ID: 1179318889

View in Genome Browser
Species Human (GRCh38)
Location 21:40271003-40271025
Sequence CTCAAGCCCTGCCATTGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179318889_1179318894 5 Left 1179318889 21:40271003-40271025 CCCTGGCAATGGCAGGGCTTGAG 0: 1
1: 0
2: 1
3: 14
4: 201
Right 1179318894 21:40271031-40271053 CCTGAGGTCAAATCATAACATGG 0: 1
1: 0
2: 0
3: 11
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179318889 Original CRISPR CTCAAGCCCTGCCATTGCCA GGG (reversed) Intronic
900140237 1:1136805-1136827 CCCAGGCCCCGCCAGTGCCAGGG - Intergenic
901567512 1:10130738-10130760 CTCAGGGCCTGCCATTACCCTGG + Exonic
901770756 1:11529341-11529363 TTCTAGCCCTGCCCCTGCCAAGG - Intronic
903746077 1:25587588-25587610 CACAAGTCCTGCCATTGGAAGGG - Intergenic
903815543 1:26061606-26061628 CTGAGGCTCTGCCAGTGCCAAGG + Intronic
903969177 1:27107914-27107936 CTCGAGCCCCTCCACTGCCAGGG + Intronic
904672321 1:32175099-32175121 CTCAAGTTCTTCCTTTGCCACGG - Exonic
904698072 1:32341691-32341713 CTCAAGGCCTGTCACTGGCAGGG - Intergenic
904821965 1:33251380-33251402 CTCCACCTCTGCCAATGCCAAGG + Intergenic
906075528 1:43049251-43049273 CTCTGGCCCTGCCCTTGCCCTGG + Intergenic
908596464 1:65693642-65693664 CTCAAGCACTGACATGGCTAAGG - Intergenic
915630900 1:157153708-157153730 ATCAAGCCCTGCCTTTGCCGGGG - Intergenic
915744420 1:158145145-158145167 TCCAAGGCCTGCCATTGCAAAGG + Intergenic
917081578 1:171261412-171261434 AGCAAGCACAGCCATTGCCAGGG - Intronic
918718970 1:187828051-187828073 CTCAAGCCCTCCCCCTGCCTTGG - Intergenic
920366159 1:205449427-205449449 ATCAGGCCCTGCCTCTGCCAGGG + Intronic
920370709 1:205477659-205477681 CTCAAACCCTGGCAGTTCCAGGG + Intergenic
921188601 1:212690734-212690756 CTCAAACCCTCCCATGGCAAAGG - Intronic
921324479 1:213977512-213977534 CTCATTCCCTGGCTTTGCCAAGG - Intergenic
921562035 1:216670614-216670636 CTCAGGCCCTGGCACTTCCATGG - Intronic
923376882 1:233373194-233373216 CTCAAACCTTGCCTTTGCCTAGG + Intronic
924385989 1:243498293-243498315 CTAGAGCCCTGCCATTGCAGAGG - Intronic
1063126784 10:3142802-3142824 CTCCAGCCCTGCCATCTGCAGGG + Intronic
1063565641 10:7170701-7170723 CTCAGGCCCCACCAGTGCCATGG - Intronic
1065513877 10:26506034-26506056 CTCTAGGCCTGCCCTTGCCTTGG + Intronic
1066760027 10:38741204-38741226 CTCTAGCCCTGCCTTGGCCCTGG - Intergenic
1067322235 10:45231923-45231945 CACGACCCCTGCCAATGCCATGG - Intergenic
1069537436 10:69265447-69265469 CTCCAGCCTAGCCATTGCCTGGG + Intronic
1070489739 10:76965355-76965377 CTCAACCCCAGCCTCTGCCAAGG - Intronic
1070749725 10:78956810-78956832 TTCCAGCCCTGCCTTAGCCAGGG - Intergenic
1072038881 10:91589361-91589383 GTCAGGTCCTGCCCTTGCCAGGG - Intergenic
1073937136 10:108646963-108646985 CTCAAGCACTGCCAGTTACAGGG - Intergenic
1075725748 10:124610254-124610276 CTAAAGCCCTGACACTGACACGG + Intronic
1077499163 11:2901545-2901567 CCCAAGCCCTGCCCTTGGCCTGG - Intronic
1083067683 11:59942443-59942465 CGCAAGCCCTTCCATTTCTATGG - Intergenic
1083339073 11:61946932-61946954 CTCAAGGCCTGCCTTGTCCAAGG - Intergenic
1085841107 11:80012764-80012786 CTCTAGCCCAGCCATGGCAAGGG - Intergenic
1086330149 11:85745870-85745892 CTCAGGCCTTCCCAGTGCCAAGG + Intronic
1086452968 11:86935145-86935167 CTCCAGACCTGGCTTTGCCAAGG + Intronic
1086812293 11:91325298-91325320 ATGAAGGCCTGCCATTGCCCTGG - Intergenic
1089141637 11:116289351-116289373 CTCAAGCCCTGCCCATCTCAAGG - Intergenic
1091337275 11:134781863-134781885 ATCAATCACTGCCATTTCCAAGG - Intergenic
1091695656 12:2626435-2626457 TTCAAGCCCTCCCATAGCAAAGG + Intronic
1092234809 12:6800067-6800089 CTCAGGCCCTGCCATTTCTGTGG + Exonic
1093676136 12:21942251-21942273 CTCCAGCCCTGCCAGTCCCAGGG + Intergenic
1096437082 12:51601814-51601836 CTGGAGCCCTACCTTTGCCAAGG + Intronic
1096907676 12:54950030-54950052 CCCAAGCTTTGACATTGCCAAGG - Intronic
1100274502 12:93059402-93059424 CTCAATCTCAGCCATTGCCTTGG - Intergenic
1100403213 12:94250243-94250265 CACAAGCCAAGCCCTTGCCATGG - Intronic
1103335644 12:120187503-120187525 ACCAAGCCCAGCCATGGCCATGG + Intronic
1103963992 12:124626472-124626494 CTCCAGCCCAGCCTTTGCCCTGG + Intergenic
1104093302 12:125533724-125533746 CTCAGGCCCTGCGATTTCCAGGG + Intronic
1104899323 12:132179867-132179889 CCCAGGCCCTGCCTGTGCCAGGG - Intergenic
1105827721 13:24137280-24137302 CTCCAGCCCTGGGTTTGCCAGGG + Intronic
1113937470 13:114001984-114002006 CTCAAGCCTTGCCCTGGGCAGGG + Intronic
1115224389 14:31087998-31088020 CTCAATGCCTGCCCTTCCCATGG - Intronic
1116297971 14:43136403-43136425 CTCAAGCACTGCCAGAGCCAAGG + Intergenic
1116756456 14:48954816-48954838 CTAAAGCAATGCCATTGTCAGGG - Intergenic
1118349891 14:64966089-64966111 CTCAGACCCTGGCACTGCCAGGG + Intronic
1119679418 14:76580802-76580824 CTCATCCCATGCCTTTGCCAAGG - Intergenic
1120175506 14:81289306-81289328 CTCAGGTCCTGGAATTGCCACGG + Intronic
1123666194 15:22610890-22610912 CTCCAGCCTTCCCAGTGCCATGG - Intergenic
1124320017 15:28705296-28705318 CTCCAGCCTTCCCAGTGCCATGG - Intronic
1124482494 15:30090121-30090143 CTCCAGCCTTCCCAGTGCCATGG + Intronic
1124488951 15:30142223-30142245 CTCCAGCCTTCCCAGTGCCATGG + Intronic
1124521080 15:30407088-30407110 CTCCAGCCTTCCCAGTGCCATGG - Intronic
1124537582 15:30559132-30559154 CTCCAGCCTTCCCAGTGCCATGG + Intronic
1124544037 15:30611187-30611209 CTCCAGCCTTCCCAGTGCCATGG + Intronic
1124564001 15:30798622-30798644 CTCCAGCCTTCCCAGTGCCATGG + Intergenic
1124754579 15:32396100-32396122 CTCCAGCCTTCCCAGTGCCATGG - Intronic
1124761074 15:32448455-32448477 CTCCAGCCTTCCCAGTGCCATGG - Intronic
1124777560 15:32600608-32600630 CTCCAGCCTTCCCAGTGCCATGG + Intronic
1125261666 15:37832910-37832932 TTCAGCCCCAGCCATTGCCAAGG + Intergenic
1125384624 15:39124148-39124170 CTCCAGCTCTGCCATCTCCAAGG - Intergenic
1125722762 15:41853048-41853070 CTCCAGCCCTGCCCTGCCCATGG - Intronic
1126736770 15:51738107-51738129 TTCCAGCTCTGCCAATGCCAAGG + Exonic
1127896521 15:63304865-63304887 CTCAATGCCTGCCATGCCCACGG + Intronic
1128331943 15:66761738-66761760 CTCTAGCCCAGACATTCCCAAGG + Intronic
1129321086 15:74775422-74775444 CTCAATCCCTTCCAGTTCCAGGG + Intergenic
1131868228 15:96734295-96734317 CTAATTCCCTGCCATTGCAAGGG + Intergenic
1134216440 16:12320288-12320310 CACCAGCCCTGCCATTGGAAGGG + Intronic
1136254501 16:29029272-29029294 CACTAGCCCTGCAACTGCCACGG - Intergenic
1138220068 16:55242805-55242827 CTCAACCCTAGACATTGCCATGG + Intergenic
1138454389 16:57112960-57112982 CTCAGGCCCTGCCCCTGCCTGGG - Intronic
1139370079 16:66461655-66461677 CTGCAACCCTGCCATGGCCAGGG + Intronic
1141664060 16:85456830-85456852 CCCAAGCCCCGCCATTGCCAGGG + Intergenic
1141844097 16:86595336-86595358 CCCAGTCCCTTCCATTGCCACGG - Intergenic
1141982634 16:87559939-87559961 CTGTAGCCTTTCCATTGCCATGG + Intergenic
1142174990 16:88640997-88641019 CCCAAGGGCTGACATTGCCATGG + Intergenic
1142176197 16:88646596-88646618 CACAGGCCCTGCCAGAGCCAGGG + Intronic
1142201090 16:88761508-88761530 CGCAAGCACAACCATTGCCATGG - Intronic
1142430312 16:90022806-90022828 CTCCAGGCCTCCCATTCCCAGGG - Intronic
1144786736 17:17836399-17836421 CTCCAGCCCTGTGATGGCCACGG - Intronic
1147910624 17:43853861-43853883 CTGAGGCCCCTCCATTGCCAGGG + Exonic
1148734705 17:49858861-49858883 TTCAAGCCCTGACAGTGCCCCGG - Intergenic
1152100800 17:78300824-78300846 CTCATGCCCTGCCTTTGTCATGG + Intergenic
1152903126 17:82956659-82956681 CCCAAGCCCTTCCACGGCCAAGG + Intronic
1154274527 18:12947877-12947899 CTCAAGCCCTGCCCACGCCCCGG - Intronic
1155457503 18:26034196-26034218 CTTAAGCTCTGCCATTGCTGTGG - Intronic
1155875951 18:31088756-31088778 CTAATGCTCTCCCATTGCCAGGG + Intronic
1156226858 18:35118130-35118152 CTCAAAGCCTGCCCCTGCCAAGG - Intronic
1156367315 18:36440932-36440954 CTCCTGCCCTGCTATTGCCTTGG + Intronic
1156701045 18:39825285-39825307 CTTAAGCCCTGCCCTTGCCTGGG + Intergenic
1157447092 18:47754207-47754229 CCCCAGCCCTGCCATTGTCTCGG + Intergenic
1160329248 18:77977285-77977307 CTCCAGCCCTGACAATGCCATGG + Intergenic
1165428139 19:35756764-35756786 CTCGACCACTTCCATTGCCAGGG - Intronic
1166037947 19:40182910-40182932 CTCCAGCCCTGCCAAAGCCCAGG + Intergenic
1167683658 19:50941985-50942007 CTCAAGCCATGCCCCTGCCTTGG + Intergenic
926559593 2:14401788-14401810 CTCAAGCCCTCCATTTTCCAGGG + Intergenic
927907254 2:26867997-26868019 CACAAGACCTGCCAATGACAAGG + Intronic
931643277 2:64399892-64399914 CTCAGCCCCTGCCATGCCCAGGG - Intergenic
932927557 2:75994387-75994409 CTGATGCCCTGCCACTGACAGGG + Intergenic
933291428 2:80442565-80442587 CTCAAGCCATGGCATTGGGAAGG - Intronic
933861266 2:86471101-86471123 CTCAAACCCTGCAGTTGTCAAGG - Intronic
935742901 2:106166528-106166550 GTCATGCCCTGCCATGCCCAGGG - Intronic
936616649 2:114054605-114054627 CTCAAGCCCTTCCTATTCCATGG - Intergenic
937810701 2:126196057-126196079 CTCAAGCCTTGGCAATGGCAGGG - Intergenic
939022206 2:136971852-136971874 CCCAATCCCTGCCAGTACCATGG - Intronic
941224938 2:162837032-162837054 CTCAAGCCCTGCAACTGCGGGGG + Intronic
942868135 2:180699969-180699991 GCCAAGCCCTGGCATTGTCATGG - Intergenic
943055210 2:182968849-182968871 CTCAAACCCTACCATGGCAAGGG + Intronic
946780210 2:223187217-223187239 GTCAAAGCCAGCCATTGCCATGG - Intronic
947480984 2:230499795-230499817 CTCATTCCCTGACATTCCCAGGG + Intronic
948435500 2:237950930-237950952 CTCAAGCCATGGAATTGCCTTGG - Intergenic
948741917 2:240053908-240053930 CTCAAGACCTCCCCTGGCCATGG + Intergenic
1170710916 20:18789861-18789883 CTACAGCCCTGCCCTTTCCAGGG + Intergenic
1171154920 20:22863030-22863052 CTCAAGAGCTGCCGTGGCCAGGG + Intergenic
1172205180 20:33158264-33158286 CTCATTCCCACCCATTGCCAAGG - Intergenic
1173747453 20:45448681-45448703 CTCCACCCCTGCCATCCCCAAGG - Intergenic
1174165318 20:48579929-48579951 CTCAAGTCCTGCCCTCTCCAGGG - Intergenic
1176055158 20:63141386-63141408 CACATACCCTGCCACTGCCATGG + Intergenic
1176169701 20:63691246-63691268 CTCAAGCGCAGCCAGTGGCAGGG - Intronic
1179086622 21:38224141-38224163 GTCAAGCCCTGCCTTTGTTAAGG - Intronic
1179318889 21:40271003-40271025 CTCAAGCCCTGCCATTGCCAGGG - Intronic
1179398274 21:41060864-41060886 CTCCAGCCCTGCTACTCCCAAGG + Intergenic
1179922431 21:44514335-44514357 CTCTTGCCCTTCCATGGCCATGG + Intronic
1180024204 21:45149390-45149412 CCCAACCCCTGCCAGTGTCAGGG - Intronic
1181483792 22:23218183-23218205 CTCAGGCCCTGCCAGTGCCCTGG + Intronic
1183126325 22:35784879-35784901 CTCAAACCCTGCCACCGCCCTGG - Intronic
1183371428 22:37434730-37434752 CACAAACCCTCCCTTTGCCATGG - Intergenic
1183646525 22:39130319-39130341 CTAAACCCCAGGCATTGCCAGGG + Intronic
1183662187 22:39227761-39227783 CTCAAGGCCAGCCATTTCCTGGG + Intronic
1183979975 22:41533639-41533661 CTCATGCCCTGCTGATGCCAGGG - Intronic
950014076 3:9743963-9743985 CTCAACCCCTGCCATTCCCCAGG + Intronic
950590798 3:13934781-13934803 CCCAAGGCCTGCCATTGTCCAGG - Intergenic
951743610 3:25951671-25951693 GTTCAGCCCTGACATTGCCATGG - Intergenic
952535629 3:34306027-34306049 TTCAACCCCTGCTATGGCCAGGG + Intergenic
954410278 3:50367599-50367621 CCCAAACCCTGCCCCTGCCAGGG - Intronic
957532108 3:81453785-81453807 CCCAAGCCCTGCCACTGATAAGG - Intergenic
959037778 3:101386356-101386378 CTCAGGTCCTGCCAGGGCCAAGG - Intronic
959921274 3:111870938-111870960 CTCATGCCCTGCAAGAGCCATGG - Intronic
961634638 3:128325310-128325332 CTCAGGCCCAGCCATTGCTGTGG + Intronic
965976510 3:174630579-174630601 CTCAACCACTACCTTTGCCAAGG + Intronic
969074152 4:4563975-4563997 CTCAATCCCTTCCAATGGCAAGG - Intergenic
969137723 4:5044134-5044156 CTCAATCCCTGCCTCTGCGAGGG + Intergenic
969138631 4:5050896-5050918 CTCATGCCCAGCCATTCCCAGGG + Intergenic
970230290 4:13903066-13903088 CTCAAATCCTACCATTTCCAAGG + Intergenic
971357519 4:25908421-25908443 CTCAAGCCCTACGATTGCCTGGG - Intronic
972798755 4:42449860-42449882 TTCAAACCCTGTCATTGCTAAGG + Intronic
978440681 4:108730248-108730270 TTCCATCCCTGCCATTGCCTTGG - Intergenic
979911523 4:126372938-126372960 CTCAATCACTGCCCATGCCATGG + Intergenic
984710516 4:182880445-182880467 CTCCAGCACTCCCAATGCCAAGG + Intergenic
985033448 4:185814904-185814926 CTCAGGCCCTGCCCTAGCCCAGG + Intronic
985578501 5:684659-684681 CTCAGGTCCTGCCATGCCCAGGG + Intronic
986466729 5:8033501-8033523 CTCAAGCTCTGTGATTTCCAGGG + Intergenic
988186391 5:27869102-27869124 CTCAAGGCATCACATTGCCAGGG - Intergenic
988521388 5:31948494-31948516 CTCAAGCTCTATCATTTCCAGGG - Intronic
990420275 5:55625197-55625219 CTAACGTCCTGACATTGCCATGG - Intergenic
990709885 5:58568489-58568511 CACAAGCCCTACCATTTACAAGG + Intergenic
992023475 5:72648465-72648487 CTCAAACCCTGCCTTCTCCATGG + Intergenic
994434662 5:99711602-99711624 CTCCAGACCTGCAATTGGCAGGG + Intergenic
998671884 5:144362778-144362800 CCCAAGCCCTGCCACTGGCTAGG + Intronic
999124427 5:149236517-149236539 CTGAAGCCATGCCTTTTCCACGG - Intronic
1002419273 5:179137267-179137289 CACAAGCACTGCCATGCCCAAGG + Intronic
1002441816 5:179268223-179268245 GTCCAGCCCTGGCCTTGCCATGG - Intronic
1003117632 6:3293837-3293859 CCCAAGCTCTGTCATTGCTAGGG + Intronic
1005499965 6:26421174-26421196 CTCAAGCCTTGAGATTCCCAAGG - Intergenic
1008670095 6:53759478-53759500 CTTAAGCTCTTCCATTGGCAAGG + Intergenic
1009734745 6:67662563-67662585 CTAGCGCCCTGCCATAGCCAGGG - Intergenic
1013613419 6:111818105-111818127 CTCATGCCATGCCAATGCAAGGG + Intronic
1014972845 6:127839877-127839899 GTCAGGCCCTGCCATTTTCAAGG + Intronic
1017444595 6:154495902-154495924 CTCAACCCTCCCCATTGCCACGG + Intronic
1017715874 6:157212765-157212787 CTCATGCCTGGCCATTGCCCCGG + Intergenic
1019338384 7:495680-495702 CTCACACCGTGCCCTTGCCAGGG - Intergenic
1020406305 7:7839446-7839468 CTCAAGCCCTTCTCTTGCCTCGG + Intronic
1021456176 7:20831584-20831606 CTGAAGGCCTGCCCTTGGCAAGG + Intergenic
1022594759 7:31702460-31702482 CTCAAGCTCTGCCACTGTCCAGG + Intronic
1026986660 7:74559255-74559277 CTCAAAGGCTGCCCTTGCCATGG - Intronic
1031732534 7:125316342-125316364 TTCACACCATGCCATTGCCAGGG - Intergenic
1035446642 7:158947738-158947760 CTCATGCTCTGCCAGTGCCCAGG + Intronic
1036148471 8:6276068-6276090 CTCAAGGCCTGGCATTGTCCTGG - Intergenic
1037118707 8:15257074-15257096 CACAAGCCCTGCCAATGTCAAGG + Intergenic
1041472400 8:58225354-58225376 CTACAGCCTTGCCACTGCCAAGG + Intergenic
1041889825 8:62856547-62856569 CTTAGGCACTGTCATTGCCATGG + Intronic
1042288113 8:67136822-67136844 CTCTAACCCTGCCAGTTCCATGG - Intronic
1045877262 8:106996604-106996626 CTCAAGCCCAGCTTTTCCCATGG + Intergenic
1048333490 8:133486634-133486656 CCCCAGTCCTGCCATTGACAGGG - Intronic
1049343560 8:142126704-142126726 CTCCAGCCCTGCCAGAGCCCAGG - Intergenic
1050431051 9:5562111-5562133 CCCAACTCCTGCCATTGCCTGGG - Intronic
1052043478 9:23767972-23767994 CTCCAGCCACTCCATTGCCATGG + Intronic
1053803543 9:41778877-41778899 CACAGGTCTTGCCATTGCCACGG - Intergenic
1055199426 9:73641413-73641435 CACAAGCCCTGCCATTTTCTTGG - Intergenic
1055522854 9:77099435-77099457 CTCAAGCCCTGGCCTTACCTGGG - Intergenic
1056390058 9:86132690-86132712 CTCAAGCCTTGCCACTTCCAGGG - Intergenic
1057940236 9:99275659-99275681 CAGAAGCCCTGACATGGCCAGGG - Intergenic
1058937757 9:109784860-109784882 CTCAAGCTTTCCCATTGCAATGG - Intronic
1060797302 9:126521692-126521714 CTCACCCCCAGCCAGTGCCAGGG + Intergenic
1061037320 9:128120935-128120957 TTCCAGCCCTGCCACTGCCCTGG - Exonic
1062205797 9:135336210-135336232 CTCAAGCCCAGCCGCTGGCACGG + Intergenic
1062387877 9:136321510-136321532 CCCAAGCCCTGCCATTCCTCAGG + Intergenic
1185684231 X:1914854-1914876 CTCAAGCTCAGCCAATGCAAAGG - Intergenic
1189827837 X:44938191-44938213 CTCAAGCCATCCCCTTGCCTTGG + Intronic
1191641507 X:63432917-63432939 CTTAAGCCCTGACACTGCCGAGG - Intergenic
1196059093 X:111388263-111388285 CTGAAGTCCTGCCTTTACCATGG + Intronic
1196556553 X:117091377-117091399 CTCAAGCCATGCCCCTGCCTTGG + Intergenic
1198031937 X:132761512-132761534 CCCAAGCCCTGCCATTTCCCAGG + Intronic
1199690399 X:150305129-150305151 CTCAAGCCATGCTCTTGCCTCGG - Intergenic