ID: 1179325513

View in Genome Browser
Species Human (GRCh38)
Location 21:40339299-40339321
Sequence GCCCACGATCACGTGGACCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179325513_1179325520 15 Left 1179325513 21:40339299-40339321 CCAGGGTCCACGTGATCGTGGGC 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1179325520 21:40339337-40339359 ACGTTGCACATAAGGGAAACCGG 0: 1
1: 0
2: 0
3: 7
4: 80
1179325513_1179325521 24 Left 1179325513 21:40339299-40339321 CCAGGGTCCACGTGATCGTGGGC 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1179325521 21:40339346-40339368 ATAAGGGAAACCGGCTCTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 67
1179325513_1179325516 7 Left 1179325513 21:40339299-40339321 CCAGGGTCCACGTGATCGTGGGC 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1179325516 21:40339329-40339351 TTCCCTTCACGTTGCACATAAGG 0: 1
1: 1
2: 0
3: 7
4: 101
1179325513_1179325517 8 Left 1179325513 21:40339299-40339321 CCAGGGTCCACGTGATCGTGGGC 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1179325517 21:40339330-40339352 TCCCTTCACGTTGCACATAAGGG 0: 1
1: 0
2: 1
3: 3
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179325513 Original CRISPR GCCCACGATCACGTGGACCC TGG (reversed) Exonic
900303338 1:1988898-1988920 GCTGAGGATGACGTGGACCCGGG - Exonic
901084411 1:6601942-6601964 GCCCACGAGCACGAGGATCTCGG + Exonic
902732182 1:18376817-18376839 GCCCATGTTCACGTGGACGCGGG + Exonic
911527460 1:99004432-99004454 TACCACGAGCACGGGGACCCCGG + Exonic
924714230 1:246557763-246557785 GCACAGGATCACTTGAACCCAGG - Intronic
1064193507 10:13227343-13227365 GTCCAAGTTCACGTGCACCCAGG + Intronic
1066047552 10:31606479-31606501 CCCCAGGACCACCTGGACCCAGG - Intergenic
1068533215 10:58211623-58211645 GCCCAGGATCACTTGAGCCCAGG + Intronic
1076464078 10:130666478-130666500 GGAAATGATCACGTGGACCCTGG + Intergenic
1077132053 11:977985-978007 GTCCACCATCCCGTGGACCGTGG + Intronic
1081871969 11:46387106-46387128 GCCCACGAGCATGTGGGCTCTGG + Intergenic
1087263393 11:96035858-96035880 GCCCACGGTCACATGGAGCTAGG - Intronic
1094840900 12:34342337-34342359 GCGCAGGATCCCGGGGACCCTGG + Intergenic
1100580865 12:95939312-95939334 GTCCAAGATCACGAGGGCCCTGG + Intronic
1101788790 12:107910189-107910211 GCCCAGGATCAAGTGGCCCCAGG - Intergenic
1115686203 14:35798760-35798782 GCACACGATCACTTGGGGCCAGG + Intronic
1119407791 14:74409572-74409594 GCCCACCAGCTCCTGGACCCAGG - Exonic
1120996786 14:90423555-90423577 GCCCATGATGATGTGGAGCCAGG - Intergenic
1122665091 14:103324103-103324125 GGCTTCGATCACTTGGACCCAGG + Intergenic
1128106549 15:65049760-65049782 ACCCAGGAGCACGTGGAGCCTGG - Intronic
1129303257 15:74639116-74639138 GGCCACCATCACTTGGGCCCTGG + Intronic
1135261062 16:20981305-20981327 ACCCACAAGCACGTGGACCCAGG + Intronic
1137245993 16:46705434-46705456 GCACAAGATCACTTGAACCCGGG + Intergenic
1142811980 17:2399721-2399743 GCCCCCGACCACGTGCACCGGGG - Intronic
1149908075 17:60545065-60545087 GCTCACGATCACTTGAACCCAGG + Intergenic
1150249590 17:63698568-63698590 GCCCACAAGGAGGTGGACCCCGG - Exonic
1160375567 18:78409489-78409511 GCCCACCATCATGGGGACCTGGG - Intergenic
1160375585 18:78409566-78409588 GCCCACCATCATGGGGACCTGGG - Intergenic
1160375603 18:78409643-78409665 GCCCACCATCATGGGGACCTGGG - Intergenic
1160375621 18:78409720-78409742 GCCCACCATCATGGGGACCTGGG - Intergenic
1160375638 18:78409797-78409819 GCCCACCATCATGGGGACCTGGG - Intergenic
1160410773 18:78674073-78674095 GCCCTCATGCACGTGGACCCTGG + Intergenic
1161108687 19:2456586-2456608 GCGCGCGATCGCGGGGACCCTGG - Intronic
1165858536 19:38894552-38894574 GCCCACGCTCCAGGGGACCCGGG - Intronic
1167724395 19:51200666-51200688 GGCCTCGCTCACCTGGACCCGGG + Intergenic
928854830 2:35790675-35790697 GCCCAGGCTCACTTGCACCCAGG + Intergenic
935265141 2:101387350-101387372 GCTCACGATCACGTAGCCCGCGG + Exonic
938065914 2:128281968-128281990 GCCCATGTCCACCTGGACCCAGG + Intronic
938382758 2:130845908-130845930 GCCCACGCTCACCTGTCCCCAGG - Intronic
943981632 2:194559811-194559833 GCCAACAATCATGTGGCCCCAGG + Intergenic
947393827 2:229667506-229667528 GCCCAGGGTCACGTGTACCAGGG + Intronic
1171995952 20:31731530-31731552 CCCCAGGATCGCTTGGACCCGGG - Intergenic
1173221844 20:41137812-41137834 GCGCCAGATCACGTGGAGCCGGG + Exonic
1179325513 21:40339299-40339321 GCCCACGATCACGTGGACCCTGG - Exonic
1179536939 21:42058977-42058999 CCCCAGGCTGACGTGGACCCTGG + Intergenic
1180038770 21:45265068-45265090 GCCCTCCGTCAGGTGGACCCGGG - Exonic
1180149421 21:45940140-45940162 GATCACCATCACGGGGACCCCGG + Exonic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
1184777270 22:46629482-46629504 GCCCAGGCTCACGAGGCCCCCGG + Intronic
1184947233 22:47812186-47812208 GCCAAGGATCACCTGGAGCCAGG + Intergenic
1185268882 22:49919117-49919139 GCCCACGGTGGCGTCGACCCTGG - Intronic
950288618 3:11765193-11765215 ACCCATGATCAAGTGGACCCAGG + Intergenic
957430315 3:80096441-80096463 ACCCAAGATCACTTGAACCCAGG + Intergenic
962563924 3:136637964-136637986 GGCCAGGATCACTTGGGCCCAGG - Intronic
962563934 3:136638000-136638022 GGCCAGGATCACTTGGGCCCAGG - Intronic
981516842 4:145619255-145619277 GGCCACGTCCACGGGGACCCTGG + Exonic
984010924 4:174370649-174370671 GCCCCAGATAACTTGGACCCAGG - Intergenic
1002133803 5:177096409-177096431 GCCCAAAGTCACGTGGCCCCAGG + Intronic
1005756128 6:28926328-28926350 GGTCACGATCACGTGAGCCCAGG - Intergenic
1007098004 6:39226296-39226318 GAGGACGATCACGTGGTCCCAGG + Intronic
1016745795 6:147578889-147578911 GCCCAAGACCACGTGGACTTAGG - Intronic
1019398156 7:834481-834503 GCCCAGGACCAGGAGGACCCAGG - Intronic
1020147751 7:5657663-5657685 GCCCACGGTCCTGTGGTCCCTGG - Intronic
1029310699 7:99660860-99660882 GCCCACAATCATGTAGACCTTGG - Intronic
1029331449 7:99859604-99859626 GCCCACAATCGTGTAGACCCTGG + Intronic
1033320630 7:140336331-140336353 GCCCAAGATCACCTGAGCCCAGG + Intronic
1034364918 7:150537900-150537922 GCCCAGGCTCCAGTGGACCCTGG + Intergenic
1034811328 7:154134528-154134550 GCTCAAGGTCACATGGACCCAGG - Intronic
1056071402 9:82991060-82991082 GCCCAGCTTCACGTGGCCCCAGG + Intronic
1058226099 9:102365700-102365722 TCCCACCAACACATGGACCCAGG - Intergenic
1061209001 9:129179953-129179975 GCCCAAGATCACATGGCCCCAGG + Intergenic
1061392510 9:130325686-130325708 CCCCACCATCACGTGGACCAAGG + Intronic
1062056316 9:134471218-134471240 GCCCAGGCTCAGGAGGACCCAGG - Intergenic
1062056426 9:134471609-134471631 TCCCAGGATCAGGAGGACCCAGG - Intergenic
1062167764 9:135116530-135116552 GCCCTTGATCGCGGGGACCCAGG - Intronic
1062483848 9:136764564-136764586 GCCCAGGAGCAGGTGCACCCAGG - Intronic
1191927477 X:66329165-66329187 GCCCATGCTCACCTGGAACCTGG - Intergenic
1193795286 X:85866322-85866344 GCCCAACATCACGTGGAAGCTGG - Intronic
1198685334 X:139222675-139222697 GCCCACGGTCACTTGCTCCCAGG + Intronic
1200224879 X:154411879-154411901 GCCGCCGCTCACCTGGACCCTGG + Exonic
1201986242 Y:19970692-19970714 GCTCTGGATCAGGTGGACCCAGG + Intergenic