-115559359 AATATTAGAAAACAAGATCTGGG - Intronic
1074956142 10:118391990-118392012 GGTATTGGAAACCAAGATCTAGG + Intergenic
1075300918 10:121323358-121323380 CCAAGTCTAAACCAAGATTTGGG - Intergenic
1075372446 10:121949466-121949488 CCCATTAGAAAAGAAGATTCAGG + Intergenic
1075386541 10:122059397-122059419 CTTATTACAAACACAGATTTAGG - Intronic
1076989138 11:260656-260678 GGTATTAGAAACCAAGATCTGGG + Intergenic
1077730012 11:4720642-4720664 CTTATTAAAAACTATGATTTTGG + Intronic
1077948674 11:6930230-6930252 GGTATTAGAAACCAAGATCTGGG + Intronic
1077957278 11:7034461-7034483 ACAGTTAGAAACCAAAATTTGGG + Intronic
1078635936 11:13050083-13050105 GGTATTAGATACCAAGATCTGGG + Intergenic
1079903349 11:26215588-26215610 ATTATTAGAAACCAAGATCTAGG + Intergenic
1079990799 11:27244407-27244429 GGTATTAGAAACCAAGATCTGGG - Intergenic
1081004463 11:37717863-37717885 GGTATTAGAAACCAAGGTTTGGG - Intergenic
1081437789 11:43046367-43046389 TCTTTTATGAACCAAGATTTGGG + Intergenic
1082984369 11:59155158-59155180 GGCATTAGAAACCAAGATCTAGG + Intergenic
1084194304 11:67515532-67515554 GGTATTAGACACCAAGATCTGGG - Intergenic
1086281576 11:85195455-85195477 CCAAGTAGAAACCTAGAATTGGG + Intronic
1086289180 11:85286764-85286786 AGTATTACAAACCAAGATCTGGG - Intronic
1086413072 11:86561348-86561370 GGTATTAGAAGGCAAGATTTGGG + Intronic
1086522432 11:87685033-87685055 GGCATTAGAAACCAAGATCTTGG + Intergenic
1087236322 11:95722913-95722935 GGTATTAGAAACCAAGATCTGGG - Intergenic
1087340456 11:96899033-96899055 GCTATTAGAAACCAATATATGGG + Intergenic
1087425593 11:97981922-97981944 CCTAGAAGAAAACATGATTTAGG - Intergenic
1087532193 11:99397824-99397846 GGTATTAGAAACCTAGATCTGGG + Intronic
1088203909 11:107370687-107370709 CCTGTCAGCAACCAAAATTTAGG + Intronic
1088650624 11:111955073-111955095 GTTTTTAGAAAGCAAGATTTGGG - Intronic
1089035659 11:115387868-115387890 GGTATTAGAAACCAATATTGGGG - Intronic
1091348320 11:134870990-134871012 GACATTAGAAACCAAGATCTGGG + Intergenic
1091799505 12:3316043-3316065 CCTCTTAGACCCCAACATTTGGG - Intergenic
1091922279 12:4314927-4314949 TTTATTTGAAAACAAGATTTGGG + Intergenic
1093164071 12:15785659-15785681 GGTGTTAGAAACCAAGATCTGGG - Intronic
1094803050 12:34060477-34060499 GGCATTAGAAATCAAGATTTGGG - Intergenic
1095225665 12:39674353-39674375 CCTTTTAAAAATCATGATTTTGG + Intronic
1095485271 12:42678244-42678266 CTTATTACAAATCAACATTTTGG - Intergenic
1095564173 12:43601439-43601461 CCTATTTAAAACAATGATTTTGG - Intergenic
1096061989 12:48709150-48709172 CCTATTAGAAACTAAAAGTATGG + Intronic
1096400269 12:51300136-51300158 CCTATTAGAAAGTGAAATTTGGG - Intronic
1097160448 12:57042984-57043006 CATCTCAGAAACCAAGATATAGG + Intronic
1097644125 12:62215807-62215829 CAAATAAGAAACCAAGATTCAGG - Intronic
1098096181 12:66958555-66958577 GGTATTAGGAACCAAAATTTGGG + Intergenic
1098334497 12:69389105-69389127 CCTATTTGAAAAAAAGATATTGG + Intronic
1098349105 12:69538983-69539005 TGTATTAGAAACCAAGATTTGGG - Intronic
1098652795 12:72994138-72994160 GATATTAGAAACCAATATCTGGG + Intergenic
1098705068 12:73676804-73676826 GGTATTTGAAACCAAGATCTGGG - Intergenic
1098760960 12:74424717-74424739 GATATTACAAACCAAGATCTGGG + Intergenic
1099117637 12:78647476-78647498 CCTATTAGAAACCAAATTTGGGG + Intergenic
1099572555 12:84342545-84342567 GGTATTAGAAACTAAGTTTTTGG + Intergenic
1099585976 12:84514043-84514065 GCTATTAGAAATCAAGTGTTAGG + Intergenic
1099648125 12:85386670-85386692 ACTATTAAAAACTAAGAATTTGG - Intergenic
1099832830 12:87867143-87867165 CATATTAAAAACCAAGATTTGGG - Intergenic
1100512516 12:95290670-95290692 GCATTTAGAAACCAAGATTAGGG + Intronic
1100629991 12:96378525-96378547 GGTGTTAGAAACCAAGATCTGGG + Intronic
1100961251 12:99965118-99965140 GCCATTAGAAGCTAAGATTTGGG - Intronic
1101808626 12:108088511-108088533 GGTATTAGTAACCAAGATCTGGG - Intergenic
1101957670 12:109225101-109225123 CCTGTTAGAAACAAAGAGTGAGG - Intronic
1102826310 12:115950413-115950435 CCATTTAGAAACCAAGATGGAGG - Intergenic
1102896820 12:116604811-116604833 CTTATTAAAAACACAGATTTGGG - Intergenic
1104017933 12:124972762-124972784 CCCTTCAGAAACCAGGATTTTGG - Intronic
1104184439 12:126416261-126416283 GGTATTAGAGACCAAGATCTGGG - Intergenic
1104305715 12:127609369-127609391 AATATTACAAACCAAGATCTGGG + Intergenic
1105632331 13:22182642-22182664 GGAATTAGAAACCAAGATTTTGG + Intergenic
1105644788 13:22304982-22305004 GATATTAAAAACCAAGATCTGGG + Intergenic
1105703373 13:22950509-22950531 GGCATTAGAAACCAAGATGTGGG + Intergenic
1105707292 13:22976082-22976104 AGTATTAGAAGCCAAGATCTGGG + Intergenic
1105770880 13:23610701-23610723 CCTGTTAGATACCAGGCTTTTGG + Intronic
1105856019 13:24372666-24372688 AGCATTAGAAACCAAGATGTGGG + Intergenic
1107472234 13:40701911-40701933 ACATTTAGAAACCAAGATATGGG - Intergenic
1107697007 13:43010217-43010239 GTATTTAGAAACCAAGATTTGGG + Intergenic
1107734398 13:43382876-43382898 CCTAGTTGAAACCAAGACCTTGG - Intronic
1108765851 13:53628618-53628640 CCTATTGGAAACAAAGAAATGGG - Intergenic
1109036813 13:57273500-57273522 TATGTTAGAAACCAAGATTTGGG - Intergenic
1109885287 13:68534076-68534098 CTACTTAGAAACCAAGATCTAGG + Intergenic
1109979351 13:69886198-69886220 CTTATTATAAAGAAAGATTTTGG + Intronic
1110221452 13:73078794-73078816 GGTATTAGAAACCAAGATCTAGG - Intergenic
1110310547 13:74044330-74044352 GGTATTAGAAACCAAGATCTGGG - Intronic
1110338461 13:74360733-74360755 GGTATTAGAAACCAAGATCTAGG + Intergenic
1110366030 13:74686740-74686762 GGTATTAGAAACCAAAATCTGGG - Intergenic
1110930112 13:81205109-81205131 AGTATTAAAAAACAAGATTTGGG - Intergenic
1110985583 13:81963434-81963456 CATATTACAAACCAAAATTTGGG - Intergenic
1111068652 13:83133076-83133098 CAAATTAGAAATAAAGATTTGGG + Intergenic
1111434464 13:88188646-88188668 CGTATTAGAAACCAAGTGTTGGG - Intergenic
1111550237 13:89799835-89799857 CCTACTAGAAAACACCATTTTGG - Intergenic
1111589037 13:90320158-90320180 GCTATTAGAACCCAAGATCTGGG - Intergenic
1111887702 13:94043210-94043232 GGTATTAGAAACCAAGGTCTGGG + Intronic
1112316579 13:98368384-98368406 CCTTCAAGAAACCAAGTTTTAGG - Intronic
1114688458 14:24557649-24557671 CCTATTAGGTACCAAGGGTTGGG + Intergenic
1114827330 14:26096966-26096988 GCTATTAGAAACTTTGATTTGGG + Intergenic
1115773453 14:36689713-36689735 CTTATTAGAAATCAAAATTGAGG + Intronic
1115828181 14:37300949-37300971 AGTATTAGAAACCAAGATCTGGG + Intronic
1115883135 14:37942940-37942962 AGTATTTAAAACCAAGATTTGGG + Intronic
1116049472 14:39785572-39785594 CCTATTAGTAATTAAGTTTTAGG - Intergenic
1116224914 14:42137887-42137909 GGTATTAGAAACCAAAATCTGGG + Intergenic
1117200354 14:53383793-53383815 CCATTTAGAAACCAAGAATGAGG - Intergenic
1117412058 14:55459148-55459170 CATGTTAGCTACCAAGATTTGGG - Intergenic
1117414553 14:55481707-55481729 GATATTCGAAACCAAGATCTGGG - Intergenic
1119011949 14:71002263-71002285 CCTACCAGATACTAAGATTTGGG - Intronic
1119028510 14:71173273-71173295 AGTACTAGAAACCAAGATCTGGG + Intergenic
1119735941 14:76982129-76982151 GCATTTGGAAACCAAGATTTGGG - Intergenic
1119754846 14:77109065-77109087 GCATTTAGAAACCAAGATCTGGG + Intronic
1120093962 14:80366654-80366676 GGTATTAGAAACCAAGATCCAGG - Intronic
1120225058 14:81781463-81781485 AGTATTAGAAACCAAGATTTGGG + Intergenic
1120555612 14:85926892-85926914 TTTATTAAAAAGCAAGATTTTGG + Intergenic
1120579275 14:86226177-86226199 CATATGAGAAACCAAGAATCAGG - Intergenic
1120716134 14:87842578-87842600 AGTACTAGAAACCAAGATTTAGG + Intronic
1120924433 14:89783371-89783393 CTTATTAAAAACCAATGTTTAGG - Intergenic
1121071069 14:91021909-91021931 CTTAATAGAAACCAAGATCTGGG + Intronic
1121260532 14:92562813-92562835 GATATTAGAAACCAAGATCTGGG + Intronic
1121921627 14:97887542-97887564 CCTATCAGAATCCTAAATTTAGG - Intergenic
1122250245 14:100433923-100433945 GCATTTAGAAACCAAGATTTTGG + Intronic
1122807846 14:104269657-104269679 CCCATTAGACACCAAGACCTGGG + Intergenic
1124109026 15:26770257-26770279 CCTATTATAAACAAATATTGAGG - Intronic
1124181958 15:27484585-27484607 GATATTAGAAACCAAGATCTGGG - Intronic
1124199886 15:27670140-27670162 GCGATTAGAAACCAAGGTCTGGG - Intergenic
1125683956 15:41551617-41551639 GGTATTAGAAACCGAGATCTGGG + Intergenic
1125763550 15:42116651-42116673 GCTATTAGAAGCCAAGATCTGGG + Intergenic
1126314086 15:47349720-47349742 CCTAATAGAAAAACAGATTTTGG + Intronic
1126434346 15:48620808-48620830 AGTATTAGCAACCAAGATCTAGG - Intronic
1126540803 15:49820991-49821013 GGTATTAGAGACCAAGATTTAGG + Intergenic
1126587163 15:50300256-50300278 CCTATTAAAAAACAGAATTTGGG + Intronic
1126824463 15:52535420-52535442 GGTATTAGAAACCAAGATTTGGG + Intergenic
1127051921 15:55092777-55092799 AGAATTAGAAACCAAGATCTGGG - Intergenic
1127273284 15:57420227-57420249 GGTATTAGAGACCAAGATCTGGG + Intronic
1127730377 15:61796116-61796138 ACATTTAGAAACCAAGATGTGGG + Intergenic
1128807914 15:70547056-70547078 CATATCAGAATCCAAGATCTGGG - Intergenic
1128851506 15:70962464-70962486 AGTATTAGAAACAAAGATCTGGG - Intronic
1130216918 15:81980482-81980504 GGTATTAGAAACCAAGATATGGG + Intergenic
1130749889 15:86700413-86700435 AGTATTATAAACCAAGATGTAGG + Intronic
1130873331 15:87990220-87990242 CCTATTAGGAACCCAGATAGGGG + Intronic
1131315292 15:91330246-91330268 GGTATTGGAAATCAAGATTTTGG + Intergenic
1131742237 15:95405806-95405828 CCTATTAGAAAACTAAATGTTGG - Intergenic
1131753301 15:95533340-95533362 GATATTAAAAACCAAGATCTGGG - Intergenic
1132361204 15:101217457-101217479 GGTATTAGAAAGCAAGACTTGGG - Intronic
1134033506 16:11011606-11011628 GGTATTAGAGGCCAAGATTTGGG + Intronic
1134075627 16:11289368-11289390 GGTATTAGAAACCAAGATCAGGG + Intronic
1134324551 16:13195134-13195156 AATATTAGAAACCAAAATCTAGG - Intronic
1135513447 16:23109239-23109261 GGTATTAGAAACCAAGATATGGG - Intronic
1137528449 16:49259939-49259961 GGTATTAGAAACCAAGATCTGGG - Intergenic
1138129116 16:54464093-54464115 GGTATTAGAAACCAAGATTAGGG - Intergenic
1138639589 16:58373705-58373727 CCAGTTAGAAGCAAAGATTTAGG + Intronic
1139098988 16:63743425-63743447 AGTATTAGAAACCAAGATCAGGG - Intergenic
1140009271 16:71114518-71114540 GCATTTAGAAACCAAGCTTTGGG + Intronic
1140493319 16:75360192-75360214 AATATTAGAAACCAAAATCTGGG - Intronic
1142281720 16:89152173-89152195 CCTGTTAGAAACCGAGACGTTGG + Intronic
1143865898 17:9923308-9923330 CCCATAAGAAGCCTAGATTTCGG - Intronic
1144335113 17:14261670-14261692 CCTTTTATAAATCAAGATTATGG - Intergenic
1144416753 17:15055248-15055270 GGTATTAGAAACCAAGATCTGGG - Intergenic
1144492477 17:15725738-15725760 GGTATCAGAAACCAAGATCTGGG - Intergenic
1144593754 17:16547662-16547684 CTATTTAGAAACCAAGATCTGGG - Intergenic
1144907997 17:18653449-18653471 GGTATCAGAAACCAAGATCTGGG + Intronic
1145256699 17:21328433-21328455 CCTATTAGAAAACAAGCGTCAGG - Intergenic
1145319913 17:21759515-21759537 CCTATTAGAAAACAAGCATCAGG + Intergenic
1146007450 17:29169567-29169589 CCTACCATAAACCAAGATGTGGG + Intronic
1146026418 17:29325543-29325565 CCATATAGAAACCAAGATATCGG + Intergenic
1147333734 17:39714585-39714607 CATAATAAAAACCAACATTTAGG - Intronic
1149378887 17:56072927-56072949 CATATTAGAAAGCAGGATTTTGG + Intergenic
1149619151 17:58029124-58029146 GGTATTAGAAACCAAGATCTGGG - Intergenic
1149811542 17:59678699-59678721 GGCATTAGAAACCAAGATCTGGG + Intronic
1150459780 17:65340001-65340023 GGTATTAGAAACCATGATCTGGG - Intergenic
1151792729 17:76319346-76319368 GTATTTAGAAACCAAGATTTGGG - Intronic
1152419904 17:80186858-80186880 CCTTTTAGAGAACAAGATGTGGG + Intronic
1155320444 18:24613688-24613710 CTTATTCGACACCAAGTTTTTGG + Intergenic
1155604669 18:27591317-27591339 TCTACTAGAAACCAGGTTTTAGG + Intergenic
1155657155 18:28205737-28205759 CCTATTAAAGACAAGGATTTGGG - Intergenic
1156013533 18:32521952-32521974 GGTATTAGAAACCAAGACTTGGG + Intergenic
1156319239 18:36003011-36003033 GCTATTAGAAAAGAGGATTTGGG - Intronic
1156945343 18:42822798-42822820 CCTATTTGAAAATAAGAATTGGG + Intronic
1157155735 18:45263918-45263940 GCATTTAGAAACCAAGATCTGGG + Intronic
1157837616 18:50921481-50921503 CCTACTAAAAACCTAGTTTTAGG - Intronic
1158083313 18:53619770-53619792 GTTATTAGAAAACAAAATTTTGG - Intergenic
1158844846 18:61430917-61430939 GGTATTGGAAACCAAGATCTGGG + Intronic
1159139434 18:64374947-64374969 TCTACTAGAAAACAAGTTTTAGG - Intergenic
1159280559 18:66279402-66279424 CCTAGAACAAACCAAAATTTGGG - Intergenic
1159298987 18:66537754-66537776 AGTATTAGAAAGCAAGATCTAGG + Intronic
1159701715 18:71637353-71637375 AGTATTAAAAACCAAGATTGAGG - Intergenic
1160380207 18:78448797-78448819 CCTATTAGAAACCATGATTTGGG - Intergenic
1160411602 18:78678746-78678768 TTTATTAGAAAACAAGGTTTTGG - Intergenic
1163531728 19:17853936-17853958 ACGGTCAGAAACCAAGATTTGGG + Intergenic
1164955088 19:32376356-32376378 GGTATCAGAAACCAAGATTTGGG - Intronic
925520792 2:4742725-4742747 GGTATTAGAAGCCAAGATCTGGG - Intergenic
925666945 2:6267932-6267954 GATATTAAAAACCAAGATCTGGG - Intergenic
925966166 2:9068339-9068361 GGTATTAGAAACCAATATCTGGG + Intergenic
926555764 2:14356083-14356105 TATGTTAGAAACCAAGATCTGGG - Intergenic
926856774 2:17265022-17265044 GGTGTTAGAAACCAAGATCTGGG + Intergenic
927088481 2:19692655-19692677 GGTATTAGAAACCAATATCTGGG + Intergenic
927312312 2:21645000-21645022 GCTATTTGAAACCACGATTCTGG + Intergenic
927821249 2:26267204-26267226 CTATTTAGAAACCAAGATCTGGG - Intronic
928228773 2:29477871-29477893 CCAGCTAGAACCCAAGATTTCGG - Intronic
928599293 2:32887416-32887438 GGTATTAGAAACCAAGATCTGGG - Intergenic
929039837 2:37733741-37733763 CCTCTGATACACCAAGATTTTGG - Intronic
929368649 2:41193770-41193792 CCTGTTATAAAGGAAGATTTTGG + Intergenic
929623357 2:43380682-43380704 GGTATTCGAAACCAAGATTGGGG - Intronic
930067879 2:47341734-47341756 CCCATAAGAAACAATGATTTTGG + Intergenic
930568275 2:53050848-53050870 GATATTAGAAACCAAGATGTTGG - Intergenic
930687099 2:54321475-54321497 CCTGTTGGAAATCCAGATTTGGG - Intergenic
931197156 2:60063586-60063608 CCTATTAGAAACCAAAACCTGGG - Intergenic
931199400 2:60082911-60082933 GTTGTTAGAAACCAAGATCTAGG - Intergenic
931508010 2:62953383-62953405 CCAATTAAAAATCAAGTTTTAGG + Intronic
931865419 2:66405082-66405104 AGTATTAGAAACAAAGAGTTGGG - Intergenic
932047057 2:68360278-68360300 CGTATTAGTAATCAAGATCTGGG + Intergenic
932198593 2:69805829-69805851 CCTATTAGAAACTAAAACTGAGG + Intronic
932361663 2:71113388-71113410 GGTATTAGAAGCCAAGATCTAGG - Intronic
932792469 2:74667584-74667606 CGTATTTGAAAATAAGATTTCGG - Intronic
933034546 2:77377243-77377265 GGTATTAGAAATCAAGATCTGGG + Intronic
933106694 2:78336971-78336993 AATATTAGAAACAAAGATGTGGG + Intergenic
933378732 2:81515920-81515942 GGTATTAGAAGCCAAGATCTGGG - Intergenic
933521203 2:83376513-83376535 AATATTAGAAACCAAGATTTAGG + Intergenic
933986868 2:87599451-87599473 CCTACGTGAAAACAAGATTTGGG - Intergenic
934017306 2:87901253-87901275 CCTACTATAAACCAAGCATTAGG - Intergenic
934570520 2:95368978-95369000 ACAATTAGAAATCAAAATTTAGG - Intronic
934581088 2:95439454-95439476 ATTATTAGCATCCAAGATTTTGG + Intergenic
934598362 2:95637260-95637282 ATTATTAGCATCCAAGATTTTGG - Intergenic
935585609 2:104797335-104797357 CCTATTAGAAAATGAGATTCTGG + Intergenic
935747381 2:106200457-106200479 AGTATTGGAAACCAAGATTTGGG + Intergenic
935859717 2:107315799-107315821 GTTATTAGAAACCAAGACCTTGG + Intergenic
936306976 2:111351357-111351379 CCTACGTGAAAACAAGATTTGGG + Intergenic
937465913 2:122132948-122132970 CTTATTAGATACCAAGGTTCAGG + Intergenic
937952509 2:127399297-127399319 ACATTTAGAAACCAAGATCTGGG - Intergenic
938391060 2:130906234-130906256 GTATTTAGAAACCAAGATTTGGG + Intronic
938634408 2:133207491-133207513 GTTATTTGAAACCAAGATCTTGG - Intronic
939524282 2:143272864-143272886 CCAATTAAAAAGCAAGATTCTGG - Intronic
939714743 2:145570025-145570047 CCAATTAGATACCCAGAGTTTGG + Intergenic
940213913 2:151284956-151284978 ATTATTAGAAACCAAGATCTGGG - Intronic
940436741 2:153665282-153665304 CCTTTTAGAAATGAAGGTTTGGG + Intergenic
940561441 2:155302025-155302047 CCTATTAGCTACTACGATTTTGG - Intergenic
940732525 2:157409099-157409121 GGTATTAGAAGCCAAGATCTTGG + Intergenic
940794108 2:158058799-158058821 GATATTAGACACCAAGATCTGGG + Intronic
940958272 2:159753615-159753637 CATATTTAAATCCAAGATTTGGG - Intronic
941064075 2:160880975-160880997 CATATTAAAAGCCAAGATCTGGG + Intergenic
941299032 2:163777926-163777948 CCACTGATAAACCAAGATTTGGG - Intergenic
941526809 2:166616128-166616150 GGTATTAGAAGCCAAGATCTGGG - Intergenic
941832806 2:169980778-169980800 TGTATTAGAAACCAAGATCGGGG - Intronic
942303342 2:174583559-174583581 CCTAATTCAAAGCAAGATTTTGG - Intronic
942376857 2:175346385-175346407 AGTATTAGAAACGAAGATCTGGG + Intergenic
943408917 2:187521063-187521085 GGTATTAGAAACCCAGATCTGGG + Intronic
943584757 2:189725369-189725391 ATATTTAGAAACCAAGATTTGGG - Intronic
943901991 2:193451514-193451536 GGCATTAGAAACCAGGATTTGGG - Intergenic
943994338 2:194739936-194739958 GATATTAGAAACCAAAATCTGGG - Intergenic
944006393 2:194913212-194913234 GGTATTTGAAACCAAGATTTGGG + Intergenic
944425723 2:199580877-199580899 CCTATTAGACACAAAAATTAAGG - Intergenic
944425726 2:199580958-199580980 CCTATTAGACACAAAAATTAAGG - Intergenic
945558198 2:211305282-211305304 GGTATTAGAAACCAAAATCTGGG - Intergenic
946002669 2:216495863-216495885 GATATTATAAACCAAGATCTGGG + Intergenic
947328764 2:229005994-229006016 CCTAATTGAAACCAAGATTTCGG + Intronic
947803346 2:232946619-232946641 CTGTTTAGAAACCAAGATCTGGG - Intronic
948006359 2:234611180-234611202 GGTATTAGAAACCAAGATCTGGG - Intergenic
948304826 2:236938896-236938918 GATATTAGAAACCAAGATGTGGG + Intergenic
948342030 2:237261206-237261228 GATATTAGAAACCAAGATCTGGG - Intergenic
1168755260 20:312313-312335 TTTATTAGAAACCAAGAACTGGG + Intergenic
1169334366 20:4743318-4743340 GTTATTAGAAACCAAGGTCTGGG - Intergenic
1169735837 20:8836689-8836711 CTTATAAGAAGCAAAGATTTTGG + Intronic
1170495577 20:16921178-16921200 CTTATTAGAATCCATGACTTTGG - Intergenic
1171109633 20:22468461-22468483 CATATTAGAAATCAAAATTGAGG - Intergenic
1172103510 20:32500600-32500622 CATATTAAAAACCAAAATATCGG - Intronic
1173068142 20:39734578-39734600 GGTATTAGAAATCAAGATTTAGG - Intergenic
1173996444 20:47342214-47342236 AGTATTAGAAACCAAGATGTGGG - Intronic
1174397348 20:50255628-50255650 GGTATAAGAAACCAAGATCTGGG + Intergenic
1174728189 20:52887493-52887515 GCATTTAGAAACCAAGATCTAGG - Intergenic
1174966212 20:55218973-55218995 GGTATTAGAAACCAATATCTGGG + Intergenic
1175076512 20:56379541-56379563 GTTATTAGAAACCAAGCTCTGGG - Intronic
1175486142 20:59347885-59347907 GATATTAGAAACCAAGATCTGGG + Intergenic
1177046741 21:16180564-16180586 TCTTTTAGCTACCAAGATTTGGG + Intergenic
1177232732 21:18343306-18343328 CCTATTAAAAACCATCATTGAGG - Intronic
1177898935 21:26889506-26889528 TCTATTTGAAACCACAATTTTGG + Intergenic
1178036809 21:28593486-28593508 AGTATTAGAAACCAAGACCTGGG - Intergenic
1178415008 21:32397372-32397394 GGTATTAGAAACCAAGATCTGGG - Intergenic
1178591209 21:33912065-33912087 AATATTAGGAACCAAGATTAGGG - Intronic
1178603078 21:34011948-34011970 CATTTTAGAAACCAAGATCTAGG + Intergenic
1178630416 21:34254850-34254872 GCTATTAGAAACCAAGATCTAGG + Intergenic
1178947445 21:36959943-36959965 CCTTTAAGAAGCCAAGATCTAGG + Intronic
1179314398 21:40228789-40228811 CCTATTAGAAACCAAGATTTGGG + Intronic
1179338211 21:40478032-40478054 CCTATTAGAAATCAAGATACTGG - Intronic
1179390510 21:40985750-40985772 GGTATTAGAAACCAAGATTAGGG - Intergenic
1180753953 22:18147310-18147332 GGAATTAGAAACCAAGATCTGGG + Intergenic
1182536305 22:31006105-31006127 GGCATTAGAAACCAAGATCTGGG - Intergenic
1182799736 22:33022181-33022203 CCTATTAGGAATCAGTATTTAGG + Intronic
1182921363 22:34082751-34082773 CCTTTAAGAAAACCAGATTTTGG - Intergenic
1185064585 22:48624797-48624819 ACTATTAGAAACCTAGGTCTTGG + Intronic
1185282582 22:49981279-49981301 CCTATTAGAAACCAAGAACAAGG + Intergenic
950403189 3:12786950-12786972 GCACTTAGAAACCAAGATCTGGG - Intergenic
950786547 3:15441277-15441299 CTTTTTAGAAATCAAGAATTTGG + Exonic
951034410 3:17917373-17917395 CTTATTAGAAAATAAGGTTTGGG + Intronic
951083361 3:18479210-18479232 CCTATTCTACACCAAGAGTTAGG + Intergenic
951969078 3:28422882-28422904 CCTATTAGAATTCAAAATTCAGG - Intronic
952014958 3:28945441-28945463 GGTATTAGAAACTAAGATCTGGG + Intergenic
952113322 3:30149771-30149793 GATATTAGAAACCAAGATCTGGG - Intergenic
952219372 3:31309306-31309328 CATATTGGAAACCAAAATATTGG + Intergenic
952280788 3:31921306-31921328 GGTATTACAAACCAAGATGTGGG - Intronic
952686657 3:36157630-36157652 ACTATTAGAAACCAAGATCTGGG - Intergenic
952697810 3:36290354-36290376 AGTATTAGAAACCAAGGTCTTGG + Intergenic
952703835 3:36355827-36355849 GGTATTAAAAACCAAGATATGGG + Intergenic
952952445 3:38536105-38536127 ATATTTAGAAACCAAGATTTGGG + Intronic
953367729 3:42360377-42360399 GTTATTAGAAGCTAAGATTTGGG + Intergenic
954375033 3:50189582-50189604 CCTTTGAGAGCCCAAGATTTGGG + Intergenic
954516635 3:51183981-51184003 GATATTAGAAACCAAGATCTAGG - Intronic
954861984 3:53697961-53697983 GTTATTAGAGACCAAGATGTGGG + Intronic
955039416 3:55300573-55300595 GGTATTAGAGACCAAAATTTGGG + Intergenic
955343828 3:58146426-58146448 CCCATTAGAACCACAGATTTGGG - Intronic
955540325 3:59969399-59969421 CATATTAGAGCCCAAAATTTGGG - Intronic
955588761 3:60511709-60511731 ATAATTAGAAACCAAGATCTGGG - Intronic
955660860 3:61297595-61297617 CCTGTTAGACACAAAGCTTTAGG - Intergenic
956256521 3:67289026-67289048 CATATTAGAAACCAAGACTTGGG + Intergenic
956267050 3:67408416-67408438 CTTAATACAAAACAAGATTTGGG + Intronic
956931023 3:74043057-74043079 CCCATTAGAATGCAAGCTTTGGG + Intergenic
957480559 3:80788017-80788039 CCTTTTAGAAATAAAAATTTGGG + Intergenic
958772426 3:98441427-98441449 GGTATTAGAAACCAAGATCTGGG + Intergenic
959607120 3:108253369-108253391 GGTATTAGAAACCAAGATCTGGG + Intergenic
959655265 3:108797114-108797136 GGTATTAGAAATCAAGATCTGGG - Intergenic
959790648 3:110357318-110357340 CTGTTTAGAAACCAAGATCTGGG - Intergenic
959831170 3:110864399-110864421 CCTAATACATACAAAGATTTTGG + Intergenic
960251059 3:115453906-115453928 AATATTAGAATCCAAGATCTTGG + Intergenic
960370160 3:116826465-116826487 GGAATTAGAAACCAAGATTTGGG - Intronic
960389804 3:117063821-117063843 CTGATTATGAACCAAGATTTGGG + Intronic
961430411 3:126878270-126878292 TCATTTAGAAACCAAGATTTAGG - Intronic
962090830 3:132242505-132242527 CCTTTTAGAAGCCAAGAGCTTGG - Intronic
962303633 3:134266560-134266582 GTCTTTAGAAACCAAGATTTGGG + Intergenic
962955396 3:140261563-140261585 GGTATTAGAAACCAAGAGCTGGG + Intronic
963569300 3:146971556-146971578 CCCTTTAGGAACAAAGATTTGGG + Intergenic
963964104 3:151346285-151346307 CATAGTAGAAATCAAGATTGGGG - Intronic
964615269 3:158657002-158657024 GGTATTAGAAACCAAGATTTGGG + Intronic
964904116 3:161696934-161696956 CCTTTTAGAAGCTAAGTTTTGGG - Intergenic
965112196 3:164441537-164441559 GGTATTAGAAACCAAGATCTAGG - Intergenic
965637188 3:170794474-170794496 GCTATTGGAAACCAATATCTGGG + Intronic
966543060 3:181113851-181113873 GATATTAGAAACCAAGGTATTGG + Intergenic
967295431 3:187959612-187959634 CCCATTTGAAACCCAGATTTGGG + Intergenic
967610125 3:191495305-191495327 GGTACTAGAAACCAAGATCTAGG + Intergenic
969147235 4:5134585-5134607 CATATCAGAAACCAGGATTTGGG + Intronic
969723017 4:8903635-8903657 GTGATTAGAAACCAAGATCTGGG + Intergenic
969777636 4:9369712-9369734 CCTATAAGGAATGAAGATTTAGG - Intergenic
971467755 4:26982668-26982690 CTGTTTAGAAACCAAGATTTGGG + Intronic
971963639 4:33522169-33522191 AGTGTTAGAAACCAAGACTTGGG + Intergenic
972261975 4:37418035-37418057 ATTATTAGAAATCAAGATCTGGG - Intronic
972491240 4:39589499-39589521 TCTGTTAGAATCTAAGATTTTGG - Intronic
973622331 4:52740004-52740026 GGTTTTAGAAACCAAGATCTGGG - Intronic
973896174 4:55415500-55415522 GGTATTAGAACCCAAGATCTAGG + Intronic
974291897 4:59943884-59943906 CTGTTTAGAAACCAAGATCTGGG + Intergenic
974623164 4:64386114-64386136 GCTATTAGTAATCAAGCTTTTGG - Intronic
974699634 4:65423807-65423829 GGCATTAGAAACCAAGATCTGGG + Intronic
974859345 4:67500446-67500468 GCATTTAGAAACCAAGATTTGGG - Intronic
975128770 4:70811570-70811592 GGTATTAGAAAACAAGATCTGGG - Intergenic
975213306 4:71725944-71725966 GATATTAGAAACAAAGATCTGGG + Intergenic
975385482 4:73754621-73754643 GATTTTAGATACCAAGATTTGGG - Intergenic
976361193 4:84180345-84180367 GATATGAGAAACCAAGATCTGGG + Intergenic
976719674 4:88157823-88157845 CCTCCTAAAAACCAAGCTTTAGG + Intronic
976734737 4:88298022-88298044 GCTATGAGAAAGCAAGTTTTTGG + Intergenic
976747369 4:88417355-88417377 CCCACTAGAAACAGAGATTTGGG + Intronic
977313904 4:95420965-95420987 CCTATTAGAATTTAAAATTTGGG + Intronic
977590340 4:98819259-98819281 GGTATTAGAAACCAAGATTTGGG - Intergenic
978365332 4:107975221-107975243 GGTATTAGAAACCAAGGTCTGGG - Intergenic
979423752 4:120538754-120538776 GCTATTAGAAAGCAAGATCCAGG + Intergenic
979464375 4:121019468-121019490 GGTGTTAGAAACAAAGATTTGGG + Intergenic
979860567 4:125687986-125688008 AGTATTAGAAACCAAAATCTGGG - Intergenic
980134200 4:128844752-128844774 CCTATTAACAAGCAAGAATTAGG - Intronic
980164114 4:129203549-129203571 GCTGTTAGAGACCAAGATTCAGG - Intergenic
980525123 4:133980223-133980245 CATATAAGAAGCCTAGATTTTGG - Intergenic
981016833 4:139982451-139982473 GGTATTAGAAACCAAGGTCTGGG + Intronic
981266170 4:142786120-142786142 GGTGTTAGAAATCAAGATTTGGG - Intronic
981353970 4:143765671-143765693 AGTATTAGAAACCAAGATCTGGG + Intergenic
981492843 4:145358890-145358912 AGTACTAGAAACCAAGATCTGGG - Intergenic
981679017 4:147372927-147372949 GGTATTAGAAACCAAGATCTGGG + Intergenic
981839828 4:149098416-149098438 GGTATTAGAAACCAAAATCTGGG + Intergenic
981962405 4:150557002-150557024 GCTATTAGAAACCAAGATGTGGG - Intronic
982185269 4:152789968-152789990 AGTATTAGAAACCAATATCTGGG + Intronic
982509346 4:156261981-156262003 GGTATTAGAAACCAAGATCTGGG + Intergenic
982874858 4:160634588-160634610 GCTATTAGAAGCTAAGTTTTGGG + Intergenic
983926254 4:173405901-173405923 TAAATTAGAAACCAAGATCTGGG + Intronic
983959779 4:173738520-173738542 CCTAGTGGAACCCAAGAATTGGG + Intergenic
984035336 4:174661072-174661094 GTTTTTAGAAACCAAGATCTGGG + Intronic
985807396 5:2056963-2056985 GTAATTAGAAACCAAGATCTGGG - Intergenic
985853119 5:2403393-2403415 ACTATTAGAAACAAAAGTTTGGG + Intergenic
986943572 5:12987192-12987214 CCTATTATCAACCGTGATTTGGG - Intergenic
987218341 5:15763089-15763111 GAAATTAGAAACCAAAATTTTGG - Intronic
987556382 5:19456476-19456498 AGTATCAGAAACCAAGATTTGGG - Intergenic
987622398 5:20352418-20352440 CCTTTCAACAACCAAGATTTGGG - Intronic
988162633 5:27540955-27540977 TGTATTACAAACCAAGATCTGGG - Intergenic
988172056 5:27670904-27670926 CCTATTAAAAACCCAAATATTGG + Intergenic
988374375 5:30415376-30415398 GGTATTAGAAACCAAGATTTGGG - Intergenic
988878688 5:35475916-35475938 GGCATTAGAAACCAAGATGTGGG + Intergenic
990050818 5:51497541-51497563 AACATTAGAAACCAAGATCTGGG + Intergenic
990317963 5:54601899-54601921 CACATTAGAAACCAGGAATTTGG + Intergenic
990996889 5:61741391-61741413 GAAATTAGAAACCAAGATCTGGG - Intronic
990997020 5:61742948-61742970 AGTATTAGAAACCAAGACCTGGG - Intronic
991282315 5:64929262-64929284 GGTGTTAGAAACCAAGATCTGGG - Intronic
991376109 5:65968943-65968965 CTTATTTGAAACAAAGATTTGGG - Intronic
991618811 5:68524057-68524079 TCTATTGAAAACTAAGATTTAGG + Intergenic
991988101 5:72310258-72310280 GGCATTAGAAACCAAGATCTAGG - Intronic
992571417 5:78062725-78062747 CCTGTTAAAAACCAATCTTTTGG + Intronic
992813878 5:80416808-80416830 TTTATTAGAAACCAAGATCTGGG + Intronic
993239664 5:85365886-85365908 GGTATTAGAAACCAATATTTTGG + Intergenic
993251473 5:85530337-85530359 GGTATTAGAAACCAAGATGTGGG + Intergenic
994366155 5:98919887-98919909 GGCATTAGAAACCAAGATTTGGG - Intronic
994464915 5:100114536-100114558 AGTATTAGAAACCAAGATCTGGG - Intergenic
995024098 5:107398904-107398926 CCTAATATGAACCAAAATTTAGG + Intronic
995134377 5:108664980-108665002 CCAATTTGATCCCAAGATTTGGG + Intergenic
995202099 5:109437648-109437670 GGTATTAGAAACCACGATCTGGG - Intergenic
995807709 5:116072120-116072142 AATATTAGAAACCAAGATTAGGG + Intergenic
995839810 5:116432993-116433015 CCTATCAGAAACCAAGAGACAGG - Intergenic
998195683 5:140068464-140068486 GGTACTAGAAACCAAGATCTAGG - Intergenic
999168025 5:149567873-149567895 TATTTTAGAAACCAAGATCTGGG + Intronic
999623511 5:153496174-153496196 CCTATTAGAGATCAAGTCTTAGG - Intronic
999788173 5:154911211-154911233 TCATTTAGAAACCAAGATCTGGG + Intronic
1000585444 5:163091932-163091954 GGTATCAGAAACCAAGATCTGGG - Intergenic
1000735765 5:164898318-164898340 AGAATTAGAAACCAAGATTTGGG + Intergenic
1001901003 5:175429695-175429717 GGTGTTAGAAACCAAGATCTGGG - Intergenic
1002036435 5:176474015-176474037 GGTATTAGAAACCAAGTTCTAGG + Intronic
1002348761 5:178567258-178567280 GATATTAGAGACCAAGATCTGGG - Intronic
1002411464 5:179081700-179081722 GCATTTAGAAACCAAAATTTGGG - Exonic
1003004281 6:2366496-2366518 ACAATTACAAACCAAGATCTGGG - Intergenic
1003139895 6:3462521-3462543 GGTATTAGATACCAAGATCTGGG - Intergenic
1003289595 6:4768277-4768299 CATATTAGAAAGCAAGTTCTGGG - Intronic
1003469858 6:6419319-6419341 AATATTAGAAAACAAGATCTGGG + Intergenic
1004583985 6:16981676-16981698 GCTATTAGTAATTAAGATTTGGG - Intergenic
1004799262 6:19128160-19128182 GGTATTAGACACCAAGATCTTGG - Intergenic
1005002084 6:21251812-21251834 GCTATTAGAAACCAAGATCTGGG + Intergenic
1005176845 6:23056619-23056641 GGTATTAGAAACCAACATCTGGG - Intergenic
1005707682 6:28471473-28471495 AGTTTTAGAAACCAAGATCTGGG + Intergenic
1006012020 6:31050795-31050817 ATATTTAGAAACCAAGATTTGGG - Intergenic
1006892607 6:37441995-37442017 CTTATTAGAAGCCAGAATTTTGG + Intronic
1006967109 6:37998983-37999005 GTTATTAGAAACCAGGATCTAGG - Intronic
1007062644 6:38955830-38955852 CCTATTAAAATCCAAGACCTAGG + Intronic
1008169785 6:48188934-48188956 TCATTTAGAAATCAAGATTTGGG - Intergenic
1009360915 6:62812024-62812046 CCTTTTAGAAAACAAATTTTGGG - Intergenic
1009624123 6:66115678-66115700 TGTATTAGGAACCAAGATCTAGG + Intergenic
1009857932 6:69288475-69288497 ACTGTCAGAAACCAAGTTTTGGG - Intronic
1009884616 6:69610941-69610963 GGTATTAGAAACCAAGATCTGGG - Intergenic
1010499061 6:76572429-76572451 ACTACTAGAAACCAAGAAATGGG - Intergenic
1010620336 6:78065614-78065636 CCTATTAGAAACCAAGAGTTGGG + Intergenic
1010623728 6:78109812-78109834 CATATGATAAACCAAGAATTTGG - Intergenic
1010853880 6:80813643-80813665 CCCTTTAGAAACAAAGGTTTGGG - Intergenic
1011008457 6:82675695-82675717 GGTGTTAGAAACCAAGATCTGGG - Intergenic
1011221085 6:85055117-85055139 CGTATTAGAAACTAAAATCTGGG - Intergenic
1011907959 6:92396081-92396103 AATATTAGAAACCAAAATCTAGG + Intergenic
1012469466 6:99554800-99554822 GATATTAGAAACCAAGATATGGG + Intronic
1012544321 6:100399933-100399955 ACAATAAGAAACCAAGAGTTTGG + Intronic
1012747309 6:103109197-103109219 CTTATTAAAAACCAAAATATCGG + Intergenic
1012783561 6:103593617-103593639 GGTTTTAGAAACCAAGATCTAGG + Intergenic
1013545478 6:111152918-111152940 CATTTAAGAAACCCAGATTTGGG + Intronic
1013620674 6:111885565-111885587 CCTATTAGACTCTAAGATCTGGG - Intergenic
1014329749 6:120047840-120047862 AATATTAGAAACCAAGATTTGGG + Intergenic
1015021218 6:128478239-128478261 TCTATCAGAAAACAAGAGTTAGG - Intronic
1015553382 6:134435452-134435474 GGTATTAGAAATCAAGATTGGGG - Intergenic
1015752740 6:136576691-136576713 GCATTTAGAAACCAAGATTTGGG + Intronic
1016226087 6:141739966-141739988 AGTATTAGAAAGCAAGATCTAGG + Intergenic
1016357027 6:143228992-143229014 CATGATAGAAACCCAGATTTGGG + Intronic
1016375815 6:143419526-143419548 CCCATTGGAAACCAACATTTTGG - Intergenic
1016589234 6:145726002-145726024 GATATTAGAAATCAAGATCTGGG - Intronic
1016640557 6:146343911-146343933 TGTATTAGAAACCAAGATCTGGG + Intronic
1016708399 6:147140897-147140919 GGTATTAGAAAACAAGATCTGGG - Intergenic
1017281450 6:152630328-152630350 CCTATAAGACACCAAGTATTGGG - Intronic
1017467912 6:154712040-154712062 AGTTTTAGAAACCAAGATCTGGG + Intergenic
1017504783 6:155058162-155058184 GCTATTAGAAACCAAGATCTGGG + Intronic
1017719264 6:157233564-157233586 CCGATTAAATACAAAGATTTGGG - Intergenic
1017919846 6:158861912-158861934 ATTTTTAGAAACCAAGATTTTGG + Intergenic
1018546857 6:164946946-164946968 CCTATAAGAAACCTAGAATTTGG - Intergenic
1021149826 7:17135932-17135954 AGTATTAGAAATCAAGATCTGGG + Intergenic
1021362888 7:19738501-19738523 GGTATTAGAAACCAAGATCTGGG - Intronic
1022869842 7:34464698-34464720 TGTATTAGAAATCAAGATCTGGG + Intergenic
1023002619 7:35826846-35826868 CATTTTAGATAGCAAGATTTGGG + Intronic
1023022167 7:36019969-36019991 CCTAAAAGAAACCAGAATTTGGG - Intergenic
1023902457 7:44492976-44492998 GATATTAGAAACCAAGATCTGGG - Intergenic
1023902700 7:44495851-44495873 AATATCAGAAACCAAGATCTGGG - Intergenic
1024455441 7:49600571-49600593 AGTATTAGAAACCAAGATCTGGG + Intergenic
1024848800 7:53684352-53684374 GGTATTAGAAACCAAGCTCTGGG - Intergenic
1026127540 7:67592638-67592660 CCAATTACAAACTAATATTTGGG - Intergenic
1027686865 7:81289357-81289379 CCTTTTAGACGCCAAGGTTTAGG - Intergenic
1027691094 7:81345707-81345729 GATATTAGAAACCAAGACCTAGG - Intergenic
1028278871 7:88895558-88895580 GGTATTAGAAACCAAGATCTTGG - Intronic
1028293130 7:89092876-89092898 AGTATTAGAAACCAAGATCTGGG + Intronic
1028425533 7:90683498-90683520 GCTATTAGAAACCAAATTCTGGG + Intronic
1028512452 7:91640448-91640470 CTTATTAGAAATGCAGATTTGGG - Intergenic
1028698097 7:93741081-93741103 GATATTAGAAACAAAGATCTGGG + Intronic
1028846536 7:95487562-95487584 GATATAAGAAACCAAGTTTTAGG + Intronic
1029058057 7:97767304-97767326 CCTAATTAAAACCAAGAATTGGG + Intergenic
1029099579 7:98117664-98117686 GATATGAGAAACCAAGATCTGGG + Intronic
1030074913 7:105728650-105728672 GATACTAGAAACCAAGATCTGGG - Intronic
1030429253 7:109421091-109421113 GATATTAGAAACCAAGATCTAGG + Intergenic
1030757128 7:113300629-113300651 TGTATTAGAAACCAAGATCTAGG + Intergenic
1031479772 7:122264664-122264686 TGTATTAGAAATCAAGATTTGGG - Intergenic
1031745105 7:125486416-125486438 AGTATTAGAAACCAAGATCCTGG - Intergenic
1033125425 7:138702918-138702940 CCTATTGCAAATGAAGATTTTGG + Intergenic
1033448740 7:141444137-141444159 GGTATCAGAAACCAAGATATGGG + Intronic
1036275082 8:7343667-7343689 CCTATGAGGAATGAAGATTTAGG - Intergenic
1036346272 8:7966681-7966703 CCTATGAGGAATGAAGATTTAGG + Intergenic
1036841595 8:12127439-12127461 CCTATGAGGAATGAAGATTTAGG + Intergenic
1036863404 8:12373686-12373708 CCTATGAGGAATGAAGATTTAGG + Intergenic
1037009166 8:13819401-13819423 CCTATTAAAAGCCATGATGTGGG + Intergenic
1037420133 8:18693300-18693322 CCTGGTAGAAACCATGATTTGGG - Intronic
1038365301 8:26925806-26925828 GGTATTAGAAACCAAGATCTGGG - Intergenic
1039192139 8:34988295-34988317 GCATTTAGAAACCAAGATCTGGG + Intergenic
1039767415 8:40644250-40644272 GATATTAGAAACCAACATTTGGG - Intronic
1040673901 8:49725720-49725742 TGTATTAGAAACGAAGATCTGGG - Intergenic
1040733388 8:50476759-50476781 AGTATTAGATACCAAGATCTAGG - Intronic
1040998503 8:53426194-53426216 GGTATTAGAAACCAGGATCTGGG - Intergenic
1041994877 8:64042467-64042489 CATAATAGAAACCAAGAGTTTGG + Intergenic
1042136889 8:65641191-65641213 GTATTTAGAAACCAAGATTTAGG - Intergenic
1042437562 8:68784950-68784972 GATTTTAGAAACCAAGATTGGGG + Intronic
1042777020 8:72443517-72443539 CTTTTTAGAAACCAAGACCTGGG + Intergenic
1042950024 8:74191636-74191658 GGTATTAGAAACCCAGATTTGGG + Intergenic
1043001589 8:74766730-74766752 GGTATTAGAAATCAAGATTTGGG + Intronic
1043001860 8:74769338-74769360 GGTATTAGAAATCAAGATTTGGG + Intronic
1045008110 8:97933535-97933557 CCTATTCGACACCAGGATTGCGG - Intronic
1045078866 8:98602962-98602984 CATTTTAGAAGCCAAGATCTTGG - Intronic
1045410713 8:101914883-101914905 AGTATTAGAAACCAAGATCTGGG + Intronic
1046520003 8:115311917-115311939 CCTTTTAGAAACAAAGAAGTTGG + Intergenic
1047088708 8:121549243-121549265 ACTATAAGAAAAGAAGATTTGGG + Intergenic
1047100475 8:121670119-121670141 CTTATTAAAAAACAAAATTTTGG + Intergenic
1047321884 8:123793729-123793751 GCTATTAGAGACCAAGATACTGG + Intronic
1047331655 8:123894637-123894659 GCATTTAGAAACCAAGATCTGGG - Intronic
1047449006 8:124945803-124945825 CCAATTAGATATCAAGTTTTAGG + Intergenic
1047469276 8:125152662-125152684 CAGATAAGAAAACAAGATTTTGG + Intronic
1048057518 8:130882096-130882118 CCTCTTAGAAACCCATATTGAGG + Intronic
1048548443 8:135408557-135408579 GGTATTAGCAACCAAGATCTGGG + Intergenic
1048640324 8:136351001-136351023 GGTATTAGAAACCAAGATCTGGG - Intergenic
1049842754 8:144784228-144784250 CCTACTAGATATCAAGACTTAGG + Intronic
1049918763 9:344147-344169 CCTGTTAGAAACCAGGTCTTGGG + Intronic
1049952544 9:659435-659457 CTTATTAGAAATCCAAATTTTGG - Intronic
1050070185 9:1802491-1802513 GGTATTAGAAACCAAGATCTGGG - Intergenic
1050140086 9:2508505-2508527 AATATTAGAAACCAAGATCTTGG + Intergenic
1050225557 9:3450948-3450970 AGTATTGGAAACCAAGATCTGGG - Intronic
1050315050 9:4392554-4392576 CCTGTTAGAATCTAAGGTTTGGG - Intergenic
1051029179 9:12653934-12653956 GGTAGTAGAAACCAAGATCTGGG + Intergenic
1051196361 9:14566220-14566242 CCTTTTAGAAATCTACATTTTGG + Intergenic
1051652267 9:19340140-19340162 GATTTTAGAAGCCAAGATTTGGG + Intronic
1051733041 9:20167557-20167579 GTATTTAGAAACCAAGATTTGGG - Intergenic
1052164392 9:25306383-25306405 GTTATTAGAAACCAAAATTTAGG - Intergenic
1052257009 9:26469048-26469070 GGTGTTAGAAACCAAGATCTGGG + Intergenic
1053326188 9:37153811-37153833 GATATTAGAAACCAAAATCTGGG + Intronic
1053470489 9:38342821-38342843 CCTCTGAAAAACCAACATTTGGG - Intergenic
1056323149 9:85455746-85455768 CCTGATAGAAACAAAGATGTTGG - Intergenic
1056451841 9:86723996-86724018 AGTATTAGAAACTAAGATCTGGG - Intergenic
1056898498 9:90575309-90575331 GGTATTAGAAACCAAGATCTGGG - Intergenic
1057079071 9:92158867-92158889 AGTGTTAGAAACCAAGATCTGGG + Intergenic
1057104387 9:92397656-92397678 GGTATTAGAAACCAAGATGCAGG + Intronic
1057106778 9:92426936-92426958 GATGTTAGAAACCAAGATCTGGG - Intronic
1057443296 9:95097121-95097143 CATTTAAGAAACCCAGATTTAGG + Intergenic
1057952801 9:99383428-99383450 CAGATCAGAAACCAAGAGTTTGG - Intergenic
1058052128 9:100416884-100416906 GCTATTAGAAATCAATATCTGGG + Intergenic
1058359973 9:104133686-104133708 CCTATTACAAGCTAGGATTTTGG + Intronic
1058527672 9:105876394-105876416 AGTTTTAGAAACCAAGATCTGGG - Intergenic
1060165412 9:121409909-121409931 GGTATTAAAAACCAAAATTTTGG + Intergenic
1060168568 9:121441553-121441575 CCTATTAAAAAGCAAGTGTTTGG - Intergenic
1060805137 9:126570655-126570677 CTTAGTAGAAACTAAGCTTTGGG - Intergenic
1186604274 X:11073431-11073453 GATATTAAAAACCAAGATCTGGG - Intergenic
1186926966 X:14344170-14344192 GGTAATACAAACCAAGATTTTGG - Intergenic
1188769590 X:34135850-34135872 GTATTTAGAAACCAAGATTTGGG - Intergenic
1189502829 X:41580164-41580186 CACATAAGAAACCAAGATTTAGG + Intronic
1189697709 X:43682249-43682271 AGTATTAGAAACCAAGATCTGGG - Intronic
1189796999 X:44654684-44654706 GTTATAAGAAATCAAGATTTTGG + Intergenic
1189899813 X:45694653-45694675 ATTATTAGAAACCAAGATCTGGG - Intergenic
1190731463 X:53229138-53229160 ACATTTAGAAACCAAGATTTGGG - Intergenic
1191060382 X:56289387-56289409 TGTATTAGAAACCAATATCTGGG + Intergenic
1191235685 X:58131962-58131984 CCCATTAGAAAGCCAGATGTTGG - Intergenic
1192192951 X:69005019-69005041 GATATTAGAAAACAAGATCTGGG + Intergenic
1192227001 X:69236300-69236322 GGTATTAGAAACCAAGATCTGGG + Intergenic
1192329263 X:70161377-70161399 GGTATTAGAAACCAAGATTTGGG - Intronic
1194049340 X:89049344-89049366 CTTTTTAGAAACCAAAAATTAGG - Intergenic
1194155817 X:90387440-90387462 GGTATTAGAAATCGAGATTTGGG - Intergenic
1194897799 X:99467593-99467615 GCATTTAGAAACCAAGATCTGGG + Intergenic
1195406219 X:104516459-104516481 CCTATTATAGACCATGCTTTAGG + Intergenic
1195631467 X:107059910-107059932 ACTTTTAGAAACCAAGATCTGGG - Intergenic
1195638519 X:107146920-107146942 GCATTTAGAAACCAAGATCTAGG + Intronic
1196311365 X:114170516-114170538 ACTATAAGAAAGCAAGGTTTAGG - Intergenic
1196384741 X:115137330-115137352 ACAATTAGAAACACAGATTTAGG + Intronic
1197125329 X:122939296-122939318 ATTATTAGAAACTAAGATCTGGG - Intergenic
1197276426 X:124484800-124484822 GGTATTAGAAACCAAGATCTGGG + Intronic
1197449647 X:126595544-126595566 CCTATATGAAACCAATCTTTTGG - Intergenic
1198203892 X:134448227-134448249 ATTATTAGAAACCAAGCTCTGGG - Intergenic
1198218920 X:134581865-134581887 CCTGTTAGAAATCAAGACTGGGG + Intronic
1198279587 X:135128494-135128516 GACATTAGAAACCAAGGTTTGGG - Intergenic
1198291370 X:135244020-135244042 GACATTAGAAACCAAGGTTTGGG + Intergenic
1198806123 X:140496684-140496706 GATATTAGAAACTAAGATCTGGG + Intergenic
1198857904 X:141037403-141037425 CATATTAGAAACCTAGACCTGGG + Intergenic
1198904792 X:141549967-141549989 CATATTAGAAACCTAGACCTGGG - Intergenic
1199127177 X:144137292-144137314 CCTACTATAAACCAAGCATTAGG + Intergenic
1199226874 X:145386317-145386339 CATTTTAGAAGCCAAGATCTCGG + Intergenic
1199254843 X:145707813-145707835 GGTATTAGAAACCAAGATCTGGG - Intergenic
1199584176 X:149395839-149395861 GGTATTAGAGACCAAGATCTGGG - Intergenic
1200502165 Y:3964394-3964416 GGTATTAGAAATCGAGATTTGGG - Intergenic
1201362953 Y:13173514-13173536 ACTATTAAAGACCAAGTTTTTGG + Intergenic
1202014761 Y:20390476-20390498 ACTGTCAGAAAACAAGATTTTGG + Intergenic
1202576982 Y:26338212-26338234 CCTATTAGAAACCCTGCATTGGG + Intergenic