ID: 1179327020

View in Genome Browser
Species Human (GRCh38)
Location 21:40357293-40357315
Sequence CTGAATAATTAAGTGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179327020 Original CRISPR CTGAATAATTAAGTGGAGAC AGG Intronic
901943988 1:12686007-12686029 ATAAATAAATAAGTGGAGCCAGG - Intergenic
902689436 1:18100931-18100953 CTGCATTCTTAAGTGGAGAGAGG - Intergenic
905807350 1:40886488-40886510 CTGAATAAACAAGTGAACACTGG + Intergenic
906941237 1:50257282-50257304 GTGAGTAATTAGGAGGAGACCGG - Intergenic
907764056 1:57390725-57390747 CTGAATAATGAAATGAAAACGGG - Intronic
908343319 1:63205255-63205277 CTGAATAATGACATGGAGCCAGG - Intergenic
909228294 1:73053973-73053995 TTGAATAATTATGTAGATACAGG + Intergenic
909450246 1:75790380-75790402 CTGAATATTTGAGTGGAGGGAGG + Intronic
909523301 1:76594021-76594043 CTGACTAAATAAGGGGAGAAGGG - Intronic
911006411 1:93229568-93229590 CTGAATAATTAAGTGGCCCTAGG + Intronic
911682592 1:100734612-100734634 CTGAAGAAAAAAGCGGAGACAGG + Exonic
911783129 1:101909094-101909116 TTGTATAACTGAGTGGAGACAGG - Intronic
911887318 1:103320439-103320461 CTGAATCAAGAATTGGAGACTGG - Intergenic
914820774 1:151100946-151100968 CTTAAAAATTAAGAGTAGACTGG + Intronic
918547940 1:185707211-185707233 CAGAAGAGCTAAGTGGAGACTGG + Intergenic
919462263 1:197891605-197891627 ATGGATAATTTAGGGGAGACTGG + Intergenic
921086514 1:211798873-211798895 CTGATTAATGGAGTGGAGACTGG + Intronic
924055159 1:240117901-240117923 CTGAAGAATAAAGTGGATAATGG + Intronic
924533662 1:244915375-244915397 TTGAATTTTTTAGTGGAGACAGG - Intergenic
1065281892 10:24147669-24147691 CTGGCTAATTTAATGGAGACTGG - Intronic
1066011624 10:31199750-31199772 CTGAGTAATTAAATGGGCACAGG + Intergenic
1067975344 10:51018448-51018470 TTAAATAATTTAGTGGAGTCAGG + Intronic
1070379663 10:75869280-75869302 GTTAATAATGAAGTTGAGACTGG + Intronic
1071157794 10:82711082-82711104 TTGATTAATTAATTAGAGACAGG + Intronic
1072506602 10:96074151-96074173 GTGAGTAATAAAGTGGAGAATGG + Intergenic
1072731131 10:97847910-97847932 CTGTATTTTTTAGTGGAGACGGG + Intergenic
1073235719 10:102014181-102014203 CTGAAAAATTAACTGGAAATGGG - Intronic
1076497952 10:130910773-130910795 ATCAATAATAAAGTGGTGACTGG - Intergenic
1078591256 11:12641978-12642000 GAGAATAATTAAGAGGAGGCTGG + Intergenic
1078635896 11:13049794-13049816 ATGAATAAATAAGTGGAGAAGGG - Intergenic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1080245071 11:30170661-30170683 TCGAATCATGAAGTGGAGACAGG + Intergenic
1086800831 11:91172822-91172844 AAGAATAATTAAGTGAAGAGAGG - Intergenic
1087045610 11:93841567-93841589 CTGAATGAGAAACTGGAGACCGG - Intronic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087741313 11:101890324-101890346 CTGAAAAATTAAGTGGGAAGAGG - Intergenic
1094566811 12:31606454-31606476 ATGTATTATTAAGTAGAGACAGG + Intergenic
1094704442 12:32900390-32900412 GAGAAGAATTAAGTGGAGAAGGG - Intergenic
1095155720 12:38851426-38851448 CTGATTAATCAAGTGGATAGTGG - Intronic
1095724027 12:45432836-45432858 CTCAGTAATGAAGGGGAGACAGG - Intronic
1098466831 12:70796854-70796876 CCGGCTAATTTAGTGGAGACAGG - Intronic
1098916180 12:76259080-76259102 CTGAATAAATAGGTAAAGACAGG - Intergenic
1102929668 12:116852502-116852524 CTGAATAATCAAGTGGGAAGGGG + Intronic
1103099868 12:118164147-118164169 TTGTATTTTTAAGTGGAGACGGG - Intronic
1104119181 12:125782596-125782618 CTGGCTAATTTAGTAGAGACAGG + Intergenic
1104397521 12:128447188-128447210 ATGATTAAGTAAGTGGACACAGG - Intronic
1104754208 12:131258703-131258725 ATGAATAAGTAAATGGAGAAGGG - Intergenic
1109215966 13:59590418-59590440 CTGTATTTTTAAGTAGAGACAGG + Intergenic
1109831306 13:67792707-67792729 CTAAATGATTAAGTGCTGACAGG - Intergenic
1110833726 13:80060973-80060995 CTGAATAATTAAGTAGTAAAGGG - Intergenic
1111528845 13:89510012-89510034 CTGGATAATTAAGAGAAGTCAGG - Intergenic
1112259559 13:97865626-97865648 CTGAATAATTAAGCATACACTGG + Intergenic
1112328047 13:98456875-98456897 CTGCATAATTAAGAGGAAACAGG + Intronic
1112333204 13:98492783-98492805 CTGATTACCTAAGGGGAGACAGG - Intronic
1114441452 14:22751597-22751619 ATAAATAAATAAGTAGAGACAGG - Intergenic
1116213957 14:41986556-41986578 CTGAAGCATTAAGTGGATAGAGG + Intergenic
1119036759 14:71236831-71236853 TTGGATAATTAACTGCAGACAGG + Intergenic
1119053536 14:71394282-71394304 CTGTATAATTAATTGGTGAATGG - Intronic
1119206306 14:72796513-72796535 ATAAATAAATAAATGGAGACAGG + Intronic
1120188366 14:81417588-81417610 CTGTGCAATTAATTGGAGACAGG + Intronic
1120495096 14:85225177-85225199 CAAAATAATTGAGAGGAGACAGG + Intergenic
1121402014 14:93688341-93688363 CTGAACAATTAGGTGAAGAGAGG + Intronic
1121867046 14:97372387-97372409 CTGAATCACCAAGTGGAGGCAGG - Intergenic
1124253792 15:28124719-28124741 CTGACTAATTTTGTAGAGACAGG + Intronic
1124647622 15:31450096-31450118 CTTAATAATCAAGTGGAGGCGGG - Intergenic
1125617630 15:41029777-41029799 CTGAATAATTAGGAGGAAAAAGG + Intronic
1127419518 15:58791442-58791464 TTGAATTTTTAAGTGGAGATGGG - Intronic
1127582964 15:60354466-60354488 CTGGCTAATTTAGTAGAGACAGG - Intronic
1128278138 15:66371688-66371710 TTGAATTTTTTAGTGGAGACGGG + Intronic
1129344073 15:74905781-74905803 CTGATTAAATAAGTGGGGAGAGG - Intronic
1133082651 16:3335112-3335134 ATAAAGAACTAAGTGGAGACAGG - Intergenic
1133085294 16:3357672-3357694 CTGCATTATTAAGAAGAGACAGG - Intergenic
1134239757 16:12496847-12496869 TTGAATAATTAAGTAGACAAGGG + Intronic
1136751451 16:32638904-32638926 AGGTAAAATTAAGTGGAGACAGG + Intergenic
1139124560 16:64062553-64062575 CTGAGTAATGAAATGGGGACCGG + Intergenic
1139815239 16:69664579-69664601 CTGAAAAATAAAGTTGAGGCCGG - Intronic
1140478574 16:75250938-75250960 GTGAATCATTAACTGGAGCCGGG + Intronic
1141796299 16:86277651-86277673 GTAAATATGTAAGTGGAGACAGG + Intergenic
1142006880 16:87693500-87693522 TTGTATTTTTAAGTGGAGACAGG - Intronic
1203053585 16_KI270728v1_random:898159-898181 AGGTAAAATTAAGTGGAGACAGG + Intergenic
1142779285 17:2168352-2168374 CTGGCTAATTTAGTAGAGACGGG + Intronic
1143154302 17:4826468-4826490 TTGCATAATTTAGTAGAGACGGG + Intergenic
1144296540 17:13880726-13880748 CTGAATAATGAAATTAAGACAGG + Intergenic
1145083864 17:19918491-19918513 CTGGCTAATTTAGTAGAGACAGG + Intronic
1149820361 17:59771177-59771199 TTGAATTATTAACTGGAGACAGG + Intronic
1151018580 17:70585638-70585660 CTGAATTTTTGAGTGGTGACTGG + Intergenic
1151498040 17:74471155-74471177 CTTAATAAGTAAATGGAGCCTGG - Intronic
1152447179 17:80352563-80352585 TTGAATAATTTCGTGGAGAATGG + Intronic
1152454174 17:80403395-80403417 ATGAAGAATTAAGTCGAGATAGG - Intergenic
1153300926 18:3591514-3591536 CTGGATAATTTTGTGGAGATGGG - Intronic
1153937916 18:9947514-9947536 CTAAATAATATAGTGGAAACTGG + Intronic
1155615730 18:27719056-27719078 CTGAATAAGAAACTGGAGATTGG - Intergenic
1156109174 18:33703150-33703172 GTGAGCAATTAAGAGGAGACTGG - Intronic
1156673835 18:39503958-39503980 CTGAATGATAAAGTGGAGAGAGG - Intergenic
1156768551 18:40689647-40689669 GAGAATAATGAAGGGGAGACAGG - Intergenic
1158250686 18:55484199-55484221 CTGAATAATTAATTTGAAAGAGG - Intronic
1163468908 19:17485882-17485904 CTGAATGATTGTGTGGAGGCAGG - Intronic
1165572220 19:36785069-36785091 CCCAATAATTTTGTGGAGACAGG - Intergenic
926227706 2:10980037-10980059 CTGAAAAATGAAGGGGAGACAGG - Intergenic
926540401 2:14171319-14171341 CTGAATGCTTAAGTGGAAAGTGG - Intergenic
926804385 2:16692242-16692264 CTGAATAATAAAATGAAGAAAGG + Intergenic
928139137 2:28712702-28712724 TTGTATATTTTAGTGGAGACGGG - Intergenic
930342201 2:50131226-50131248 ATGATTAATTAAGTGGAAAAGGG - Intronic
930361403 2:50384589-50384611 CTGAAGAATTTAGTAGAGAAGGG - Intronic
931878211 2:66537642-66537664 CTGAATAATTAATGCTAGACAGG + Intronic
932154549 2:69404132-69404154 AAGAATAATTAATTGGAGGCCGG - Intronic
935330409 2:101973502-101973524 CTGAATATGTAAGTGGATAATGG + Intergenic
935863171 2:107356490-107356512 CTGATTTATTAAGTGGAGCTTGG + Intergenic
937594785 2:123660230-123660252 ATGAAGAATTATGTCGAGACAGG + Intergenic
937658646 2:124405442-124405464 CTGCATATATAAGTGGAGTCCGG - Intronic
939152393 2:138488334-138488356 CTGAATAAATAACTGGAGAATGG + Intergenic
939333024 2:140789109-140789131 CTGAATAAGTAAGTTGATATGGG - Intronic
940229829 2:151439135-151439157 CATAATCATTAAGTGGAAACGGG + Intronic
940789480 2:158016765-158016787 CTCAATAATTAAGTGTTGAGAGG + Intronic
941111479 2:161422867-161422889 CTGAACAATCAAATGGACACAGG + Intronic
941329661 2:164164444-164164466 GTGAAGAATTAAGAGGAGCCTGG + Intergenic
941893106 2:170602662-170602684 CAGAATAATTTAGAGGAGAGAGG - Intronic
946498126 2:220216729-220216751 CTGAATATATATGTGGAGTCCGG + Intergenic
947426502 2:229987790-229987812 CTGGATAATTTTGTAGAGACAGG + Intronic
1169638468 20:7721317-7721339 GTGTATCATTCAGTGGAGACTGG - Intergenic
1169667956 20:8060024-8060046 TTGAGTCATTAAGTGGAGTCTGG + Intergenic
1170300771 20:14881879-14881901 CTGAGAAATTAGGGGGAGACAGG - Intronic
1172460112 20:35111323-35111345 CTGAATAATGAAGTGGACTGTGG + Intergenic
1173071384 20:39770918-39770940 TTTAAAAATTAAGTAGAGACAGG - Intergenic
1173125872 20:40335562-40335584 CTGTAAATTTAAGTGGAGAATGG - Intergenic
1173291977 20:41723255-41723277 CAGAATGATTAAGTCCAGACTGG + Intergenic
1173760474 20:45555324-45555346 CTTAAGAATGAAGTGTAGACAGG - Intronic
1175793738 20:61758321-61758343 CTGAGTAATTACGTTGTGACTGG - Intronic
1176994041 21:15533139-15533161 CTGAAGAAGTAAGTGGAAAATGG + Intergenic
1177209055 21:18047169-18047191 CATAATAATTAAATGGAGAAGGG - Intronic
1178472012 21:32902303-32902325 CTGAATATTCAAGTGGTGAGAGG + Intergenic
1179327020 21:40357293-40357315 CTGAATAATTAAGTGGAGACAGG + Intronic
1182106684 22:27694821-27694843 CTGAATAAAGAGATGGAGACAGG + Intergenic
1182249743 22:28990668-28990690 CTGATTGATTGACTGGAGACAGG - Intronic
1182425449 22:30269216-30269238 ATGAATAGTTAAGAGGAGAGGGG + Intergenic
951053123 3:18117262-18117284 ATGAATAATTTAATGGAGAAGGG - Intronic
951269022 3:20602853-20602875 TTAAATAATCAGGTGGAGACAGG + Intergenic
951703149 3:25516489-25516511 ATGAATAATCAAATTGAGACTGG + Intronic
951707607 3:25558954-25558976 CTGAAGAAAAATGTGGAGACAGG - Intronic
951785556 3:26414814-26414836 CTGAATTATTAACTGGAGGGAGG + Intergenic
951802700 3:26613956-26613978 CTCAAGAGTTAAATGGAGACAGG - Intergenic
953628576 3:44591696-44591718 TTAAAAAATTAAGTGGAGGCTGG + Intronic
954860649 3:53687481-53687503 CTAGATAATTCAGTGGAGAAAGG + Intronic
955181546 3:56675471-56675493 TTTAAAAATTAAGTGGGGACCGG - Intronic
957795550 3:85001204-85001226 GTGAATAATTAAATAGAGAAAGG - Intronic
958268382 3:91467184-91467206 CTGAATAATTAAGGGGCAACTGG - Intergenic
961969885 3:130951256-130951278 CTAAATAATTAAGAGGAATCTGG + Intronic
962095512 3:132288548-132288570 CAGAACAGTTAAGTGGTGACAGG + Intergenic
962429200 3:135303824-135303846 CTGAATAATTAGGTGTCAACTGG - Intergenic
963767581 3:149353535-149353557 CTGAAGAATTACGTACAGACTGG + Intergenic
963873782 3:150449754-150449776 GTGAATAATTAAGGGGAGGTCGG + Intronic
964117423 3:153150638-153150660 CTGAATAATTGTGTGAAAACAGG - Intergenic
966822435 3:183935671-183935693 CTGGCTAATTTAGTAGAGACAGG + Intronic
970420311 4:15899620-15899642 CTGAATTAAGAAGTGGACACTGG - Intergenic
970677241 4:18465072-18465094 TTGAATAATTAAGTGGAAAGAGG - Intergenic
970860430 4:20696312-20696334 CTGGATAGTTAAGAGGAGATTGG + Intronic
971533396 4:27717519-27717541 CTCAATAATTAAATCGAGAGGGG + Intergenic
971851584 4:31991941-31991963 TTGAATAATTAAGTGGAAGTTGG + Intergenic
972874456 4:43341276-43341298 CTGAATAAGGAAGTGAAGTCTGG - Intergenic
974908915 4:68091687-68091709 CTGAAAAATTAATTGGATATTGG - Intronic
975573117 4:75837837-75837859 CTGGATAATTTTGTAGAGACGGG + Intergenic
976328337 4:83798612-83798634 CTGAATAAATAAGGAGAGTCAGG + Intergenic
977534061 4:98236512-98236534 TGGAATAATAAAATGGAGACTGG - Intergenic
977540416 4:98312224-98312246 CAGAATTATTAGCTGGAGACTGG - Intronic
977598185 4:98907053-98907075 CTGAATAAATACTTGGAGAATGG - Intronic
978092879 4:104739330-104739352 CTAAATATTAAAGTAGAGACTGG - Intergenic
978297002 4:107217142-107217164 CTACATAATTAAGTGGATAATGG - Intronic
979065672 4:116129489-116129511 CAGAATAATTTAATGGAGAGAGG - Intergenic
979681896 4:123469464-123469486 CTGAATAATACACTGAAGACAGG - Intergenic
979794230 4:124826020-124826042 CTGAGGAAATTAGTGGAGACAGG - Intergenic
981250162 4:142591468-142591490 TTGAATAAATAAATGGAGAAAGG + Intronic
983758620 4:171375992-171376014 CTGATTAAGTAAATGGACACTGG + Intergenic
984118598 4:175713362-175713384 CTGGCTAATTTAGTAGAGACGGG + Intronic
985983242 5:3489383-3489405 CTGTATAATTAAGTGGAGGCCGG + Intergenic
986149311 5:5112366-5112388 CATAATAATTAAGGGGAGTCTGG - Intergenic
986175046 5:5345009-5345031 CTGAATATTCAAGTAGAAACTGG + Intergenic
987132234 5:14871164-14871186 CTGAATAATTGAGGGGAGGGAGG + Intronic
987654689 5:20791573-20791595 CTGAATAACCACGTGGAGAAGGG - Intergenic
988508827 5:31848372-31848394 CTGAATAATTAAATGTATAAAGG + Intronic
988740949 5:34070268-34070290 CTGAATAACCACGTGGAGAAGGG + Intronic
989064919 5:37450567-37450589 CTGAATAAGTAAATGGATAGTGG - Intronic
989802763 5:45564407-45564429 CTGACTAATTTAGTAGAAACGGG + Intronic
992120434 5:73586806-73586828 CTGAAAAAATAAGTGGCGACAGG - Intergenic
993205186 5:84869472-84869494 CAGAGCAATTAAGTGGAAACTGG + Intergenic
993824854 5:92670550-92670572 ATGAAGAGTTAAGTGGAGAAAGG - Intergenic
994981652 5:106882274-106882296 CTGCAAAATAAAATGGAGACAGG - Intergenic
995984791 5:118157005-118157027 CTGAATAAGTATCTGGAGTCAGG + Intergenic
996307702 5:122068816-122068838 ATGAATAAATAAATGGAGAATGG + Intronic
996492116 5:124110282-124110304 CCTGATAATTAACTGGAGACAGG - Intergenic
997779379 5:136641452-136641474 CTGGTTAATTAAGTGGACTCTGG - Intergenic
998456066 5:142274387-142274409 CTGAGTTATTGAGTTGAGACAGG - Intergenic
998604909 5:143623562-143623584 CTGTATTATTTAGTAGAGACAGG + Intergenic
1000526354 5:162363355-162363377 CTGAATTACCAAATGGAGACTGG - Intergenic
1003105929 6:3215934-3215956 ATGAAATATTAAGTGGAGGCTGG - Intergenic
1006848332 6:37078948-37078970 CTGAATCATCAAGCAGAGACTGG + Intergenic
1008187823 6:48416199-48416221 CTGAATAAATATGTGGTGCCAGG - Intergenic
1010624338 6:78118444-78118466 CTGATTCATTAAGAGGAGGCTGG - Intergenic
1010747985 6:79586022-79586044 TTGTATATTTTAGTGGAGACAGG - Intergenic
1012890444 6:104891169-104891191 CTGAATAATTTAGTCCAGTCAGG - Intergenic
1012954060 6:105549277-105549299 CTGAATAATGAAGTGGACAACGG - Intergenic
1013349563 6:109292854-109292876 CTGAATAATAGAGATGAGACTGG + Intergenic
1013918411 6:115369278-115369300 CCAAATACTTAAGTGGAGGCTGG + Intergenic
1014034743 6:116753330-116753352 ATGAAAAATGAATTGGAGACAGG + Intronic
1016595992 6:145801851-145801873 CTGAAAGATTCAATGGAGACAGG + Intronic
1020056373 7:5120383-5120405 CTTTATAATTAAGTATAGACTGG + Intergenic
1020653256 7:10900391-10900413 GAGAAAAATTAAGTGGAGAAGGG - Intergenic
1027739292 7:81979847-81979869 CTGAATAAATACTTGGTGACTGG - Intronic
1028382752 7:90216822-90216844 CAGAACAATTAAGTGAAAACTGG + Intronic
1030285612 7:107823992-107824014 CTGGCTAATTTAGTAGAGACGGG + Intergenic
1031568330 7:123327104-123327126 CTGGTTAATTTAGTAGAGACAGG - Intergenic
1032648421 7:133851545-133851567 CTGAATAATACAGAGGAGCCAGG + Intronic
1033298222 7:140160731-140160753 CTGAAAAATCAAGTTCAGACTGG + Intronic
1036487468 8:9192602-9192624 CTGTATTTTTTAGTGGAGACGGG + Intergenic
1039539201 8:38348996-38349018 GGGAATAATGAAGTGGGGACAGG - Intronic
1041193740 8:55379524-55379546 CTGAGAAATTAAGTAGAAACCGG - Intronic
1041274686 8:56144567-56144589 CTGAATGTTTTAGTGGAGAATGG + Intergenic
1042604137 8:70528998-70529020 CTGAAAAACTAACTGGAGCCGGG + Intergenic
1042906933 8:73781397-73781419 GTCAATTAGTAAGTGGAGACGGG - Intronic
1043170190 8:76956287-76956309 CTGAACAATTAAGGGGCAACTGG + Intergenic
1043965143 8:86465612-86465634 CTGATTATTTATTTGGAGACAGG - Intronic
1045183243 8:99809554-99809576 CTGAATAATTAAGAGGTGTCTGG - Intronic
1047166141 8:122440549-122440571 CTTCACAATTAAGTGAAGACAGG + Intergenic
1047914188 8:129564691-129564713 GTAAATAATTAAGTGCAGTCTGG + Intergenic
1048411735 8:134182211-134182233 CCGAGTAATTTAGTAGAGACGGG + Intergenic
1050456737 9:5841623-5841645 CTGCATGTTTTAGTGGAGACAGG - Intergenic
1050756341 9:9008520-9008542 CTAAATAATGAAGGGGAGGCCGG - Intronic
1051509747 9:17864257-17864279 ATATATAAATAAGTGGAGACTGG - Intergenic
1054377080 9:64457525-64457547 CTGTAAAATTAAATGGATACTGG + Intergenic
1055011897 9:71576204-71576226 CTGAATTAGTAAGTGGTGTCAGG - Intergenic
1056469320 9:86890013-86890035 CTGAATGATAATGTGGAGACAGG + Intergenic
1059677822 9:116556446-116556468 ACGAAAAATTAAGTGGAGTCTGG - Intronic
1186021059 X:5256204-5256226 CTGTATTTTTTAGTGGAGACGGG + Intergenic
1188913413 X:35879248-35879270 CTGAATAAGAATGTTGAGACTGG - Intergenic
1193599760 X:83496016-83496038 ATGAATAAGTATGTGCAGACTGG + Intergenic
1193899782 X:87163101-87163123 CTGAATAAATAGGTGGATCCAGG - Intergenic
1195210481 X:102649595-102649617 CTGAATTAAGAAGTGGACACTGG - Intergenic
1195928188 X:110047333-110047355 CTGAATAATTAAGAGTTGATTGG + Intronic
1196798793 X:119523871-119523893 ATGAATGAACAAGTGGAGACTGG + Intergenic
1199413332 X:147551396-147551418 ATGAATAATTAAGGGAAGAATGG - Intergenic
1201243457 Y:11980276-11980298 TTAATTAATTAAGTTGAGACAGG + Intergenic