ID: 1179326648

View in Genome Browser
Species Human (GRCh38)
Location 21:40352987-40353009
Sequence CTATTATCACCCAAAGTACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 69}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179326648_1179326651 -2 Left 1179326648 21:40352987-40353009 CCCCGTACTTTGGGTGATAATAG 0: 1
1: 0
2: 2
3: 13
4: 69
Right 1179326651 21:40353008-40353030 AGCCTCATTTAGAAATTTAATGG 0: 1
1: 1
2: 0
3: 25
4: 334
1179326648_1179326653 6 Left 1179326648 21:40352987-40353009 CCCCGTACTTTGGGTGATAATAG 0: 1
1: 0
2: 2
3: 13
4: 69
Right 1179326653 21:40353016-40353038 TTAGAAATTTAATGGAGAAATGG 0: 1
1: 0
2: 10
3: 73
4: 848
1179326648_1179326655 24 Left 1179326648 21:40352987-40353009 CCCCGTACTTTGGGTGATAATAG 0: 1
1: 0
2: 2
3: 13
4: 69
Right 1179326655 21:40353034-40353056 AATGGTCTGGAAACAGACAAAGG 0: 1
1: 0
2: 15
3: 51
4: 422
1179326648_1179326654 11 Left 1179326648 21:40352987-40353009 CCCCGTACTTTGGGTGATAATAG 0: 1
1: 0
2: 2
3: 13
4: 69
Right 1179326654 21:40353021-40353043 AATTTAATGGAGAAATGGTCTGG 0: 1
1: 6
2: 3
3: 14
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179326648 Original CRISPR CTATTATCACCCAAAGTACG GGG (reversed) Intronic
908938171 1:69400640-69400662 CTACTATTACTCAAAGTACCTGG - Intergenic
913548679 1:119895721-119895743 CTATAAACACCCAAAGTACTTGG - Exonic
916033073 1:160895307-160895329 CGATTACCACCCATAGTGCGAGG + Intergenic
919118252 1:193308228-193308250 CTATTATCACCCAAAGTCCACGG + Intergenic
921410311 1:214829443-214829465 CTATTATCATCCAATGTCCCTGG + Intergenic
1070438609 10:76419085-76419107 TTATTATCACCCAAAGTCCATGG + Intronic
1071201832 10:83228198-83228220 GAATTAAGACCCAAAGTACGGGG + Intergenic
1075329454 10:121562775-121562797 TCATTATCACCCAAAGTGTGTGG - Intronic
1075882161 10:125862205-125862227 CTTTTATCACCAAAACTACAAGG - Intronic
1076564318 10:131387648-131387670 TTATTATCACCTAAAGTTCATGG + Intergenic
1089036711 11:115401788-115401810 CCGTTATCACCCAAAGTCCATGG - Intronic
1090739901 11:129649694-129649716 TCATTATCACCCAAAGTCCATGG - Intergenic
1092103811 12:5906409-5906431 CTACCATCTCCCAAAGTACTGGG - Intronic
1098849547 12:75579049-75579071 CTAATATTTCCCAAAGTATGAGG - Intergenic
1104142433 12:126001781-126001803 TCATTATCACCCAAAGTCCAAGG + Intergenic
1105777000 13:23671897-23671919 CTATTATGAACCAAAGCACAGGG + Intronic
1108859411 13:54836218-54836240 CTATTATCACACAAGGTCTGTGG + Intergenic
1110305230 13:73979156-73979178 TCATTATCACCCAAAGTTCCTGG - Intronic
1111137999 13:84076242-84076264 CTATTATTACTCAAAGTGCAGGG + Intergenic
1113631674 13:111892353-111892375 CTCTTATCACCCAAAGTATGTGG + Intergenic
1116148545 14:41106721-41106743 CTATTATCACCCTAAGTCTTAGG + Intergenic
1118295202 14:64562077-64562099 CTACTATCTCCCAGAGTACAAGG - Intronic
1119028957 14:71176485-71176507 CCATTATCACCCAAAGTCTATGG + Intergenic
1123585435 15:21756236-21756258 CAATTTTCACCCAAAGAACCTGG + Intergenic
1124166592 15:27331700-27331722 TCATTATCACCCAAAGTCCAGGG - Intronic
1127856841 15:62960416-62960438 CTCTTATCACCAAAAGGACTGGG - Intergenic
1130175309 15:81562765-81562787 CTATTCTAACCCAAAGGAGGAGG - Intergenic
1131611223 15:93966295-93966317 ATATTATCACCTAAAGTCTGTGG + Intergenic
1136292183 16:29281649-29281671 TTATTATCAACCAAAGTCCATGG + Intergenic
1138330354 16:56209894-56209916 TTATAATCACCCAAAGTTCATGG + Intronic
1140904570 16:79399461-79399483 GTATTATCACCTAAATTATGGGG - Intergenic
1142098072 16:88255602-88255624 TTATTATCAACCAAAGTCCACGG + Intergenic
1143962948 17:10735583-10735605 CTTTGACCACCCAAAGTACTGGG - Intergenic
1145287319 17:21515687-21515709 TCATTATCACCCAAAGTCTGTGG - Intergenic
1147968077 17:44204769-44204791 GCATTTTCACCCAAAGTACATGG - Intergenic
1153297012 18:3556297-3556319 TCATTATCACCCAAAGTCCATGG + Intronic
1154273995 18:12944125-12944147 CTATCATCACCCAAGGCATGAGG + Intergenic
1159154568 18:64566635-64566657 CTTCAGTCACCCAAAGTACGGGG + Intergenic
1159409502 18:68053559-68053581 CTATAATAACCCCAAGTATGTGG + Intergenic
1162255460 19:9485784-9485806 CTTCTATCTCCCAAAGTACTGGG + Intronic
932058708 2:68473020-68473042 TCATTATCACCCAAAGTTCATGG + Intronic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
936675261 2:114707299-114707321 CTCTTATCAGCCCAAGTAGGAGG + Intronic
940649262 2:156425325-156425347 CTTTGATCTCCCAAAGTACTGGG + Intergenic
941693569 2:168527371-168527393 TTATTATCACCCAAAGTCCATGG + Intronic
942637030 2:178018620-178018642 CTTTCATCACCCAAAGTCCTGGG + Intronic
943434894 2:187852867-187852889 TCATTATCACCCAAAGTCCATGG + Intergenic
946514664 2:220398598-220398620 TAATTATCACCCAAAGTCCAGGG + Intergenic
947866915 2:233404519-233404541 CTAGAATCACCCAAAGCAGGAGG - Intronic
1172601157 20:36183982-36184004 CCATTGTCTCCCAAAGTACTGGG - Intronic
1179326648 21:40352987-40353009 CTATTATCACCCAAAGTACGGGG - Intronic
955609910 3:60745884-60745906 CTATGATCACTCAGAGTACGTGG - Intronic
965181685 3:165412096-165412118 TTATTATCACCCAAAGTAAATGG - Intergenic
967852822 3:194094937-194094959 CTTTTATCTCCCAAAGTACTGGG + Intergenic
968023277 3:195415104-195415126 TTATTATCACCCAAAGTCCATGG - Intronic
978047346 4:104146929-104146951 TCATTATCACCCAAAGTCCATGG + Intergenic
983080952 4:163384730-163384752 TCATTATCACCCAAAGTCCGTGG - Intergenic
987136205 5:14901840-14901862 TTCTTATCACCAAAAGCACGTGG + Intergenic
992033805 5:72751400-72751422 TTATTATCACCCAAAGTCTGTGG - Intergenic
994458389 5:100044915-100044937 GTTTTCTCACCCAAACTACGTGG - Intergenic
1005150113 6:22739202-22739224 CTATTATGGCCCAAAGTACATGG - Intergenic
1005613263 6:27547329-27547351 CTTCTATCTCCCAAAGTACTGGG - Intergenic
1009969220 6:70608985-70609007 CGATTACCACCCATAGTGCGAGG - Intergenic
1010151587 6:72739039-72739061 TCATTATCACCCAAAGTCCATGG - Intronic
1013248636 6:108312661-108312683 CTATTATCACCCTAGCTATGTGG + Intronic
1015065601 6:129022833-129022855 CTATTATCCCCAAAAGTAATGGG + Intronic
1015230841 6:130913107-130913129 CTATTCTCACCTAAAGCACCCGG + Intronic
1016779233 6:147939858-147939880 CTATTATTACCGAAAGTATCTGG + Intergenic
1019581437 7:1765488-1765510 CCATTGTCACACAAAGCACGAGG - Intergenic
1020465107 7:8469300-8469322 CTATTATCACAGAAAGTCCATGG - Intronic
1023308258 7:38854119-38854141 CTCTTATCACTCAAAATACGGGG + Intronic
1032931962 7:136682681-136682703 TCATTATCACCCAAAGTCAGTGG - Intergenic
1035836135 8:2754300-2754322 TCATTATCACCCAAAGTCAGTGG - Intergenic
1039331885 8:36546785-36546807 CAATTATCACCCAAAAAACGAGG + Intergenic
1040420568 8:47236387-47236409 CTCTTATCACCCAGAGTCCATGG - Intergenic
1040905738 8:52468318-52468340 CCATTATCACCCAGAGTCCATGG + Intergenic
1043562445 8:81509913-81509935 TCATTATCACCCAAAGTCCCTGG - Intergenic
1045286199 8:100793816-100793838 CTATTATCACCCTAAGGAAATGG + Intergenic
1047123459 8:121932265-121932287 TTCTTAGCTCCCAAAGTACGGGG - Intergenic
1059596924 9:115730800-115730822 CTATTTTCCCCCAAAGAAAGAGG - Intergenic
1060162747 9:121381082-121381104 TTATTATCATCCAAAGTCCATGG - Intergenic
1188962696 X:36512100-36512122 CTATTTTTACCCAAATTATGGGG - Intergenic
1196155568 X:112424931-112424953 TTATTATCATCCAAAGTCCATGG + Intergenic
1198154910 X:133949599-133949621 CTATTATCACTCAAAGTCAGTGG + Intronic
1200492828 Y:3849630-3849652 CCATTATCACCCAAAGGCCTAGG + Intergenic