ID: 1179319735

View in Genome Browser
Species Human (GRCh38)
Location 21:40278808-40278830
Sequence AACATTTATCACTATATGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 1, 2: 2, 3: 13, 4: 240}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179319735_1179319737 -7 Left 1179319735 21:40278808-40278830 CCTAGCATATAGTGATAAATGTT 0: 1
1: 1
2: 2
3: 13
4: 240
Right 1179319737 21:40278824-40278846 AAATGTTGGTGATCATTATGAGG 0: 1
1: 0
2: 0
3: 24
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179319735 Original CRISPR AACATTTATCACTATATGCT AGG (reversed) Intronic
902357182 1:15912883-15912905 AACTTTTATCTCTAGATGGTAGG + Intronic
902957901 1:19938957-19938979 AAGATTCATCATTATATCCTTGG + Intergenic
905112709 1:35608493-35608515 AACATTTATCATTTTGTGTTGGG - Intronic
905197461 1:36291511-36291533 AACAATGGTCACTATATGTTGGG - Exonic
905918511 1:41702745-41702767 ATCATTTATTAATATCTGCTGGG - Intronic
908567524 1:65373059-65373081 AATATTTATCTTTCTATGCTTGG + Intronic
908622581 1:66000953-66000975 AACATGGATGATTATATGCTTGG + Intronic
910581738 1:88835067-88835089 AACATTTATAAATATTTGCTGGG + Exonic
911503524 1:98719175-98719197 CACATTTAGCACTATGAGCTAGG - Intronic
911878578 1:103202721-103202743 AACAATTATTAATATATCCTAGG + Intergenic
911973525 1:104464869-104464891 AACATTTATGACCTTCTGCTGGG - Intergenic
912159033 1:106958323-106958345 AACATTTCTTCCTATATACTTGG - Intergenic
912616412 1:111104657-111104679 AACATTTATTTCTTTGTGCTGGG + Intergenic
914356189 1:146886437-146886459 AACATTAATTACTTGATGCTTGG - Intergenic
915808673 1:158882155-158882177 AAAATTTATTAATATCTGCTTGG - Intergenic
917950644 1:180029837-180029859 AACAGTTGTCACTAGGTGCTGGG - Intronic
918094012 1:181319713-181319735 ATCATTTATCTCTATCTGCATGG - Intergenic
918775181 1:188619811-188619833 CACATATATCATTATAAGCTTGG - Intergenic
918987961 1:191658556-191658578 AACATTTAACAGTATAAGTTGGG - Intergenic
920050310 1:203160837-203160859 AACATTTATTTCTATGTGCTGGG - Intronic
921203935 1:212831981-212832003 CCCATTTATCACTATCTGATCGG + Intronic
921835274 1:219772078-219772100 AATATTTATTACTCTAAGCTTGG + Intronic
1068798017 10:61105529-61105551 AACACTTATTACCATCTGCTGGG - Intergenic
1069085574 10:64135901-64135923 AACATTTATTACTTTATTTTAGG - Intergenic
1069677953 10:70262223-70262245 AACATCTATCAGGATATGGTTGG + Intronic
1071433563 10:85625736-85625758 AACATTTAGCAGAATATGATTGG + Intronic
1074461542 10:113642643-113642665 AGCATTCATCACTATGAGCTGGG + Intronic
1075270169 10:121042642-121042664 CACATTTATTAATATATGCCAGG - Intergenic
1078043623 11:7892862-7892884 AACATTTATCTCTATAGGCATGG - Intergenic
1080833755 11:35920624-35920646 AACATTTTTCACTGTATGGAAGG + Intergenic
1087993297 11:104772348-104772370 ACGATTTATTACCATATGCTTGG + Intergenic
1088215717 11:107506345-107506367 ATAATTTTTCACTGTATGCTGGG - Intronic
1088444679 11:109912916-109912938 AACACTTAACACTATGTACTTGG - Intergenic
1089841479 11:121422186-121422208 TACATTTATAGCAATATGCTAGG - Intergenic
1091362997 11:134993075-134993097 AACATTTATTAATAGGTGCTTGG - Intergenic
1092800981 12:12166423-12166445 AATATTTATCACTCTGTGTTGGG - Intronic
1093323564 12:17744240-17744262 AACAATACTTACTATATGCTTGG + Intergenic
1095932949 12:47647656-47647678 AACATTGATCACTATATTTATGG + Intergenic
1098934905 12:76467397-76467419 AACATTTCTACCTATATGTTTGG + Intronic
1099064867 12:77963431-77963453 AACATTTGTTAGTATATACTAGG - Intronic
1099703763 12:86123568-86123590 AACATTTATTACTGAGTGCTTGG + Intronic
1100541813 12:95564375-95564397 CACTTATATCACTATTTGCTAGG - Intergenic
1100695014 12:97083548-97083570 AAAATTTCTCACCATATGCCAGG + Intergenic
1101485322 12:105151807-105151829 AATATTTATCTCTAAATACTAGG - Intronic
1101820786 12:108182876-108182898 AACTTCTAGCACTCTATGCTGGG - Intronic
1102195629 12:111023326-111023348 ATAATTAATCACTATGTGCTAGG - Intergenic
1103257979 12:119559378-119559400 AACATTGATCACTTTGTGTTTGG + Intergenic
1103394703 12:120598699-120598721 AGCATTTATCACTGTGTGCCAGG - Intergenic
1105277130 13:18942555-18942577 AAAATTTATCAGAATATGATAGG - Intergenic
1109592128 13:64499395-64499417 AACACTTATCACCAAAGGCTGGG - Intergenic
1110658643 13:78031841-78031863 AACATGTCTCATTATATTCTAGG + Intergenic
1110770461 13:79337601-79337623 AACATTTAACACTGCATACTTGG - Intronic
1111355530 13:87096181-87096203 ATAATTTATCAGTGTATGCTAGG + Intergenic
1111825430 13:93261804-93261826 AACATTTTTCACTATATACCAGG - Intronic
1112472845 13:99705077-99705099 AACACTTTTCGGTATATGCTTGG - Intronic
1113304923 13:109067280-109067302 AACATTTATCAGTATTTACTAGG + Intronic
1114136219 14:19854821-19854843 AACATTTATCATTTTTTGTTGGG + Intergenic
1118641905 14:67800311-67800333 AACATACATCTCTTTATGCTAGG - Intronic
1120054116 14:79902016-79902038 AAGAGTTATCTATATATGCTGGG + Intergenic
1120129445 14:80787682-80787704 AACATATATCACTATATTGAAGG - Intronic
1121490420 14:94355147-94355169 AACCTCTATCATTACATGCTGGG - Intergenic
1122646771 14:103199765-103199787 TAAATTTATCAGTATAGGCTGGG + Intergenic
1124360175 15:29030902-29030924 ACCTTTTATCATTATTTGCTTGG + Intronic
1124810367 15:32930989-32931011 AACATTTGCCTGTATATGCTTGG + Intronic
1127290998 15:57571047-57571069 AACAATTATAACAATATGCCAGG + Intergenic
1127764470 15:62171573-62171595 AATAATTATAACTATATCCTAGG + Intergenic
1131205114 15:90438370-90438392 AATGTTTATTAATATATGCTAGG + Intronic
1131362000 15:91801165-91801187 TACATTTATCAATAAATGCCAGG - Intergenic
1131448596 15:92520132-92520154 AACATTTATAAATATAGGCCAGG + Intergenic
1134101395 16:11454571-11454593 AACATCCATCACCAAATGCTTGG + Intronic
1135695018 16:24577938-24577960 AACATTTGTTACTATGTGCAAGG - Intergenic
1138132411 16:54492122-54492144 AACAATTATAACAATATACTGGG + Intergenic
1139670599 16:68490489-68490511 AACATTTATCAATGTCTCCTAGG + Intergenic
1139977828 16:70829025-70829047 AACATTAATTACTTGATGCTTGG + Intronic
1140655891 16:77139239-77139261 AATATTTACCTCTATATACTTGG + Intergenic
1141135441 16:81461887-81461909 AACATTCAGCAGTATGTGCTGGG + Intronic
1143841992 17:9739746-9739768 AACATTTACTACTACATGCCAGG + Intergenic
1147124550 17:38357198-38357220 AACTTTTTTCACTGTATCCTTGG + Intronic
1147211180 17:38873336-38873358 ACTAGTTATCACGATATGCTGGG + Intronic
1148480485 17:47956871-47956893 ACCATGTGTCACTAAATGCTGGG - Intronic
1150767896 17:68016741-68016763 AACATTCAGCACTAAGTGCTCGG + Intergenic
1156069889 18:33194249-33194271 AATCTTTATAACTATATGCTTGG + Intronic
1156766016 18:40656443-40656465 AACATTTTTCCATATATTCTTGG - Intergenic
1157012860 18:43672313-43672335 AACATTTGTCACTAGGTGCCGGG + Intergenic
1157893455 18:51441314-51441336 ATCATTTAGCACTATCTTCTTGG - Intergenic
1159460571 18:68717478-68717500 AAAATTTATAATTATATACTTGG + Intronic
1162672608 19:12269657-12269679 AACATTTATAACTATTGGCCAGG - Intronic
1164450466 19:28358425-28358447 AAAATTTATCACTAAATTCAAGG - Intergenic
929869516 2:45746463-45746485 AACATTTATACCTTCATGCTTGG + Intronic
931269762 2:60691074-60691096 TTCATTTATCACCATAAGCTTGG - Intergenic
931934750 2:67184937-67184959 TCCATTTATCACTACAAGCTAGG + Intergenic
933502781 2:83136654-83136676 AAGTTTTTTCACTATATACTAGG + Intergenic
936787122 2:116107114-116107136 AACAATTATAACAATATGCCAGG + Intergenic
937540271 2:122941697-122941719 AACTTTTATCTATTTATGCTAGG + Intergenic
939198053 2:138997927-138997949 GACATTTATCACAAAATCCTGGG - Intergenic
939434343 2:142154592-142154614 AACATTTATATGTATATGCAAGG - Intergenic
939944353 2:148390854-148390876 AACAATTATTACTATAGGCTGGG - Intronic
940494258 2:154405449-154405471 AACATTAATAACTATAGGCAGGG + Intronic
940906756 2:159176558-159176580 AACATTTATCACTGTAAAATTGG - Intronic
941788393 2:169523472-169523494 GGCATTCATCACTATCTGCTTGG + Intronic
941791131 2:169553586-169553608 ATCATTTTCAACTATATGCTTGG + Intronic
942754686 2:179326456-179326478 AACAATTATCATCATATTCTAGG - Intergenic
942870013 2:180723146-180723168 TACATTTATAATTATATGCCAGG + Intergenic
943394951 2:187322519-187322541 AACACTTATAACCATATCCTTGG - Intergenic
943999784 2:194818969-194818991 AAAATTTAGAACTATATGCTAGG - Intergenic
945548409 2:211187689-211187711 AAATTTTATCACCATCTGCTGGG + Intergenic
945664868 2:212728157-212728179 AACATATTTCATTATAAGCTGGG + Intergenic
945738421 2:213630505-213630527 AACATTTATCAGTGTGGGCTGGG + Intronic
946920380 2:224574865-224574887 AACATTGTGTACTATATGCTGGG + Intronic
947083660 2:226426529-226426551 AACATATATCACTACACACTTGG - Intergenic
947335182 2:229074996-229075018 AATATTTTTCACCATATGGTGGG - Intronic
948494880 2:238341315-238341337 AAAATATGTAACTATATGCTGGG - Intronic
1169214917 20:3787525-3787547 TACATTTATGGCTATATGCATGG - Intronic
1170135255 20:13066544-13066566 CACATTTTTCAGTATATGCAAGG - Intronic
1170377427 20:15715919-15715941 ATTGTTTATCACTATATGCATGG - Intronic
1170393085 20:15896131-15896153 AACATTGATAACTCTAAGCTGGG - Intronic
1170520059 20:17175755-17175777 AACATTTAGGAGGATATGCTTGG - Intergenic
1174575604 20:51534806-51534828 GACTTTTCTCACCATATGCTGGG + Intronic
1176813615 21:13573002-13573024 AACATTTATCATTTTTTGTTGGG - Intergenic
1178138957 21:29660060-29660082 AACTGTTATCAATATATCCTGGG + Intronic
1178634900 21:34293728-34293750 AACATCTAGCACAATATGCCTGG + Intergenic
1178948722 21:36968409-36968431 AAAATCTATCGCTATATGCAAGG - Intronic
1179319735 21:40278808-40278830 AACATTTATCACTATATGCTAGG - Intronic
1181945245 22:26511953-26511975 AGCCTTTATCAGTAGATGCTAGG + Intronic
1182262796 22:29087392-29087414 AACATTTTTCTCTATATTCTTGG - Intronic
950947376 3:16963637-16963659 TACTTTTATGAGTATATGCTGGG - Intronic
950998051 3:17525873-17525895 AATATTTATTATTATATGCCAGG - Intronic
951850474 3:27133983-27134005 AATAATTATGACTATTTGCTGGG - Intronic
952112954 3:30145596-30145618 AACTCTTATCCCTAAATGCTTGG + Intergenic
957008564 3:74979497-74979519 TTCATTTATCATAATATGCTAGG + Intergenic
957177571 3:76831081-76831103 AGCATTTATCACAGTTTGCTAGG + Intronic
959044414 3:101456580-101456602 AACAATTATCTTTTTATGCTAGG + Intronic
959048428 3:101500258-101500280 AAAAATTATCTCTATATGCCAGG + Intronic
959726856 3:109552979-109553001 AACATTTATGTCTAAGTGCTGGG - Intergenic
959806632 3:110562318-110562340 AACATTTCTCAATATACCCTGGG - Intergenic
959892052 3:111568033-111568055 AACACTTATTACTACATCCTGGG + Intronic
960245272 3:115393554-115393576 TACATTAATCACTATTTACTTGG + Intergenic
961188302 3:124935179-124935201 AACTTTTGTCACTGTATGCTGGG + Intronic
962558955 3:136585799-136585821 AGAATTTCTCACTATTTGCTAGG - Intronic
963703764 3:148659827-148659849 ATGATTTATGACTGTATGCTAGG + Intergenic
964735096 3:159908783-159908805 AATATTTAAAACCATATGCTGGG + Intergenic
964840247 3:160985586-160985608 AATATTTATCACCACTTGCTTGG - Intronic
965461091 3:168964353-168964375 TACATCTATCATTATATGCATGG - Intergenic
965975817 3:174620545-174620567 AATATTTTTCACAATATTCTAGG - Intronic
965984127 3:174731128-174731150 AACATTTATGACTTTGAGCTGGG + Intronic
966855640 3:184192261-184192283 AACATTTATCACTTTATGTTGGG + Intronic
967460173 3:189736984-189737006 AACATTTATTCCTATATATTTGG - Intronic
967534342 3:190585514-190585536 AACATGTGTCACTTTAGGCTGGG + Intronic
967695524 3:192527047-192527069 AAATTTTATCAATATATGTTTGG - Intronic
970482477 4:16490560-16490582 AACAATGATAACTATTTGCTTGG + Intergenic
970861315 4:20706111-20706133 AACATTTTTCACTTTAGACTTGG + Intronic
972052118 4:34750079-34750101 AAAATTTATCATTTTATTCTAGG + Intergenic
973672482 4:53235334-53235356 AACATTTATCAATTTATGGCAGG + Intronic
974086708 4:57269106-57269128 GACATTTAAAACTGTATGCTGGG - Intergenic
974145298 4:57938900-57938922 AACCTTTTTCACTCTATGTTTGG + Intergenic
974481489 4:62449503-62449525 AACATATGACACTATATGTTAGG - Intergenic
974523501 4:63017412-63017434 AACTCTTTTCACTATATTCTAGG - Intergenic
974772174 4:66430847-66430869 AACATATATCAGTATATTTTAGG + Intergenic
975941623 4:79654591-79654613 AACATTTTCTACTATATGATTGG - Intergenic
978714878 4:111829945-111829967 ACCATTTATCACAATCTGATAGG + Intergenic
980206874 4:129731319-129731341 AAAATTTTTCAAAATATGCTTGG - Intergenic
980684114 4:136203158-136203180 AAGATATATGAATATATGCTGGG + Intergenic
981018383 4:139999611-139999633 AACATTTATTTTTAAATGCTGGG + Intronic
981368796 4:143934193-143934215 AACATTTAGAAGTATAGGCTGGG + Intergenic
981422437 4:144566618-144566640 AACATTTATCGCTAAGTTCTGGG - Intergenic
981487058 4:145297901-145297923 GAAATTAATCAGTATATGCTGGG - Intergenic
982156603 4:152528895-152528917 AACATCTAGCACAATACGCTAGG + Intronic
982613553 4:157610673-157610695 AACATTTATCCCAATATCCAAGG + Intergenic
982925014 4:161325692-161325714 AAGGTTTGTCACTATATGTTTGG - Intergenic
983147940 4:164241483-164241505 AACACTTATCATTGTATACTGGG - Intronic
983592237 4:169426949-169426971 AATTTTTATCTCTATATGCCTGG + Intronic
983772827 4:171571900-171571922 AACATTTATCACTGTAACCTGGG + Intergenic
984264372 4:177479048-177479070 AATATTTTTCACTATTAGCTTGG + Intergenic
986412840 5:7498917-7498939 AACATATATCCTTTTATGCTTGG - Intronic
986566789 5:9123668-9123690 AACATTTATCATTAAAGACTTGG + Intronic
988969184 5:36448986-36449008 TTCATTTATCACTTTATGCCTGG + Intergenic
989775552 5:45202580-45202602 AAAATTGCTTACTATATGCTAGG + Intergenic
990561183 5:56984819-56984841 AACATTTGTCATTATATGACAGG - Intergenic
992925183 5:81576357-81576379 TACATATAACACTATATGTTAGG + Intronic
993362469 5:86994824-86994846 AACATTTATCAGTTTCTTCTAGG + Intergenic
993619802 5:90154698-90154720 AACATTAATAAATATTTGCTGGG + Intergenic
994218502 5:97166453-97166475 AACATTTTTCAGTACATGTTTGG - Intronic
994814635 5:104569360-104569382 ACCATATATCTCTATAAGCTTGG + Intergenic
995175600 5:109172985-109173007 AAGCTTTATCACTATATGTTTGG + Intronic
995260406 5:110097357-110097379 CACATTTATTACTTTATGGTGGG + Intergenic
996139558 5:119889491-119889513 GACATTTATCTTTATGTGCTTGG + Intergenic
996155921 5:120100120-120100142 AACAGTTATTAGTAGATGCTGGG - Intergenic
996630711 5:125628946-125628968 AACATCTATCACAATAAGGTGGG + Intergenic
997096384 5:130918119-130918141 AACATTTGTCTCTTTTTGCTTGG - Intergenic
998599825 5:143574236-143574258 AACACTTGGCACTATATGCCAGG - Intergenic
999940589 5:156538285-156538307 AACATTTAACTCTAAATTCTGGG - Intronic
1000500488 5:162042675-162042697 AGGATTTATAACTATATGATGGG + Intergenic
1000796752 5:165673611-165673633 CACTTTTATAACTATAAGCTTGG + Intergenic
1001969748 5:175945820-175945842 AATATTTATCTGTTTATGCTTGG - Intronic
1002247687 5:177897948-177897970 AATATTTATCTGTTTATGCTTGG + Intergenic
1004113768 6:12747664-12747686 AAATTTAATTACTATATGCTGGG + Intronic
1004413314 6:15401450-15401472 AACATTTATTTTTAAATGCTGGG - Intronic
1009022958 6:57964320-57964342 AATATTTGTCATTCTATGCTTGG - Intergenic
1012295800 6:97521639-97521661 AACCTTTATCATAAAATGCTTGG - Intergenic
1012304365 6:97633172-97633194 TACATTTAACAATATATCCTGGG + Intergenic
1012607709 6:101178430-101178452 AAGATTTATCTCTACATGTTGGG + Intergenic
1012713517 6:102638587-102638609 AACATTTGTCACTAAATGTGTGG - Intergenic
1013599441 6:111690649-111690671 AACATTTATCACTATGTGCTGGG + Intronic
1018539170 6:164858907-164858929 AACATATATCAGTCTTTGCTAGG - Intergenic
1020726498 7:11821205-11821227 AACAATGGTCACTATATGTTGGG + Intronic
1021103182 7:16607263-16607285 AACATTAATCATTATACTCTAGG + Intronic
1021290138 7:18833105-18833127 AACCTTTATCACTAAATATTTGG + Intronic
1021392663 7:20113159-20113181 TTCATTAAACACTATATGCTAGG - Intergenic
1021435623 7:20611867-20611889 AACATATAGCACTATATTGTTGG + Intergenic
1021831363 7:24614877-24614899 CACATTTATGACCATATGTTAGG + Intronic
1022054099 7:26711386-26711408 AACATATCTCACTATCTGCAAGG - Intronic
1024472595 7:49778383-49778405 ATCATTTATTACCAGATGCTGGG + Intronic
1024873413 7:53992603-53992625 AACATTTAACAGTGTATGGTTGG + Intergenic
1025078068 7:55960418-55960440 CACATGTGTCACCATATGCTAGG - Intronic
1026055280 7:66978322-66978344 AACATTTATACCTAAATTCTGGG + Intergenic
1026209023 7:68286694-68286716 AACATTTGTCCTTATGTGCTTGG - Intergenic
1026722421 7:72843511-72843533 AACATTTATACCTAAATTCTGGG - Intergenic
1031801083 7:126246717-126246739 AATATTTATCTTTTTATGCTTGG + Intergenic
1032271559 7:130412771-130412793 AACATTTCTAAGTGTATGCTGGG + Intronic
1032460821 7:132109172-132109194 AGCAATTATCAGTATATGCAAGG + Intergenic
1033476279 7:141696317-141696339 AAAATTCATCACTATTTCCTAGG + Intronic
1033501378 7:141953841-141953863 ATAATCTATCACTATATTCTGGG + Intronic
1034907259 7:154960897-154960919 AAGATTTAAAACTAAATGCTGGG + Exonic
1041348674 8:56927515-56927537 AGCATTTATCAATATCTGCAGGG + Intergenic
1041681793 8:60601289-60601311 AACATTAATTATTATTTGCTAGG - Intronic
1041775571 8:61519193-61519215 AAAATTTATCAACATATGCATGG - Intronic
1042819999 8:72919771-72919793 GACATTTGTCATAATATGCTCGG + Intronic
1043971447 8:86533565-86533587 AACATTTTAGACTATAGGCTGGG + Intronic
1044327103 8:90870814-90870836 AACATTTATTGCTATGTGCCAGG - Intronic
1044629260 8:94262951-94262973 AATATTTAGCACAATCTGCTTGG - Intergenic
1046425894 8:114048371-114048393 AACATTTTTAACTATATAGTTGG - Intergenic
1046801324 8:118431394-118431416 AACTTTTATCACTACTTGCAGGG + Intronic
1047572285 8:126112104-126112126 TTCATTCATCACTAGATGCTTGG + Intergenic
1048695094 8:137018776-137018798 AACATTAATCACTATATTTAAGG - Intergenic
1049233885 8:141498665-141498687 AACAATTATAACTATAAGGTTGG + Intergenic
1049975590 9:858576-858598 AAAATTTATCATTTTAGGCTGGG + Intronic
1050228844 9:3494365-3494387 AACATTTATCAGTACATGACTGG - Intronic
1050770238 9:9189697-9189719 ACCATTTATCACTGTATGCTAGG - Intronic
1051200052 9:14607437-14607459 ATCATATATCATTATATGATAGG + Intergenic
1052319140 9:27149053-27149075 AACCTTTATTACTATGGGCTGGG - Intronic
1055727825 9:79250585-79250607 AATATTTATAAATATTTGCTTGG - Intergenic
1055946296 9:81694252-81694274 AACATTTATCTCTCCATGTTTGG - Intergenic
1057249393 9:93487921-93487943 AACATTCATCACTCTCTCCTGGG + Intronic
1059437409 9:114284961-114284983 CACATTCAGCACTATGTGCTGGG + Intronic
1060324585 9:122601023-122601045 AACAAGAATGACTATATGCTGGG + Intergenic
1060555693 9:124506256-124506278 AACATGTTCCACTTTATGCTCGG - Intronic
1061465911 9:130779563-130779585 TACATTTAGCCCTTTATGCTTGG + Intronic
1188328083 X:28832082-28832104 AACATTTATTTCTTTATGTTAGG + Intronic
1188999284 X:36925180-36925202 TACATTTTCCACTATATGTTAGG + Intergenic
1190412764 X:50153423-50153445 TACATTTATCAGTTTATCCTAGG + Intergenic
1190944511 X:55078218-55078240 AACATTTGTCACTATTTTCACGG - Intronic
1190945754 X:55092151-55092173 AACATTTGTCACTATTTTCACGG - Intronic
1191025599 X:55909574-55909596 AACATTTGTCTCCATATCCTGGG - Intergenic
1192905864 X:75549557-75549579 AACATTAATCTATGTATGCTGGG + Intergenic
1198018599 X:132636043-132636065 AACATGTATCACAATGTGCTGGG + Intronic
1199323336 X:146467572-146467594 AACATATATCATAATATGTTAGG - Intergenic
1199533961 X:148880951-148880973 AACATGTATGACCATATGTTAGG + Intronic