ID: 1179320160

View in Genome Browser
Species Human (GRCh38)
Location 21:40283849-40283871
Sequence ATCCAGAGGGGTCCCCTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 76}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179320156_1179320160 10 Left 1179320156 21:40283816-40283838 CCTGCATGCAAGGAGAGCTTGGT 0: 1
1: 0
2: 0
3: 7
4: 141
Right 1179320160 21:40283849-40283871 ATCCAGAGGGGTCCCCTTGTAGG 0: 1
1: 0
2: 0
3: 12
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179320160 Original CRISPR ATCCAGAGGGGTCCCCTTGT AGG Intronic
902650024 1:17831058-17831080 AGCCAGAGGTGTCTTCTTGTAGG + Intergenic
903112076 1:21144335-21144357 ATCTTGAGGGATCCCCTTGAGGG + Intronic
907360851 1:53913413-53913435 ACCCAGAGCAGTCCCCTTCTGGG + Intergenic
915649231 1:157295337-157295359 ATCCAGTTGTGTTCCCTTGTTGG - Intergenic
916779601 1:168010389-168010411 ATCTAGAGGGGTCACAGTGTTGG + Intronic
919206217 1:194424037-194424059 ATGCTGAGAGGTCCTCTTGTGGG - Intergenic
919825548 1:201500662-201500684 ACCTGGAGGGGTCCTCTTGTGGG - Intronic
1069749588 10:70736747-70736769 ATCCAGCGGGGGCCCCTTCTTGG - Exonic
1070789863 10:79182568-79182590 ATCCACTGGGGTCACCTTGCTGG - Intronic
1075591080 10:123692220-123692242 ATTCAGAGGTGTCCCCTTGGGGG + Exonic
1084268853 11:68018686-68018708 ACCCAGAGGGGCCACCCTGTGGG - Intronic
1085050442 11:73377418-73377440 CTCCTGAGGGGTGCCCTCGTGGG - Intronic
1086876526 11:92103165-92103187 CTCCAGAGGGGGCCCATGGTTGG - Intergenic
1089334485 11:117713705-117713727 GTTCAGATGTGTCCCCTTGTCGG + Intronic
1096843756 12:54394052-54394074 ATTAAGAGGAGTCCCCTTCTTGG - Intergenic
1099216710 12:79862079-79862101 ATACAGGGGGGTGCCCTTCTAGG + Intronic
1100985857 12:100201032-100201054 AGCCAGAGGGATTCCCTGGTTGG + Intronic
1108673910 13:52720357-52720379 ATCCAGATTTGTTCCCTTGTTGG + Intronic
1112486903 13:99828027-99828049 CTCCTGAGGGGTGCCCTTCTGGG + Intronic
1117998885 14:61504605-61504627 ATTGAGAGGGGTCCCTCTGTAGG + Intronic
1119874524 14:78046221-78046243 ATCCAGAGGTGGGCTCTTGTTGG + Intergenic
1121535112 14:94685836-94685858 ATCCAGCTGGGCCCCCCTGTAGG - Intergenic
1123724520 15:23088698-23088720 ATCCAGCCGGGTCTCCATGTTGG - Intergenic
1125920899 15:43525084-43525106 ATCCAGGGAGGTCTCCTTGCTGG - Exonic
1132367941 15:101271234-101271256 ATCTAGAGAGAACCCCTTGTAGG - Exonic
1134077330 16:11301012-11301034 ACCCAGGGTGGACCCCTTGTGGG - Intronic
1140263602 16:73401433-73401455 TTCCACTGGTGTCCCCTTGTGGG + Intergenic
1144852134 17:18249132-18249154 GTCCAGAGAGGTCCCCTTGAGGG + Exonic
1145204401 17:20974872-20974894 ATCCAGAGAGGTGCCCTGGTGGG - Intergenic
1147627364 17:41908846-41908868 AAGCAGAGGGGTCCCCATGCAGG - Intronic
1148619404 17:49022930-49022952 ATCCAGAAGTGTTCCCTTGAGGG + Intronic
1153562115 18:6382356-6382378 ATCCAGTGTTGTCCCCTTGCTGG + Intronic
1157088483 18:44607077-44607099 ATCCAGAAGGCTCCCAATGTTGG - Intergenic
1159752921 18:72325167-72325189 ACCTAGAGGCGTCCCCTTGTCGG + Intergenic
1159790694 18:72776356-72776378 ATTGAGAGGGGTAACCTTGTGGG - Intronic
1160403749 18:78630056-78630078 AACCAGAGGGGCCTCCTTGTTGG + Intergenic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1161936750 19:7376850-7376872 ATCCTGGAGGGTCCCCTTGGTGG + Intronic
1162034378 19:7931438-7931460 TTCCAGGGGGGTCCCCCTGTGGG - Intronic
1162396774 19:10421615-10421637 ATCCAGAGGGTGCCTCTTGGGGG + Intronic
1165740768 19:38203929-38203951 ATCCACAGAGGTGCCCTTGGTGG + Intronic
925333148 2:3074380-3074402 AACCAGAGAGTTCCCCTTGCAGG + Intergenic
927657037 2:24957795-24957817 TTCCAGAGGGGTTACCTTGTTGG + Exonic
932115651 2:69044409-69044431 ATACAGATTGGTCCCCTTGTTGG + Intronic
932882636 2:75518146-75518168 ATCCAGAGGGGACCTCCTGGAGG + Exonic
933533101 2:83535456-83535478 ATCCGGTGAGGTCCCCTGGTTGG + Intergenic
934525782 2:95050741-95050763 ATCCTGAGGGGGCCCTTTTTAGG - Intronic
938427398 2:131202973-131202995 AACCTGAGGGTTCCCCATGTAGG + Intronic
938468342 2:131537021-131537043 AACCCGAGGGTTCCCCATGTAGG + Intergenic
1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG + Exonic
1174181875 20:48680062-48680084 AGCCAGAGGGGTCCCAGTGCAGG - Intronic
1176256194 20:64154413-64154435 GGCCAGAGGGGTCCCCTGCTAGG - Intronic
1179320160 21:40283849-40283871 ATCCAGAGGGGTCCCCTTGTAGG + Intronic
1184405825 22:44300281-44300303 AGCCAGAGGGGGCTCCTTGCTGG + Intronic
1185362813 22:50419152-50419174 CTCCAGAGGAGTCACCTGGTGGG + Intronic
954598846 3:51852185-51852207 AAGCTGAGGGGTCCTCTTGTGGG - Intergenic
968791924 4:2671074-2671096 ATCCACAGGGGCTCCATTGTTGG + Intronic
969681442 4:8645519-8645541 ATCCAGAGGTGTCCTGTTGATGG - Intergenic
969901033 4:10349639-10349661 ATCCAGTGGGGTTTCCTTGAAGG - Intergenic
971730123 4:30368457-30368479 CTCCAAAGGTGTCCCCTTATTGG - Intergenic
985970493 5:3374279-3374301 ATCCACAAAGGTCTCCTTGTGGG - Intergenic
990940717 5:61200533-61200555 AACCAGTGGGGCCTCCTTGTGGG - Intergenic
993904886 5:93611983-93612005 AGCCAGACGCGTCCCCTTTTTGG + Intergenic
996312841 5:122126279-122126301 ATCCAGATCTGACCCCTTGTGGG - Intergenic
1000150623 5:158497172-158497194 AGCCAGAGATGTCCCCTTGCTGG - Intergenic
1001489676 5:172146559-172146581 ATCCAGAGTGGTCACCTGGCCGG + Intronic
1002055643 5:176596722-176596744 ACGCAGAGGGGACCCCTTCTAGG + Exonic
1003750704 6:9052132-9052154 ATCCAGAGCCCTTCCCTTGTTGG + Intergenic
1008596710 6:53049622-53049644 ATGCAGAGTGGTCCCCATGTTGG - Intronic
1022615751 7:31927906-31927928 ATCCAGTTGTGTGCCCTTGTTGG - Intronic
1029969236 7:104773144-104773166 AGCCAGAGAAGTCCCCTGGTGGG + Intronic
1039455281 8:37701867-37701889 AACCAAAGGGCTCCTCTTGTTGG + Intergenic
1049839920 8:144764401-144764423 ATCCAGAGAGTTCCCTTTGTGGG + Intergenic
1050811463 9:9753303-9753325 GTCCAGAGGGGTCCCTGTATTGG - Intronic
1053274670 9:36774190-36774212 ACACAGATGGGTCCCCTTGAAGG - Intergenic
1058071017 9:100600756-100600778 ATCCAAAGGCCTGCCCTTGTGGG + Intergenic
1060991340 9:127851013-127851035 ATCCAGATGGGTCCACATTTTGG - Intronic
1186991420 X:15073319-15073341 ATCCAGAATGGTCGCCTTTTGGG + Intergenic
1188895247 X:35659358-35659380 ATCCTGAGGGGTCCCAGTCTCGG - Intergenic
1189047713 X:37611071-37611093 ATCCAGAGTTGTCCCCTAGAAGG + Intronic
1189220425 X:39367231-39367253 ATCCAGAGAGGGCCCCTTTGGGG - Intergenic
1192180457 X:68912643-68912665 CTCCAGAGGGGTGCCCTCGTAGG + Intergenic
1192990868 X:76454599-76454621 GCCCATAGGGGTCCCCTTGAAGG + Intergenic
1193061605 X:77213825-77213847 ATCCATAGGGGCCACCTTGCTGG + Intergenic
1194448818 X:94017207-94017229 ATCCAGATGGGTCCACGTGCTGG + Intergenic
1195348677 X:103976406-103976428 CTCCAGTGGGGTCCCCTCCTTGG - Intergenic
1195358765 X:104062434-104062456 CTCCAGTGGGGTCCCCTCCTTGG + Intergenic
1196419493 X:115507594-115507616 AAGCAGAGAGGTCCTCTTGTGGG + Intergenic
1196659284 X:118252963-118252985 CTCCAGAGGGGTTCTCTGGTTGG - Intergenic