ID: 1179314856

View in Genome Browser
Species Human (GRCh38)
Location 21:40234572-40234594
Sequence ATGCTGAGGCTACAATAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 84}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179314856 Original CRISPR ATGCTGAGGCTACAATAGAC AGG (reversed) Intronic
902547868 1:17201589-17201611 GTGCTGGGGCTACAATGGCCAGG - Intergenic
904774365 1:32897639-32897661 ATGCTGAGGCTAGCATAGGCAGG - Intronic
905933264 1:41804758-41804780 ATGCTGACCCTCCAATAGGCTGG + Intronic
915471745 1:156129887-156129909 ATGCTGAGGCTATGGTAGATGGG + Intronic
920821418 1:209385058-209385080 GTGCTGAGCATATAATAGACAGG + Intergenic
1068843611 10:61645151-61645173 ATGCTGTGGTTCCAATACACTGG - Intergenic
1071079990 10:81799297-81799319 AGGCTGAGGCTGCCAGAGACTGG + Intergenic
1079524595 11:21369951-21369973 ATACTGAGGCTACAATACAGTGG + Intronic
1079985919 11:27200863-27200885 AGGCTGAAGCTACAAGAGACAGG - Intergenic
1080390137 11:31837918-31837940 TTGCTCAGGCTACTAAAGACTGG + Intronic
1081521935 11:43890275-43890297 ATGCTGAAGCTAGAGGAGACTGG - Intronic
1086579689 11:88385058-88385080 ATGCTGAGGCTTCTGTGGACAGG - Intergenic
1092737392 12:11595518-11595540 ATGCTGAGGCTATAATGGTGAGG - Intergenic
1096923533 12:55116195-55116217 AGACTGAGGATACAATATACAGG - Intergenic
1100039558 12:90298260-90298282 ATGGTGAGGCTACTGTAGGCAGG - Intergenic
1102791259 12:115647687-115647709 ATGCTGAAGATGCAAGAGACTGG + Intergenic
1104521242 12:129477317-129477339 ATGCTGAGCTTACAAAACACAGG - Intronic
1108343726 13:49523389-49523411 ATGCTGGGATTACAATAGAGTGG - Intronic
1108364405 13:49695557-49695579 AGGCTGAGGCTGCCATACACTGG - Intergenic
1109265021 13:60188126-60188148 ATGCTCAGGCTACAACAGCAGGG - Intergenic
1114492764 14:23113681-23113703 ACGCTGAGGCAACAATAGGCAGG - Intergenic
1114757375 14:25274900-25274922 CTGATGAGGATACAATAAACTGG - Intergenic
1116365940 14:44063274-44063296 ATGCTGAGAATACAATATCCTGG - Intergenic
1116552305 14:46256843-46256865 ATGCTGAGGCGAAAATAAAGAGG - Intergenic
1125208460 15:37182566-37182588 ATTCTGAGGCTACTAAAGTCTGG + Intergenic
1125291634 15:38154986-38155008 ATGCTGAGGCTACGTTGGATTGG - Intergenic
1126523775 15:49626764-49626786 ATGCTGAGGAGACCATGGACTGG - Intronic
1126538406 15:49794523-49794545 ATGGTGACTCTATAATAGACTGG + Intergenic
1128709652 15:69862090-69862112 TTGCTGAGGCTTCAACACACAGG - Intergenic
1132459287 16:42533-42555 CCTCTGAAGCTACAATAGACAGG + Intergenic
1133488767 16:6246774-6246796 ATGCCCAGCCTACAATGGACTGG - Intronic
1134084488 16:11346955-11346977 ATGCTGAGGATACAGTTGTCAGG - Intronic
1135433159 16:22404497-22404519 ATGCTGAGGATTCAATACAGTGG + Intronic
1139352518 16:66346273-66346295 ATGATGAGGCAACAAGAGACAGG + Intergenic
1142316842 16:89352697-89352719 CAGCTGAGGCTTCAATAAACTGG - Intronic
1149373724 17:56022439-56022461 CTGCTCAGGCTACATTAGTCAGG - Intergenic
1155590040 18:27417340-27417362 ATGCTGGGGCTATTACAGACAGG + Intergenic
1158626832 18:59078808-59078830 ATGCCGAGGCTACACTGAACTGG + Intergenic
1159967262 18:74607300-74607322 ATGCTGAGGCTACAGAAGTGTGG - Intronic
925433107 2:3814157-3814179 ATACTGAACCTACAATTGACTGG - Intronic
930764469 2:55070681-55070703 ATGCTGAGATAATAATAGACCGG - Intronic
932008063 2:67947535-67947557 ATGCTGATGCTACTATAGTATGG - Intergenic
933140181 2:78782891-78782913 ATGCTGAGGCTAGGGTAGTCTGG + Intergenic
934810512 2:97272844-97272866 AATCTGAGGCTACTAGAGACTGG + Intergenic
934827180 2:97435095-97435117 AATCTGAGGCTACTAGAGACTGG - Intergenic
937247709 2:120504212-120504234 GTGCTGAGGGTGCAATAGGCGGG - Intergenic
941194705 2:162434859-162434881 AAGCTGAGGCTAGATTAGAATGG - Intronic
947249871 2:228090076-228090098 ATGCTGAGGTTACAAGACGCTGG - Intronic
1169154663 20:3319329-3319351 AAGCTGAGGCTTCAGTAGCCTGG + Intronic
1170884640 20:20329529-20329551 ATGTTGAGGCTACACTGGACAGG - Intronic
1174810221 20:53639067-53639089 ATGTTGAAGGTACAATAGACAGG + Intergenic
1178480110 21:32972698-32972720 ATGCTTAGGATACAACAGAAAGG + Intergenic
1178745863 21:35249778-35249800 AAGCTGAGGCTTCAATTAACTGG - Intronic
1179314856 21:40234572-40234594 ATGCTGAGGCTACAATAGACAGG - Intronic
1184429834 22:44435837-44435859 ATGCTGAGGCTACATAAATCCGG - Intergenic
951607328 3:24450716-24450738 AAGCTGAGCCTACTATAGATTGG - Intronic
960354820 3:116638225-116638247 ATGTTGAGGGGACAATATACTGG + Intronic
961524841 3:127490225-127490247 CTGCTCAGGCTGCCATAGACTGG - Intergenic
961871692 3:129993135-129993157 ACCCTGAGGCCCCAATAGACTGG + Intergenic
963916395 3:150862449-150862471 ATGCTGAGGTGACTACAGACTGG + Intergenic
972129335 4:35810356-35810378 ATGCACAGGCTTTAATAGACAGG - Intergenic
972816821 4:42655007-42655029 ATGCTGAAGCTATAATAAACTGG + Intronic
976546296 4:86339262-86339284 AGGCTGAGGCTAAATAAGACTGG + Intronic
983617490 4:169724387-169724409 ATGCTGAAGGTAGAATGGACAGG + Intergenic
986501977 5:8410205-8410227 ATGCTGAGGATACTGAAGACTGG - Intergenic
986672139 5:10151918-10151940 ATGCAGTGGCTACACTAAACAGG - Intergenic
987587571 5:19876279-19876301 ATCCTGAGGCTTGAATATACAGG + Intronic
990381398 5:55224481-55224503 ATGCTGAGACTATAAGAGAAAGG + Intronic
991038242 5:62149756-62149778 ATGCAGAGGCTGCAGTAAACTGG + Intergenic
993419519 5:87683574-87683596 ATGCTGTGACTACAATTAACAGG - Intergenic
995366194 5:111364097-111364119 GTGCAGAGGCAACAATAGAGAGG + Intronic
997005148 5:129807688-129807710 ATGCTGAAGCTGCAATTGACAGG - Intergenic
1006058352 6:31402292-31402314 AGGCAGAGGTTACAATAGCCTGG + Intronic
1023286879 7:38630259-38630281 ATGCTCAAGCTACAATATAAAGG + Intronic
1027608822 7:80333889-80333911 ATGCTGTTTCTACAATAGTCAGG + Intergenic
1033486330 7:141792489-141792511 GTGGTGAGGCCACAGTAGACAGG - Intergenic
1034390318 7:150782019-150782041 ATGCTGAGGCTGCAGGAGCCAGG - Intergenic
1037678628 8:21074200-21074222 ATACAGAGGATAGAATAGACTGG + Intergenic
1047067036 8:121296517-121296539 ATGCTGAGACAACCAGAGACTGG + Intergenic
1048955740 8:139534643-139534665 CTGCTCAGGCAACAATTGACAGG - Intergenic
1050966176 9:11806134-11806156 ATCCTGAGGATAAAATACACTGG - Intergenic
1051961499 9:22769646-22769668 CTGCTGGGGCTGCAATAGGCAGG - Intergenic
1053007637 9:34614600-34614622 CTGCTGAGGTTACAACAGAAAGG + Intronic
1060219581 9:121757248-121757270 CTGCTGAGGCCACAGCAGACTGG - Intronic
1060911804 9:127357188-127357210 TTGGTGAGGATACAAGAGACAGG - Intronic
1186059834 X:5692410-5692432 CTGCTGAGGATGCAATAGCCAGG + Intergenic
1186908777 X:14139384-14139406 ATACCTAGGCTACAATAGCCAGG + Intergenic
1192265647 X:69535826-69535848 ATGCTGAGGCTGCAAGAGACAGG - Intergenic
1192816013 X:74593012-74593034 ATGGTGACTCTATAATAGACTGG - Exonic
1194765113 X:97840802-97840824 ATGCAGAGACTACAAATGACTGG + Intergenic
1195656091 X:107332806-107332828 AAGCTGAGGCAAAAATAGATAGG - Intergenic
1196973816 X:121137595-121137617 ATGCTGAGGCAACAAGAGGTGGG + Intergenic
1198259267 X:134951414-134951436 TTGCTGAGGCTTGAGTAGACCGG + Intergenic
1201615500 Y:15892878-15892900 TTGCTGAGGCTAGACTTGACTGG + Intergenic
1201687124 Y:16717677-16717699 ATACTGATGCTACAACAGAGAGG - Intergenic