ID: 1179332700

View in Genome Browser
Species Human (GRCh38)
Location 21:40420699-40420721
Sequence CTTTATACAAAGGGGGAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 956
Summary {0: 1, 1: 2, 2: 33, 3: 215, 4: 705}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179332694_1179332700 -7 Left 1179332694 21:40420683-40420705 CCAATATGCCTGGTATCTTTATA 0: 1
1: 20
2: 118
3: 624
4: 1695
Right 1179332700 21:40420699-40420721 CTTTATACAAAGGGGGAATTTGG 0: 1
1: 2
2: 33
3: 215
4: 705

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179332700 Original CRISPR CTTTATACAAAGGGGGAATT TGG Intronic
900282170 1:1877476-1877498 TTTTATAAAAAAGGGAAATTAGG - Intronic
900304864 1:2000714-2000736 CCTTATAAAAAGGAGAAATTTGG - Intronic
900710119 1:4108265-4108287 CTGTATAAAAAGGGGAAATTTGG - Intergenic
900726107 1:4217346-4217368 CCTTACACAAAGGGGAATTTTGG + Intergenic
900814655 1:4834254-4834276 TCTTATAAAAAGGGGAAATTTGG + Intergenic
901315899 1:8308086-8308108 CTTTATAAGAAGGGGAGATTGGG - Intergenic
901773766 1:11545080-11545102 CCTGATAAAAAGAGGGAATTTGG + Intergenic
901856096 1:12045054-12045076 CCTTACAAAAAGGGGAAATTTGG + Intergenic
902041939 1:13499020-13499042 CCTTATAAAAAGGGGGAATTTGG - Intronic
902124013 1:14193301-14193323 CTTTATAAAAAGGGGAAATTTGG + Intergenic
902497618 1:16885116-16885138 CTTTCCACAAAGGGGCTATTTGG - Intronic
903120796 1:21215858-21215880 CTTCATAAAAGGGGGAAATTTGG + Intergenic
903976925 1:27156215-27156237 CCTTATAAAAAGGGGAAATCTGG - Intronic
904551190 1:31320013-31320035 GCTAATACAAAGGGGGTATTAGG + Intronic
904798726 1:33077499-33077521 CCTTATTAAAAGGGGAAATTTGG + Intronic
904869678 1:33608617-33608639 CTTTATAGAAGGTGGGAATTTGG + Intronic
904996998 1:34639083-34639105 CCTTAGAAAAAGGGGAAATTTGG + Intergenic
905119508 1:35670951-35670973 CCTTATGAAAAGGGGAAATTTGG + Intergenic
905194519 1:36265003-36265025 GCTTATAAAAAGGGGAAATTTGG - Intronic
905478099 1:38242976-38242998 CCTTATAAAAGGGGGAAATTTGG + Intergenic
905587782 1:39134609-39134631 TATTTTACAAATGGGGAATTAGG - Intronic
905858768 1:41332284-41332306 CTTTATAAAAGGAGGAAATTTGG - Intergenic
906070202 1:43010880-43010902 CCTTATAAAAAGGGGACATTTGG - Intergenic
907289168 1:53401973-53401995 CTTTATAAAAAGAGGAAATGTGG + Intergenic
907583310 1:55591702-55591724 CCTTATTGAAAGGGGAAATTTGG - Intergenic
907680245 1:56556271-56556293 CCCTATAAAATGGGGGAATTTGG + Intronic
907941305 1:59090240-59090262 CATTATCTAAAGGGGCAATTGGG + Intergenic
908037327 1:60069914-60069936 CTTTATAAAAAGGGGCAATTTGG + Intronic
908113276 1:60917829-60917851 CCTTATAAAAAGGGGAAATGTGG - Intronic
908846336 1:68328400-68328422 CCTTATAAAAAGGGGAGATTTGG - Intergenic
910270840 1:85392295-85392317 CTTTATAAGAAGAGGAAATTTGG - Intronic
910301377 1:85710436-85710458 CTTTATAAGAAGAGGAAATTTGG + Intergenic
911319300 1:96393218-96393240 CTTTATAAAAGAGGGAAATTTGG + Intergenic
911529796 1:99031068-99031090 CATTATAAAAAAGGGAAATTTGG + Intergenic
912405084 1:109430906-109430928 TTTTATAAGAAGAGGGAATTTGG + Intergenic
912540920 1:110414662-110414684 CCTCATAAAAAGGGGAAATTTGG + Intergenic
912958628 1:114174864-114174886 CTTTATAGAAAGCAGGTATTGGG - Intergenic
912959426 1:114181927-114181949 CTTTATAAAAAGAGAAAATTTGG - Intergenic
913279622 1:117173333-117173355 CCTTATAAAAAGGGGAAATTTGG + Intronic
913677671 1:121157051-121157073 CCTTATAAAGAGGGGAAATTTGG + Intergenic
914029505 1:143944680-143944702 CCTTATAAAGAGGGGAAATTTGG + Intronic
914159944 1:145123270-145123292 CCTTATAAAGAGGGGAAATTTGG - Intergenic
914457605 1:147850691-147850713 CCTTATACAAAGTAGAAATTTGG + Intergenic
915661402 1:157408675-157408697 CCTTATAAAAAGAGGGAATCTGG - Intergenic
916766112 1:167862336-167862358 CCTTATAAAAAGGAGAAATTTGG + Intronic
916963637 1:169913263-169913285 CTTTATAAGAAAGGGAAATTTGG + Intergenic
917294829 1:173507676-173507698 CCTTATAAAAAGGGGAAACTTGG + Intronic
917301443 1:173578800-173578822 CCTTATAAAAAGGGGAAATTTGG - Intronic
917477692 1:175383134-175383156 CCTTATAGAAAGGGGAAATTTGG - Intronic
917500937 1:175584219-175584241 CCTTATCAAAAGGGGGAATTTGG + Intronic
917661101 1:177177951-177177973 CTTTAACCAAAGCAGGAATTTGG - Intronic
917960605 1:180141405-180141427 CTTTACACAAAGGAGAACTTTGG + Intergenic
919020558 1:192099793-192099815 CCTTATAGAAAGGGGAAATTTGG + Intergenic
919067220 1:192707790-192707812 CTTTATAAGAAGTGGAAATTTGG + Intergenic
920424024 1:205859030-205859052 GTTTGTACAAAAGGAGAATTTGG - Intergenic
920464977 1:206175561-206175583 CCTTATAAAGAGGGGAAATTTGG + Intergenic
920843040 1:209570906-209570928 CCTTATAAAAAGGGGAACTTTGG - Intergenic
920911096 1:210217554-210217576 CTTTACAAAAAGGGAAAATTTGG + Intergenic
921268271 1:213444196-213444218 CCTTATGAAAAGGGGAAATTTGG - Intergenic
921550207 1:216526351-216526373 CTTCATAAAAAGGGGATATTTGG + Intronic
921891821 1:220361253-220361275 CTTTATAAGAAGAGGCAATTTGG + Intergenic
922098554 1:222463015-222463037 CCTTATAAAAAGGAGAAATTTGG + Intergenic
922444471 1:225684895-225684917 CTTTATAAAAAGGGGAAATGTGG - Intergenic
922458898 1:225799610-225799632 GTTTGTACAAAAGGAGAATTTGG + Intergenic
922931087 1:229390226-229390248 CCTTATAAAAAGGGGAAATTTGG + Intergenic
923001031 1:230006563-230006585 CCTTATAAAAAGGGGGAATTTGG - Intergenic
923656480 1:235921557-235921579 CCTTATAAAAAGAGGAAATTTGG + Intergenic
923717594 1:236438134-236438156 CCTTATGGAAAGGGGAAATTTGG - Intronic
924165711 1:241280173-241280195 CCATATAAAAAGGGGAAATTTGG + Intronic
924320311 1:242842166-242842188 CTTATAAAAAAGGGGGAATTTGG - Intergenic
924326383 1:242898538-242898560 CCTTATAAAAAGGGGAAATTTGG - Intergenic
1063130953 10:3176024-3176046 CCTTATAAAAAGGGAAAATTTGG + Intergenic
1063302619 10:4864971-4864993 CTTTATTCAAATTGGGATTTTGG - Intergenic
1063469602 10:6273726-6273748 CCTTATAAAAAAGGGAAATTTGG + Intergenic
1063817129 10:9788210-9788232 CCTTATAAAAAGGGGAAATTTGG - Intergenic
1065203797 10:23339267-23339289 CTGAATACCAAGGGGCAATTGGG + Intronic
1065228703 10:23574576-23574598 CTTTATAAGAAGAGGAAATTTGG + Intergenic
1065436799 10:25711175-25711197 TCTTATAAAAAGGGGAAATTTGG - Intergenic
1065811994 10:29450896-29450918 CTTTATATGAAGGGGAAATTGGG - Intergenic
1065959787 10:30725261-30725283 CTTTATATGAAGGGGAAATTGGG + Intergenic
1066192701 10:33070448-33070470 CCTTATCAAAAGGGGAAATTTGG - Intergenic
1067231783 10:44417272-44417294 CCTTATGAAAAGGGGAAATTGGG - Intergenic
1067460209 10:46452607-46452629 CCTTATAAGAAGGGGAAATTTGG - Intergenic
1067548421 10:47214415-47214437 CCTTATAAGAAGGGGAAATTTGG + Intergenic
1067554656 10:47260285-47260307 CCTTATAAAAAGGGGAAATTTGG - Intergenic
1067626981 10:47931996-47932018 CCTTATAAGAAGGGGAAATTTGG + Intergenic
1067740611 10:48893229-48893251 CCTTATAAAAAGGGAAAATTTGG - Intronic
1068012730 10:51474656-51474678 ATTTCTTCAAAGGAGGAATTAGG + Intronic
1068109777 10:52666261-52666283 CCTTATAAAAAGGAGAAATTTGG - Intergenic
1068165002 10:53318962-53318984 AATTTTACAAAGGGGGTATTTGG - Intergenic
1068501384 10:57843001-57843023 CTTTATAAAAAGGGGAAATTTGG - Intergenic
1068618750 10:59153777-59153799 CTTTATAAAAAGGGAAAATTTGG - Intergenic
1068857745 10:61814502-61814524 CCTTATAAAAAGGAGAAATTTGG - Intergenic
1069075859 10:64037772-64037794 CCTTATAAAAAGGGGAAATTTGG - Intergenic
1069152441 10:64981071-64981093 CTTTATAAGAAGGGGAAATTTGG + Intergenic
1069669727 10:70191654-70191676 TTTTTTACAAAGGGAGCATTTGG - Intergenic
1069760394 10:70806705-70806727 CCTTATAAAATGGGGCAATTTGG - Intergenic
1069941361 10:71957897-71957919 GTTTGTACAAAAGGAGAATTTGG - Intergenic
1069963369 10:72092556-72092578 CTTTATAAGAAGAGGGAATTTGG - Intergenic
1069980089 10:72246487-72246509 CCTTATAAAAAGGGGACATTTGG - Intergenic
1070551625 10:77494958-77494980 ATTTATAAAAAGGGGAACTTTGG - Intronic
1070601256 10:77867911-77867933 CCTTATTAAAAGGGGAAATTTGG + Intronic
1070682171 10:78456326-78456348 CCTTATAAAAAGGGAAAATTTGG + Intergenic
1071169641 10:82849134-82849156 CCTTATCAAAAGGGGAAATTTGG + Intronic
1071746557 10:88426432-88426454 CAGTAAAAAAAGGGGGAATTGGG - Intronic
1071974873 10:90945445-90945467 CCTTATCCAAAGGGGAAATTTGG - Intergenic
1072205921 10:93205248-93205270 CCTTATGAAAAGGGGGAATTTGG - Intergenic
1072985138 10:100132857-100132879 CCTTATAAAAAGGGGACATTTGG + Intergenic
1073320758 10:102615010-102615032 CTTTTTACAGAGGAGGAACTGGG - Intronic
1073591199 10:104759092-104759114 CCTTATAAAAGGGGGAAATTTGG + Intronic
1073739846 10:106393997-106394019 CCTTATAAAAAGGGAAAATTTGG - Intergenic
1074062907 10:109984180-109984202 CCTTACAAAAAGGGGAAATTTGG + Intergenic
1074210919 10:111334243-111334265 ATTTAGAAAAAGAGGGAATTAGG - Intergenic
1074426843 10:113358764-113358786 CTTTCTGCAAAGGGAGAATCTGG + Intergenic
1074475253 10:113767896-113767918 TCTTATAAAAAGGGGAAATTTGG - Intronic
1075220755 10:120582418-120582440 CCTTATAAAGAGGGGAAATTTGG - Intronic
1075470978 10:122688972-122688994 GCTTATAACAAGGGGGAATTTGG - Intergenic
1076377596 10:130002132-130002154 CTTTATACAAAGGAGGCAGAGGG - Intergenic
1077848281 11:6049221-6049243 CTTTATACTAAGTGGGGATGTGG - Intergenic
1077999486 11:7482184-7482206 CCTTATACAAAGAGGAAATTTGG - Intergenic
1078435125 11:11318373-11318395 CCTTATAAAAAGGGGCAATTTGG + Intronic
1078492969 11:11786300-11786322 TTTTATAAAAAGGAGAAATTTGG - Intergenic
1078642825 11:13112201-13112223 CTTTAGAAAAAGAGGGAATTTGG + Intergenic
1078825512 11:14926328-14926350 TTGTATAAAAAGGGGAAATTTGG + Intronic
1080032633 11:27678051-27678073 CTTAATAGAAAGTGGGAGTTAGG - Intronic
1080149481 11:29033158-29033180 CTTAATAAAAAGGGGAAATTTGG - Intergenic
1080430339 11:32192197-32192219 CCTTATCTAAAGGGGAAATTTGG + Intergenic
1080847940 11:36042725-36042747 CCTTATGAAAAGGGGAAATTTGG + Intronic
1081314108 11:41610829-41610851 CCTTATAAAAAGGTGAAATTTGG - Intergenic
1081345674 11:41982671-41982693 CTAAATAAAAAGGGGGAAGTAGG + Intergenic
1081370940 11:42302239-42302261 CCTTATAAAAAGAAGGAATTTGG + Intergenic
1081829697 11:46097708-46097730 GTTTAAACAAAGGAAGAATTGGG - Intronic
1083025373 11:59546279-59546301 CCTTACAAAAAGGGGAAATTTGG + Intergenic
1084482114 11:69428011-69428033 CCTTCTAAAAAGGGGAAATTTGG + Intergenic
1085558220 11:77445107-77445129 CCTTATAAAAAGGGGAAATTTGG + Intronic
1085758870 11:79224649-79224671 CCTTATAAAAAGGGGAAACTTGG + Intronic
1086428896 11:86716316-86716338 GTTTATACAAAGAGGGAAGAGGG + Intergenic
1087236043 11:95719750-95719772 CTTTCAACAAATGGGGAACTGGG - Intergenic
1087362320 11:97176603-97176625 CTTTAGAAAAAGAGGAAATTTGG - Intergenic
1088258440 11:107922942-107922964 CCTTATAAAAAGGGGACATTTGG + Intronic
1088539853 11:110902401-110902423 CTGTATAAAAAGGGGAAATTGGG - Intergenic
1088556931 11:111071265-111071287 CTTTATAAGAAGAGGAAATTAGG + Intergenic
1088724517 11:112622354-112622376 CTTTATAAAACAGGGAAATTTGG + Intergenic
1088953693 11:114597076-114597098 CTTTATACCATGTGTGAATTGGG + Intergenic
1089194984 11:116689062-116689084 CCTTATAGAAAGGGGAAATGTGG + Intergenic
1089531075 11:119129941-119129963 ATTTATACAAAGGCAAAATTGGG + Intronic
1090212763 11:124934484-124934506 CCTTATAAAAAGGGGAAATGTGG + Intronic
1090991893 11:131825215-131825237 CTTTATGAAAAGGGGAGATTTGG - Intronic
1092943048 12:13428190-13428212 CCTTATAAAAGGGGGAAATTTGG + Intergenic
1093388892 12:18593112-18593134 CTTTATAAAAAGAGGAAATGTGG - Intronic
1093830055 12:23744970-23744992 CTTTATAAGAAGAGGAAATTTGG - Intronic
1093881031 12:24404917-24404939 CCTTATAAAAAGGGGAAATTTGG + Intergenic
1094182926 12:27611404-27611426 CCTTATAAAAAGGGGAAATTTGG - Intronic
1094292684 12:28869972-28869994 CTTTATAAAAAGGAGAAATTTGG - Intergenic
1095476694 12:42593049-42593071 CCTTATAAAAAGGGGAAACTTGG + Intergenic
1095658359 12:44698089-44698111 CATTATAAAAAGGAGAAATTTGG - Intronic
1095906418 12:47382797-47382819 CCTCATAAAAAGGGGAAATTTGG - Intergenic
1096655627 12:53089681-53089703 CCTTATAAAAAGGGGAAATTTGG + Intergenic
1097122915 12:56749729-56749751 CTTTTTACAAAGGAGGAAACAGG - Intronic
1097416257 12:59320045-59320067 CTTTATACAAAGAGGCCATTAGG + Intergenic
1097750588 12:63348074-63348096 CCTTACAAAAAGGGGAAATTTGG + Intergenic
1098339528 12:69437573-69437595 CTTTATAAAGAGGGGAAATTTGG - Intergenic
1098435828 12:70467614-70467636 CCTTATAAAAAGGGGAAAATTGG - Intergenic
1098464683 12:70773133-70773155 CCTTATAAAAAGGGAAAATTTGG - Intronic
1098790124 12:74811930-74811952 CTTTATACAAAGTATGAAATGGG - Intergenic
1098974339 12:76886808-76886830 CCTTATACAGAGTGGGAATGGGG + Intergenic
1099165340 12:79299631-79299653 CTCTTTACAAAGGGGGATGTGGG + Intronic
1099450279 12:82799727-82799749 CCTTATAAAAAGGGGAAATGTGG - Intronic
1099688049 12:85914327-85914349 CATTATAAGAAGGGGAAATTTGG - Intergenic
1099696866 12:86034339-86034361 CTTTATACATTGGTAGAATTTGG + Intronic
1099903318 12:88739849-88739871 TTGTATAAGAAGGGGGAATTTGG - Intergenic
1100068293 12:90678703-90678725 CCTTATAAAAAGAGGAAATTTGG + Intergenic
1100703628 12:97177035-97177057 CTTTATAAAGAGGGGAAATTTGG - Intergenic
1101071642 12:101081863-101081885 CTTTATAAGAAGAGGAAATTTGG - Intronic
1101115280 12:101525530-101525552 CCTTATAAAAAGGGGAAATCTGG - Intergenic
1101182661 12:102236350-102236372 CATTATACAAAGGGGAAATTTGG - Intergenic
1101458592 12:104864269-104864291 CTTTATACAAAGGGGTAGAGGGG + Intronic
1101511269 12:105394558-105394580 CCTTATAAAAACGGGAAATTTGG + Intronic
1101568197 12:105929402-105929424 CTTTATGCAAAGGGGCTGTTTGG + Intergenic
1101858000 12:108460317-108460339 TTTTATAAAAAGGGGGAAAATGG + Intergenic
1102214905 12:111153977-111153999 CTTTGTAAAAAGGGGGAACTTGG - Intronic
1102302048 12:111778149-111778171 CTTTATAAAAAGGGGGCTCTAGG + Intronic
1102596229 12:113994483-113994505 CTTTATAAAGAGGGGAAATGTGG + Intergenic
1102741513 12:115211474-115211496 CTTAATTCAAAGAGGGATTTGGG + Intergenic
1104252064 12:127104622-127104644 CCTTATAAAAAGGGGGAATTTGG - Intergenic
1105067876 12:133216190-133216212 CCTTATAAAAAGGGGGAATTTGG + Intergenic
1105387308 13:19943230-19943252 CTTTATGAAAAGGAGAAATTTGG - Intergenic
1105631258 13:22171111-22171133 CTTTACACAAAGAGGTAGTTCGG + Intergenic
1105673577 13:22645812-22645834 CCTTATACAAAGAGGAAATGAGG - Intergenic
1105713233 13:23033621-23033643 CAATACACAGAGGGGGAATTAGG - Intergenic
1106021996 13:25924492-25924514 CCTTATAAAAAGGGCAAATTTGG - Intronic
1106139592 13:27001102-27001124 CCTTATAAAAGGGGGAAATTTGG + Intergenic
1106154730 13:27143787-27143809 TTTTCTATAAAGTGGGAATTAGG - Intronic
1106531749 13:30599693-30599715 CTTTATAAGAAGAGGAAATTTGG - Intronic
1106817439 13:33424316-33424338 ATTTTTACAGAGGTGGAATTTGG + Intergenic
1106882140 13:34143324-34143346 CCTTAGAAAAAGGGGAAATTTGG + Intergenic
1106937519 13:34739513-34739535 CTTTTTAAAAAGGGGGAGATGGG + Intergenic
1106957552 13:34957509-34957531 CTTTAGATAAAGGAGGACTTGGG - Intronic
1107043707 13:35974328-35974350 CCTTACACAAAGAGGGAATTTGG + Intronic
1107153917 13:37144529-37144551 CGTTATAAAAAGGGGAAATTTGG + Intergenic
1107252203 13:38377682-38377704 CTTTATAAAAGGAGGAAATTTGG - Intergenic
1107395992 13:40018148-40018170 CCTTATAAAGAGGGGAAATTTGG - Intergenic
1107443215 13:40446752-40446774 CCTTATAAAAAAGGGAAATTTGG + Intergenic
1107500098 13:40964834-40964856 CCTTATAAAAAGGGGAAATTTGG - Intronic
1107687640 13:42920057-42920079 CTTTATAAAAAGGGGAAATCGGG - Intronic
1108115100 13:47118859-47118881 CCTTATAAAAAGGGGAAATTTGG + Intergenic
1108244417 13:48500256-48500278 CTTTATAAAAAGGGGAAATTTGG + Intronic
1109075483 13:57829317-57829339 CTTTATAGAAAGGTGAAGTTTGG - Intergenic
1109202477 13:59446222-59446244 CCTTATAAAAAGGAGAAATTTGG - Intergenic
1109330857 13:60927945-60927967 CTTTGTACAAAAGGGAAATGAGG + Intergenic
1109483506 13:62987995-62988017 TTTTGTACAAAGTGGGCATTTGG + Intergenic
1109576627 13:64267490-64267512 CCTTATAAAAAGGGAAAATTTGG - Intergenic
1109616645 13:64842571-64842593 CCTTATAAAATGGGGGAATTTGG - Intergenic
1110273958 13:73621936-73621958 TCTTATAAAAAGGGGGAACTTGG - Intergenic
1110452920 13:75657036-75657058 CTTTATAAAAAGGGTAGATTTGG + Intronic
1110535561 13:76647054-76647076 CCTTATAAAAAGTGGAAATTTGG + Intergenic
1110618904 13:77572705-77572727 CTTTATAACAAAGGGAAATTTGG - Intronic
1111816298 13:93157366-93157388 TTTAATATAAAGGGGAAATTTGG - Intergenic
1111841688 13:93457240-93457262 CTTTATAAAAAGGGGAAAGTTGG - Intronic
1111963069 13:94832999-94833021 CTTTATGTAAAGGGAGAACTTGG + Intergenic
1112143442 13:96671699-96671721 CCTTATAAAAGGGGGAAATTTGG - Intronic
1112248603 13:97757102-97757124 CCTTATAAAAAGGGGAATTTGGG - Intergenic
1112527073 13:100160094-100160116 GTTTTTACATTGGGGGAATTTGG - Intronic
1112593688 13:100788339-100788361 CTTTATAAAAAGAGGAAATTTGG + Intergenic
1112682800 13:101786594-101786616 CCTTACACAAAGAGGAAATTAGG - Intronic
1112775850 13:102843471-102843493 CTTTGTAGAAAGAGGAAATTGGG - Intronic
1113399493 13:109977940-109977962 CCTTATAAAAAGGGGAGATTTGG - Intergenic
1113458109 13:110463298-110463320 CCCTATAAAAAGGGGAAATTTGG - Intronic
1113613505 13:111664698-111664720 CCTTATAAAAAGAGGGAGTTTGG + Intronic
1114144543 14:19958890-19958912 CTTTTTACAAATGTGGCATTTGG + Intergenic
1114340029 14:21733627-21733649 CCTTACAAAAAGGGGGAATATGG - Intergenic
1114478817 14:23018087-23018109 CCTTATAAGAAGAGGGAATTTGG + Intronic
1114822996 14:26044095-26044117 CATTATAAAAAAGAGGAATTTGG - Intergenic
1115306533 14:31939259-31939281 CCTTATAAGAAGGGGAAATTTGG + Intergenic
1115741875 14:36397567-36397589 CATTACAAAAAGGTGGAATTTGG - Intergenic
1116030266 14:39562609-39562631 TCTTATAAAAAGGGGAAATTTGG + Intergenic
1116368435 14:44099987-44100009 CTCTATGAAAAGGGGAAATTTGG - Intergenic
1116589804 14:46757570-46757592 CCTTATAAAAAGAGGAAATTTGG - Intergenic
1116777793 14:49201648-49201670 CCTTATAAAAAAGGAGAATTCGG + Intergenic
1116866486 14:50035837-50035859 CCTTATGAAAAGGGGAAATTTGG - Intergenic
1117425248 14:55588014-55588036 CTTTGGACAATGTGGGAATTAGG + Intronic
1117523433 14:56574184-56574206 CTTTATATCAAGTGGGATTTGGG + Intronic
1117772798 14:59151668-59151690 CCTTATAAAAAGGAGAAATTTGG - Intergenic
1117775624 14:59181130-59181152 CTTTATAAAAAGGGTAAATTTGG + Intergenic
1117815433 14:59592984-59593006 CCTTATTCAAAGGGGAAATTTGG + Intergenic
1118389616 14:65285099-65285121 CCTTATATAAAGGGGAAAATTGG + Intergenic
1118421156 14:65605478-65605500 CCTTATAAGAAGGGGTAATTTGG + Intronic
1118742775 14:68752478-68752500 CTTTATAAGAAGAGGAAATTTGG + Intergenic
1118973915 14:70661216-70661238 CCTTATAAAAAGGAGAAATTTGG - Intronic
1119102562 14:71893764-71893786 CTTTAAAATGAGGGGGAATTTGG + Intergenic
1119131431 14:72176338-72176360 CTCTACAGAAAGGGGGAAATGGG + Intronic
1119372598 14:74160158-74160180 CTTTATACAAAGGAAAAGTTTGG + Intronic
1119639787 14:76305928-76305950 CCTTATAAAAAGGGGAAATTTGG + Intergenic
1119816504 14:77573563-77573585 CTTTATAGAAAGGGGAAATTTGG + Intronic
1119851463 14:77869431-77869453 CCTTATAAAAAGGGGAAATTTGG - Intronic
1120425279 14:84339770-84339792 CCTTATACAATGTGGGGATTAGG - Intergenic
1120435147 14:84472045-84472067 CCTTATGCCAAGGGGAAATTTGG - Intergenic
1120601386 14:86514449-86514471 CTTCATACAAAGGGGACATTAGG + Intergenic
1121454468 14:94029523-94029545 CCTTATAAAAAGAGGAAATTAGG - Intronic
1121900601 14:97690263-97690285 CCTTATAAAAAGGGAGAATGTGG - Intergenic
1121974514 14:98390550-98390572 CTTTATAAAACAGGGAAATTTGG - Intergenic
1122003178 14:98681385-98681407 CATCATAAAAAGGGGGAATTTGG + Intergenic
1122161522 14:99787812-99787834 CCTTATAAGAAGGGGAAATTTGG - Intronic
1122253549 14:100459632-100459654 CCTTATAGAAAGGGGAGATTCGG - Intronic
1122384036 14:101331814-101331836 CCTTATCAAAAGGGGAAATTTGG - Intergenic
1122432945 14:101667498-101667520 CCTTATAAAAAGGGGAAATTTGG - Intergenic
1122642910 14:103171447-103171469 GTTTGTACAAAAGGAGAATTTGG - Intergenic
1122837806 14:104438607-104438629 CCTTATAAAAAGAAGGAATTTGG + Intergenic
1123976952 15:25562885-25562907 TCTTATACAAAGGGAAAATTTGG - Intergenic
1123998849 15:25737819-25737841 CCTTATACAAAGGGAAAATCAGG + Intronic
1124422712 15:29536749-29536771 CCTTATAAAAAGGGGAAATTTGG + Intronic
1124507322 15:30289662-30289684 CCTTATAAAAAGGGGAAATTTGG - Intergenic
1124736233 15:32248997-32249019 CCTTATAAAAAGGGGAAATTTGG + Intergenic
1125085672 15:35726343-35726365 CATTATAAGAAGGGGAAATTAGG + Intergenic
1125563520 15:40657731-40657753 CCTTATAAAAAGGGGAAATGTGG - Intronic
1126973017 15:54139257-54139279 TCTTATAAAAAGGGGAAATTTGG - Intronic
1127214470 15:56810226-56810248 CCTTACAAAAAGGGGAAATTTGG - Intronic
1127564831 15:60176982-60177004 CCTTATAAAAAGGGATAATTTGG - Intergenic
1127845602 15:62867899-62867921 CCTTATAAAAAGGGGAAATGTGG + Intergenic
1128385544 15:67145709-67145731 CTTTATACCAATGAGGAAATGGG + Intronic
1128598151 15:68972665-68972687 CCTTATGAAAAGGGGAAATTTGG - Intronic
1129769042 15:78192027-78192049 CCTTATAGAAATGGGAAATTTGG + Intronic
1129923093 15:79337293-79337315 CCTTATATAAAGGGGAAATTAGG - Intronic
1130193038 15:81754458-81754480 CCTTTTAAAAAGGGGGAATTTGG + Intergenic
1130303224 15:82696079-82696101 CTTTATAAGAAGAGGAAATTTGG - Intronic
1130450662 15:84048574-84048596 CCTTATAAAAAGGGGAAATTTGG + Intergenic
1130698600 15:86156379-86156401 CCTTATAAGAAGGGAGAATTTGG - Intronic
1131564755 15:93476049-93476071 CCTTATAAAAAGGGGAAATTTGG + Intergenic
1132196234 15:99916561-99916583 CCTTATAAAAAGGGGAAATTCGG + Intergenic
1132216313 15:100064111-100064133 CCTTATAAAAAGGGGAAGTTTGG + Intronic
1132422928 15:101689509-101689531 CTTTATAAAAAGGAGAAATCTGG + Intronic
1132742095 16:1419702-1419724 GTTTTTAAAAAGGGGGTATTTGG - Intergenic
1133451342 16:5906291-5906313 CTTTGTAAAAAGGGGAAATTTGG + Intergenic
1133556582 16:6911520-6911542 CATCATAAAAAGGGGAAATTTGG - Intronic
1133558805 16:6930708-6930730 CATTTTAAAAACGGGGAATTAGG - Intronic
1133907665 16:10036815-10036837 CCTTATAAAAAGGGGAAAATTGG - Intronic
1133988552 16:10687416-10687438 ATTTTAACAAAGGGAGAATTGGG - Intronic
1134008184 16:10832457-10832479 CCTTATAAAAAGGGGAAATTTGG - Intergenic
1134350113 16:13429512-13429534 CCTTATAGAAAGGAGAAATTTGG - Intergenic
1134407241 16:13971656-13971678 CTGTATATAAAGTGGAAATTTGG - Intergenic
1134759188 16:16698464-16698486 CTTCATTAAAAGAGGGAATTTGG + Intergenic
1134986885 16:18660720-18660742 CTTCATTAAAAGAGGGAATTTGG - Intergenic
1135080432 16:19429859-19429881 CCTTATAAAAAGGGGAACTTTGG - Intronic
1135685853 16:24497852-24497874 CCTTATAAAAAGGGGATATTTGG + Intergenic
1136650065 16:31661425-31661447 CTTTGTACAAAAGGAGAATTTGG - Intergenic
1137218478 16:46424228-46424250 CATTAAACAAAGGGGGACTTGGG - Intergenic
1137971177 16:52986587-52986609 CTTCATAAAGAGGGGAAATTTGG - Intergenic
1138237003 16:55392296-55392318 CCTTATTAAAAGGGGAAATTTGG + Intronic
1138372179 16:56535993-56536015 CCTTATAAAAAGGGGAAATTTGG + Intergenic
1138951080 16:61914041-61914063 CTTTATAAGAAGAGGTAATTTGG + Intronic
1139350826 16:66334229-66334251 CCTTATAAAAAGGGGCAATTTGG - Intergenic
1140826683 16:78713575-78713597 CCTTATAAAAAGAGGAAATTTGG + Intronic
1140968527 16:79990744-79990766 CCTTATAAAAAGGGGAAATCTGG - Intergenic
1141130344 16:81432194-81432216 CCTTATAAAAAGGGGAAGTTTGG + Intergenic
1141808445 16:86357818-86357840 CCTTATAGAAAGGGGAGATTTGG + Intergenic
1141985408 16:87576655-87576677 GTTTATAAAAAGGGGAAATTTGG - Intergenic
1143914786 17:10282227-10282249 CCTAATAAAAAGGGGAAATTTGG - Intergenic
1144005993 17:11100043-11100065 CCTTATACTAAGGGGGATTTAGG + Intergenic
1144016858 17:11204422-11204444 CTATATAAAAAGGAGAAATTGGG - Intergenic
1144455126 17:15412511-15412533 TTTCAAACAAAGGGGAAATTTGG - Intergenic
1144654054 17:17024415-17024437 CCTCATAAAAAGGGGAAATTTGG - Intergenic
1144750313 17:17644046-17644068 CCTTATCAAAAGGGGAAATTTGG + Intergenic
1144816208 17:18037274-18037296 CTTTATAGAAATGGGGAAGGGGG - Intronic
1145054924 17:19696149-19696171 CCTTATTAAAAGAGGGAATTTGG + Intronic
1145178951 17:20728058-20728080 CCTTATAAAAAGGGGAAATTTGG - Intergenic
1146147698 17:30435956-30435978 CCTTGTACAAAGGGGAAACTGGG - Intronic
1146852770 17:36237660-36237682 CCTTATAAAAAGGGGAAATTTGG + Intronic
1148987401 17:51635159-51635181 CTTTATAAAAAGGGGAAATTTGG + Intronic
1149381015 17:56093990-56094012 CCTTATAAAAAGGAGAAATTTGG + Intergenic
1149838607 17:59937641-59937663 CCTTATAAAAAGGGGAAATTTGG - Intronic
1150726145 17:67652977-67652999 CCTTATAAAAAGGAGAAATTTGG + Intronic
1150841018 17:68605338-68605360 CCTTATAAAAAGGAGAAATTGGG + Intergenic
1150915048 17:69428426-69428448 CCTTATAAAAAGGGGAAATTTGG - Intronic
1151178863 17:72311326-72311348 CCTTATAAAAAAGGGAAATTTGG + Intergenic
1151249294 17:72821199-72821221 CCTTATAAAAAGGGGAAATCTGG + Intronic
1151269872 17:72985909-72985931 CCTTATAAAAAGGAGAAATTTGG + Intronic
1151474205 17:74336430-74336452 CGTTATGAAAAGGGGAAATTTGG - Intronic
1151881172 17:76895642-76895664 TTTTATCAAAAGGGGAAATTTGG - Intronic
1152048214 17:77952884-77952906 CTTTCTAAAAAGGGGACATTTGG - Intergenic
1153050107 18:893970-893992 CCTTACAAAAAGGGGAAATTTGG - Intergenic
1153512798 18:5873776-5873798 CCTTATATGAAGGGGAAATTTGG + Intergenic
1153619556 18:6964389-6964411 CCTTATAAAAAGGGGAAATGTGG + Intronic
1153683758 18:7525448-7525470 CTTTATAGGAAGGAGGAAATGGG - Intergenic
1155409128 18:25522846-25522868 CCTTATAAAAAGGGGCAGTTTGG + Intergenic
1155504753 18:26522253-26522275 CCTTATAGAAAGGGGAAACTTGG + Intronic
1155618446 18:27747956-27747978 CTTTATGAAAAGTGGAAATTTGG + Intergenic
1155879885 18:31132145-31132167 CCTTATAAAAAGGGGAAATTTGG + Intronic
1155883179 18:31176140-31176162 CCTTATATAAAGGGGAAATTTGG - Intergenic
1156247861 18:35319933-35319955 ATTAATACAAAGGTAGAATTTGG + Intergenic
1156617928 18:38810080-38810102 CCTTATAAAAAGAGGAAATTTGG - Intergenic
1157174895 18:45442523-45442545 CTTAATAAAAAGAGGAAATTTGG - Intronic
1158158149 18:54449052-54449074 CTTTATAAAAAGGGGACATTTGG + Intergenic
1158269422 18:55696867-55696889 CTCTATACAAACTGGGACTTTGG - Intergenic
1158681834 18:59574975-59574997 CCATATAAAAAGGGGAAATTTGG + Intronic
1159117744 18:64135174-64135196 CCTTATAAAAAGGGGTAATTTGG - Intergenic
1159226713 18:65547508-65547530 CTTTATAAAAAGGGCCAGTTTGG - Intergenic
1159735254 18:72088901-72088923 CTTTATGAAAAGGGGAAATTTGG + Intergenic
1159829846 18:73262946-73262968 CTTTATTAAAAGAAGGAATTTGG - Intronic
1160450245 18:78957971-78957993 CTTTTTAAAAAGGGCCAATTTGG - Intergenic
1160884609 19:1339874-1339896 CTTTATAAAGATGGGAAATTTGG - Intergenic
1161163343 19:2772694-2772716 CCTTATAAAAAGGGGACATTTGG + Intronic
1161209852 19:3060876-3060898 TTTTATCCAATGGGGGACTTGGG + Intronic
1161232738 19:3182989-3183011 CCTTATAAAAATGGGGAAATCGG - Intergenic
1161629804 19:5348032-5348054 CCTTATACAAAGGGGAAATTTGG + Intergenic
1161629910 19:5348681-5348703 CCTTATAAAAAGGGGAAATCTGG - Intergenic
1161937961 19:7383663-7383685 CCTTATAGAAAGGGGAAACTGGG - Intronic
1162456991 19:10791386-10791408 CCTTATAAAAAGGGGGAGTTGGG - Intronic
1162693386 19:12452044-12452066 GTTTGTACAAAAGGAGAATTTGG - Intronic
1163662202 19:18585215-18585237 CTGTATATAAGGGGGAAATTAGG - Intronic
1163923935 19:20320854-20320876 GTTTTTACAAAAGGAGAATTTGG + Intergenic
1164509575 19:28886325-28886347 CTTTACAAAAAGGGGGCTTTTGG - Intergenic
1164976237 19:32574772-32574794 CCTTATATAAAGGGGATATTTGG - Intergenic
1165379709 19:35470000-35470022 CTTTTTACAAAAAGGGAAATTGG + Intergenic
1165478531 19:36047140-36047162 GTTTATACAAAGGGGAACATGGG - Intronic
1166335143 19:42101407-42101429 CCTTATAAAAAGGGCAAATTTGG + Intronic
1167203376 19:48083332-48083354 CATTTTACAAAGGAGAAATTGGG + Intronic
1167255923 19:48428661-48428683 CCTTATAAAAAGGGGAACTTGGG - Intronic
1168095635 19:54113266-54113288 CCTTATAAAAAGGGTAAATTGGG + Intronic
1168497854 19:56869282-56869304 CCTTATGAAAAGGAGGAATTTGG - Intergenic
1168623368 19:57896719-57896741 GTTTGTACAAAAGGAGAATTTGG - Intronic
925311475 2:2887297-2887319 CCTCATACAAAGGGAAAATTTGG - Intergenic
925461332 2:4065639-4065661 CCTTATCAAAAGGGGAAATTTGG + Intergenic
925462487 2:4075421-4075443 GCTTATAAAAAGTGGGAATTTGG - Intergenic
925730057 2:6913363-6913385 CCTTATGTAAAGGGGAAATTTGG - Intergenic
925744461 2:7032670-7032692 CCTGATAGAAAGGGGGGATTTGG - Intronic
925809462 2:7685083-7685105 CTTGATGAAAAGGGGGAATTTGG - Intergenic
925869096 2:8253743-8253765 CTTTATTAAAAGTGGAAATTTGG - Intergenic
925983579 2:9196807-9196829 CCTTATAAAAAGGGGAAATTTGG + Intergenic
926156301 2:10455838-10455860 CCTGATATAAAGGGGAAATTTGG + Intergenic
926284597 2:11478545-11478567 CTTTATAACAAGAGGAAATTTGG + Intergenic
926363220 2:12109798-12109820 CCTTATACAAAGGTGGAATTTGG - Intergenic
926562013 2:14427985-14428007 CTTTATAAAAAAGGGAAACTGGG - Intergenic
926708103 2:15850908-15850930 CCTTATAAAAAGGGGGAATTTGG + Intergenic
927404624 2:22753346-22753368 CAGTTTACAAAGGGGGAAATGGG + Intergenic
928112828 2:28524446-28524468 CATTTTACCAAGGGGGAAATCGG + Intronic
928395867 2:30942957-30942979 CCTTATAAAAAGGGGAAATTTGG + Intronic
928607276 2:32954490-32954512 CCTTATAAAAAGGGGAAATTTGG - Intronic
929833861 2:45375929-45375951 CCTTATAAAAAGGGGAAATTTGG - Intergenic
930037390 2:47095299-47095321 CTTTATTAAAAGGGGAAATTTGG + Intronic
930285620 2:49424087-49424109 CCTTATAAAAAGGGGGAATTTGG + Intergenic
930397248 2:50838596-50838618 CTTTATAAAAAGGTGAAATTTGG + Intronic
931120331 2:59210627-59210649 CCTTATAAAAAGAGGAAATTTGG - Intergenic
931158964 2:59667055-59667077 CCTTATAAAAAGGGGAAATTAGG - Intergenic
931636147 2:64342152-64342174 CCTTATAAAAAGGGGAAGTTTGG + Intergenic
931780127 2:65572303-65572325 CTTTATAAGAAGTGGGGATTAGG + Intergenic
932016947 2:68038217-68038239 CTTTATAAAACCGGGAAATTGGG - Intergenic
932628280 2:73316465-73316487 CTTTATAAAAAGGAAAAATTTGG - Intergenic
932689579 2:73900917-73900939 CTTTATAAGAAGAGGGAATTAGG - Intronic
932834901 2:75027177-75027199 ATTTATACAAAGTTGAAATTAGG + Intergenic
933124730 2:78590459-78590481 CCTTATAAAAAGGGGAAGTTTGG + Intergenic
934888528 2:98045998-98046020 CCTTATATAAAAGGGAAATTTGG - Intergenic
934995000 2:98949749-98949771 CCTTATAAAAAGGGGAAATTTGG + Intergenic
935127378 2:100236222-100236244 CTTTATACAAAGGGGAAATTTGG + Intergenic
935237991 2:101153765-101153787 CCTTATAAAAAGAGGAAATTTGG + Intronic
935468202 2:103424986-103425008 CCTTATAAAAAGGTGAAATTTGG + Intergenic
935573213 2:104684173-104684195 CTTTTTAAAATGGGAGAATTTGG + Intergenic
935573354 2:104686017-104686039 CTTTATACATAGGGACCATTTGG + Intergenic
935866090 2:107389118-107389140 CTTCACACAAAGGGGAAGTTTGG + Intergenic
935945733 2:108284995-108285017 CCTTATAAAAGGGGGAAATTTGG + Intergenic
935950346 2:108323237-108323259 CTATATAAAAAGGCAGAATTTGG - Intergenic
936822010 2:116533355-116533377 CTTTATAAGAAGAGGAAATTTGG - Intergenic
936968039 2:118146537-118146559 TTTTATACAACTGGGGACTTTGG - Intergenic
937759218 2:125580359-125580381 CATTTTACAAAGGAGGAATCTGG - Intergenic
938196527 2:129333797-129333819 CCTTATAAAAATGGGGAATTTGG - Intergenic
938878057 2:135554674-135554696 GTCTATAAAAAGGGGAAATTTGG + Intronic
938989918 2:136617206-136617228 CTTCATAAAAATGGGAAATTTGG - Intergenic
939011007 2:136845914-136845936 GTTTATACAAAAGGGGTATTGGG + Intronic
939261438 2:139815428-139815450 CTTCATAGAAAAGGGGACTTTGG + Intergenic
939843408 2:147215695-147215717 CCTTATAAAAAGAGGGAATTTGG + Intergenic
939872803 2:147543536-147543558 CTTTATACAAAGGATGAGTTTGG + Intergenic
940071387 2:149692138-149692160 CATTATATAAAGAGGAAATTAGG + Intergenic
940129336 2:150363263-150363285 ACTTATAAAAAGGGGAAATTTGG + Intergenic
940284129 2:152016917-152016939 TTTTATACACAGGGGAAATGAGG + Intronic
940326234 2:152428056-152428078 CCTTTTACAAAGGGGGAATGTGG - Intronic
940888669 2:159013986-159014008 CTTTTTAAAAAGGAGAAATTTGG - Intronic
941165334 2:162077772-162077794 CTTTATAAAAAGGAGAGATTTGG + Intergenic
941242412 2:163055660-163055682 CTTTATAAAAAGAGGGACGTTGG - Intergenic
941635869 2:167934428-167934450 TTTTATAAAAAGGGTAAATTTGG + Intergenic
941886318 2:170531215-170531237 ATTTTTACAAATGGGGCATTTGG - Intronic
942245767 2:174006421-174006443 CTTTATAAAAAGGGAAAATCTGG - Intergenic
942486072 2:176441070-176441092 CTTTATAAAAAGAGGAAATTTGG - Intergenic
942958123 2:181797991-181798013 CTTTATATAAAGGGGAAATTTGG - Intergenic
943112632 2:183624873-183624895 CTTCATAAAAAGAGGTAATTTGG - Intergenic
943462925 2:188192042-188192064 CTTTATAGAAAGGAGAAATCTGG - Intergenic
943874185 2:193041353-193041375 CTCTATAATAAGGGGAAATTTGG - Intergenic
943881750 2:193154397-193154419 TCTTATAGAGAGGGGGAATTTGG - Intergenic
943893529 2:193322320-193322342 CCTTATAAAAAATGGGAATTTGG - Intergenic
943910890 2:193566023-193566045 CCTTATAAAAGGGGGTAATTTGG + Intergenic
944036756 2:195303605-195303627 CTTTACAAAAAGGGGAAGTTTGG - Intergenic
944150134 2:196548884-196548906 CCTTATAAAAAGGGGAAATATGG - Intronic
944450121 2:199834142-199834164 CCTCATAAAAAGGGGAAATTGGG + Intronic
945175334 2:207038038-207038060 CCTTATAAAAAGAGGAAATTTGG + Intergenic
945609361 2:211979195-211979217 GTTTATACAAAGGGGAATTTTGG + Intronic
945655059 2:212612837-212612859 CTTTATAAAAAGGGGAAATCTGG - Intergenic
946532676 2:220589211-220589233 CCTTATAAAAAGGGGAAATTTGG + Intergenic
946668467 2:222076328-222076350 CTTTGTAAAAAGGAGAAATTTGG + Intergenic
946763974 2:223023007-223023029 CCTTATAAAAAGGGGAAATCTGG - Intergenic
947340279 2:229130984-229131006 CTTTATAAAAAGTGGAAATTTGG - Intronic
947484303 2:230533927-230533949 CACTATACAAAGGTGAAATTTGG + Intronic
947597469 2:231422287-231422309 CTTTATAAGAAGAGGAAATTTGG - Intergenic
948056810 2:235014731-235014753 ATTTATACAAAGAGGAAATGTGG - Intronic
948261202 2:236605727-236605749 CTTTATACAAAGAGGGGATTTGG - Intergenic
948332476 2:237180745-237180767 CTTTATACAAACGGGGTAAGAGG - Intergenic
949066407 2:241993386-241993408 CTTCATGGAAAGGGGAAATTTGG - Intergenic
1169292167 20:4362039-4362061 CCTTATAGAAAGGGGAAATTTGG + Intergenic
1169520895 20:6371927-6371949 CTTTATAAAAAGGGGGCATTTGG + Intergenic
1169640110 20:7742008-7742030 CTTTAGACATCTGGGGAATTAGG + Intergenic
1170102351 20:12716236-12716258 CCTTATAAAAAGGGGATATTTGG + Intergenic
1170517051 20:17141186-17141208 ATTTATAAAATGGGGAAATTGGG - Intergenic
1170641384 20:18156783-18156805 CCTTACACAAAGGGGAAACTTGG - Intronic
1170931760 20:20774880-20774902 CTTTATAAAAAGGAGACATTTGG - Intergenic
1170971581 20:21121934-21121956 CTTCATAAAAAGGCAGAATTTGG + Intergenic
1171026466 20:21634822-21634844 CTCTATAAAATGGGGGCATTGGG + Intergenic
1171152971 20:22844108-22844130 CCTTTTAAAAAGGGGAAATTTGG + Intergenic
1171462372 20:25305659-25305681 CTTTAAAAAAAGAGGGAAGTAGG - Intronic
1172341446 20:34161180-34161202 CTTTATAAGAAGAGGAAATTTGG - Intergenic
1172893926 20:38286397-38286419 CCTTATAAAAAGGGGAAATGTGG - Intronic
1172909261 20:38394411-38394433 CCTTATAAAAAGGGAAAATTTGG + Intergenic
1173254519 20:41384696-41384718 CTTTATAAGAAGAGGAAATTAGG - Intergenic
1173331896 20:42082236-42082258 CATTATACAAGTGGGGAACTTGG - Intronic
1173631240 20:44517473-44517495 CCTTATAAAAAGGGGAAACTTGG + Intronic
1175560657 20:59926496-59926518 ATTTATAAAAAGGGGAAATTTGG - Intronic
1175938982 20:62529144-62529166 CCTGATACAAAGGGGAAATCTGG + Intergenic
1177051206 21:16236768-16236790 CTTTATACAATGTGGACATTGGG - Intergenic
1177298078 21:19202783-19202805 TCTTATAAAAAGAGGGAATTGGG + Intergenic
1177859210 21:26433407-26433429 CTTTCTGAAAAGGGGAAATTTGG + Intergenic
1177877538 21:26652033-26652055 CTTTACAAAAAGGAGAAATTTGG + Intergenic
1177952855 21:27560535-27560557 CTTTATATGAAGAAGGAATTTGG + Intergenic
1178354726 21:31901056-31901078 CCTTATAAAAAGGAGAAATTTGG - Intronic
1178355154 21:31905150-31905172 CTTTATAAGAAGAGGAAATTTGG + Intronic
1178368782 21:32009886-32009908 CCTTATAAGAAGGGGAAATTGGG + Intronic
1178491180 21:33053004-33053026 CTTTCGGCAAAGGGGAAATTTGG - Intergenic
1178599859 21:33986027-33986049 CCTTATAAAAAGGGGAAATGTGG - Intergenic
1178611441 21:34085414-34085436 CTTAATACAAAAGGGAAATAGGG - Intronic
1178627876 21:34233364-34233386 CCTTATAAAAAGGAGAAATTTGG - Intergenic
1178757229 21:35363367-35363389 CCTTATGAAAAGGGGAAATTTGG + Intronic
1178763122 21:35423029-35423051 CCTTATAAAAAGAGGAAATTTGG + Intronic
1178812333 21:35895611-35895633 CTTTATCAAAAGGGGAAATTTGG + Intronic
1178991901 21:37363892-37363914 CCTTATAAAAAGGAGAAATTTGG - Intergenic
1179010484 21:37552499-37552521 CCTTATAAAAATGGGAAATTTGG + Intergenic
1179107338 21:38414255-38414277 CCTTACACAAAGGAGAAATTTGG - Intronic
1179112718 21:38461289-38461311 CCTTATAAAAAGAGGTAATTTGG - Intronic
1179153980 21:38833596-38833618 CCTTATAAAAAGGGGGAATTTGG - Intergenic
1179257606 21:39730275-39730297 CCTTATAAAAAGGGGCAATTTGG - Intergenic
1179332700 21:40420699-40420721 CTTTATACAAAGGGGGAATTTGG + Intronic
1179343823 21:40537634-40537656 CTTTATAAATAGGAGAAATTTGG + Intronic
1179640869 21:42746502-42746524 CCTTACAAAAAGGGGGAATTTGG - Intronic
1179708939 21:43200735-43200757 CTTTATAAGAAGAGGAAATTAGG - Intergenic
1179841373 21:44076921-44076943 CTTTGTAAAAAGGAGTAATTTGG + Intronic
1179931331 21:44572812-44572834 CCTTATAAAAAGGGGAGATTTGG + Intronic
1181349298 22:22244044-22244066 CCTTATAAAAAGGGGAAATTTGG - Intergenic
1181547595 22:23611265-23611287 CATTATACAGATGGGGAATGTGG - Intronic
1181992533 22:26848236-26848258 CCTTATATAAAGGGGAGATTTGG + Intergenic
1182014912 22:27031617-27031639 CCTTATCAAAAGGGGGAATTTGG - Intergenic
1182874510 22:33679429-33679451 TCTTATATAAAGGGGAAATTTGG + Intronic
1183930450 22:41233159-41233181 ATTTATAAAAAGGGGAAATTTGG + Intronic
1184124799 22:42479528-42479550 CTTTATACTAAAGGAGATTTGGG + Intergenic
1184406441 22:44303412-44303434 TTTTATAAAAAGGGACAATTTGG + Intronic
1184583941 22:45435187-45435209 CCTTATGAAAAGGGGAAATTTGG - Intergenic
1184632923 22:45799469-45799491 CCTTATAAAAAGGGGAAATTGGG + Intronic
949167503 3:959801-959823 CCTTATAAAAAGGGGAAATTTGG + Intergenic
949236803 3:1818892-1818914 CTTTATGAAAGGGGGAAATTTGG - Intergenic
949297150 3:2538107-2538129 CCTTATAAAAGGGGGAAATTTGG + Intronic
949407751 3:3732557-3732579 CCTTATAAAAAGGGAAAATTTGG - Intronic
949409227 3:3745668-3745690 CCCTATAGAAAGGGGAAATTGGG - Intronic
949449470 3:4169371-4169393 CTTTATAAAAAGGGGAAATTTGG + Intronic
949527146 3:4916119-4916141 CCTTATAAAAAGGGGAAATTTGG - Intergenic
949542643 3:5045852-5045874 CTTTATAAAAAGAGGAGATTAGG + Intergenic
949620702 3:5808701-5808723 CCCTATCCAAAGGGGGAAATTGG + Intergenic
949676212 3:6456348-6456370 TCTTATACAAAGGGGAAATTTGG - Intergenic
949911090 3:8908401-8908423 GTTTATAAAAGGGGGAAATTTGG + Intronic
949944922 3:9182332-9182354 CCTTGTAAAAAGGGGAAATTTGG + Intronic
950113825 3:10437859-10437881 CCGTATACAAAGAGGAAATTTGG + Intronic
950635848 3:14314016-14314038 CCTTATAAAATGGGGGAATTTGG + Intergenic
950749373 3:15116808-15116830 CCTTATAGGAAGAGGGAATTAGG - Intergenic
950844464 3:16001051-16001073 CCTTATACAAAGGGGAAATTTGG - Intergenic
951008329 3:17646110-17646132 CTTTATAAGAAGGGTAAATTTGG + Intronic
951145222 3:19218866-19218888 CCTTATAAAAAGAGGAAATTTGG - Intronic
951456494 3:22898061-22898083 ATTGATTAAAAGGGGGAATTTGG + Intergenic
951797126 3:26551847-26551869 CTTTAGGCAAAGTTGGAATTAGG - Intergenic
951934830 3:28010906-28010928 ATTTAAACAAAGGGAAAATTTGG + Intergenic
952262859 3:31757295-31757317 TCTTATAAAAAGGGGAAATTTGG + Intronic
952272950 3:31850433-31850455 TTTTCAACAAAGGGGGAAGTGGG - Intronic
952411348 3:33052654-33052676 ATTCATACAAAGGTTGAATTTGG - Intronic
953382980 3:42488093-42488115 CCTTATAAAAAGGGGAAATTTGG + Intergenic
954787102 3:53101734-53101756 CCTTATAAAAAGGGGAAACTTGG + Intronic
954961899 3:54573064-54573086 CTTTATATAAAGGGACAATTTGG - Intronic
955081893 3:55665488-55665510 CCTTATAAGAAGGGGAAATTTGG + Intronic
955520421 3:59770406-59770428 CCTTATACAAAGGGAAAATTTGG + Intronic
956143866 3:66172840-66172862 CCTCATAAAAAGGGGAAATTTGG - Intronic
956406670 3:68934868-68934890 CCTTATAAAATGGGGAAATTTGG + Intergenic
956849315 3:73213773-73213795 CCTTATAAAAAGGGGAAATTTGG + Intergenic
956865315 3:73363477-73363499 CCTTATAAAAAGGGGAAATTTGG - Intergenic
956930304 3:74035838-74035860 CTTTATAAGAAGGGGAGATTAGG - Intergenic
957196042 3:77070011-77070033 CCTTATAAAAAGGGAGAATTTGG + Intronic
957346183 3:78964165-78964187 CCTTATAGAAAGGGGAAATTTGG - Intronic
957544400 3:81618693-81618715 CTTAATACAAAGGGAGATTCAGG - Intronic
957589725 3:82180403-82180425 CCTTATAAAAAGAGGAAATTCGG - Intergenic
957868559 3:86057290-86057312 CTTTTTAAATAGGGGGAAGTGGG + Intronic
958424856 3:93968265-93968287 CCTTATAAAAAGGGGAAATGTGG + Intronic
958834653 3:99130675-99130697 CCTTATAAAAAGGGGAAAGTAGG - Intergenic
958880388 3:99662864-99662886 CCTTATAAAAAGGGGAAATTTGG - Intronic
959911794 3:111771693-111771715 CCTTACACAAAGGAGAAATTTGG - Intronic
960018141 3:112916517-112916539 CCTTATATAAAGAGGGAATTTGG + Intergenic
960195720 3:114765354-114765376 CTGTAGAGAAAGGGGAAATTTGG + Intronic
960240676 3:115338324-115338346 CATTATACAAATGGATAATTTGG + Intergenic
960275258 3:115721747-115721769 CTTTACAAAATGGGGAAATTTGG - Intergenic
960344089 3:116511031-116511053 CCTTATAAAAAGGGGAAATTTGG + Intronic
960427566 3:117527502-117527524 CCTTATAAAAAAGGGAAATTTGG + Intergenic
960544806 3:118902057-118902079 CTCTATATAACGAGGGAATTGGG + Exonic
960617140 3:119606328-119606350 CTTTATATAAAGAGGAAATTTGG - Intronic
960704676 3:120470379-120470401 CCTTATGAAAAGGGGAAATTTGG - Intergenic
961008525 3:123420995-123421017 CCTTATAAAAAGGGGAAATTTGG - Intronic
961352861 3:126315163-126315185 CCTTATAAAAAGGGGACATTTGG - Intergenic
961903995 3:130243513-130243535 CTTTTTATAAAGGCGGCATTTGG - Intergenic
962372175 3:134829791-134829813 CCTTATAAAAATGGGAAATTTGG + Intronic
962996433 3:140633337-140633359 CCTTATGAAAAGGGGAAATTTGG + Intergenic
963045547 3:141100348-141100370 CCTTATGGAAAGGGGAAATTTGG + Intronic
963425884 3:145122832-145122854 CTTGCCACAAAGGGGGAAATGGG - Intergenic
963766047 3:149336951-149336973 GATTATAAAAAGAGGGAATTTGG + Intergenic
963923107 3:150924808-150924830 CTTTTTCCAAGGGGGGATTTTGG + Intronic
964000105 3:151760922-151760944 CTTTATAAAAAGGGAAAATTGGG - Intronic
964316083 3:155445546-155445568 CCTTATGCAAATGGGAAATTTGG - Intronic
964473137 3:157075158-157075180 CCTTATGAAAAGGGGAAATTTGG - Intergenic
965149427 3:164951224-164951246 CTTTATAAAAGGGGGAAATTTGG - Intergenic
965355628 3:167669634-167669656 CTTTATAAAAAGAAGAAATTGGG - Intergenic
966436057 3:179885343-179885365 CCTTATAAAAAGGGGAAATTTGG + Intronic
966543082 3:181114027-181114049 CTTTATTAAAGGGGGGAATTTGG - Intergenic
966587081 3:181638343-181638365 CCTTCTAAAAAGGGTGAATTTGG - Intergenic
967982991 3:195076817-195076839 CTTGATAGAAAGGGGCAATGTGG - Intronic
968006541 3:195247051-195247073 ATTTATAGAAAAGGTGAATTAGG - Intronic
968169282 3:196496461-196496483 CCTTATAAAAAGGAGAAATTTGG - Intronic
968673978 4:1867157-1867179 CCTTATAAAAAGGGAAAATTTGG - Intergenic
969056358 4:4405269-4405291 CCTTATAAAGAGGGGAAATTTGG - Intronic
969421255 4:7097744-7097766 CCTTATAAAGAGGGGAAATTTGG + Intergenic
969502896 4:7564410-7564432 CCTTACAGAAAGGGGAAATTTGG - Intronic
970068074 4:12122303-12122325 CATTTTACAGAGGGGGAAATTGG - Intergenic
970410105 4:15797811-15797833 CCTTATGAAAAGGGGAAATTTGG - Intronic
970445770 4:16122230-16122252 CTTTTTAAAAAGGGAAAATTTGG + Intergenic
970461895 4:16283048-16283070 CTTTATAAAAAGGAGAAATTTGG + Intergenic
970506015 4:16731272-16731294 GTTTGTACAAAGTGGGAAGTTGG - Intronic
970648224 4:18147532-18147554 CTTTATAAAGAGGAGAAATTTGG - Intergenic
970892477 4:21063032-21063054 TCTTATAAAAAGGGGAAATTTGG + Intronic
971069393 4:23073955-23073977 TTTTATAAAAAAGGGAAATTTGG + Intergenic
971157150 4:24095501-24095523 CCTTATAAAAAGGGGAAAATTGG + Intergenic
971347797 4:25827349-25827371 CTTTATAAAAAAGTGAAATTTGG + Intronic
971528116 4:27648398-27648420 CCTTATATTAAGAGGGAATTTGG - Intergenic
972554973 4:40172492-40172514 CCTTATAAAAAGGAGGAATTTGG + Intergenic
972574288 4:40337884-40337906 CCTTATAGAAAGGGGAAATTTGG - Intronic
972667748 4:41183514-41183536 CCTTATAAAAAGGGAAAATTTGG + Intronic
972722723 4:41716540-41716562 CTTCATAAAAAGGGGAAATTTGG + Intergenic
972872415 4:43316042-43316064 CTTTATAAAAAGGAGGAATTTGG + Intergenic
973302571 4:48604476-48604498 CCTTTTAAAAAGGGGAAATTTGG + Intronic
973829436 4:54743432-54743454 CTTCATCAAAAGGGGGAACTTGG - Intergenic
973971505 4:56218066-56218088 CCTTGTAAAAAGGGGAAATTGGG - Intronic
974020929 4:56691733-56691755 TTTTATAAAAAGGGAAAATTTGG - Intergenic
975601791 4:76108120-76108142 CTTGTTATAAAGGGAGAATTGGG - Intronic
976694784 4:87907853-87907875 CTTTGTAAAAAGGAGAAATTTGG - Intergenic
976785089 4:88810440-88810462 CCTTATAAAAAGGGGAAATTTGG + Intronic
976816122 4:89149620-89149642 CCTTATAAGAAGGGGAAATTTGG + Intergenic
976947497 4:90788567-90788589 CTTATTAAAAAGGGGAAATTTGG - Intronic
977055616 4:92186952-92186974 TCTTATAAAAAGGGGAAATTTGG - Intergenic
977212824 4:94241407-94241429 CCTTATAAAAAGGGGAAATTTGG - Intronic
977437367 4:97015671-97015693 CTTTTTAAAGAGTGGGAATTAGG - Intergenic
978931400 4:114317013-114317035 CCTTATCAAAAGGGGAAATTTGG + Intergenic
978970199 4:114794184-114794206 CATTATATAAATGGAGAATTTGG + Intergenic
979367201 4:119839730-119839752 CATTATAAAAAGGAGAAATTTGG - Intergenic
979428205 4:120594016-120594038 CTTTATAAAAAGAGAAAATTTGG - Intergenic
979935194 4:126684976-126684998 CCTCATAAAAAGGGGAAATTTGG - Intergenic
980396294 4:132220304-132220326 CTTTATAAAAGGGGGAAATTTGG - Intergenic
980565757 4:134537990-134538012 CCTTATAAAAAGGGGAAATTTGG - Intergenic
980806451 4:137820977-137820999 CCTTATACAAAGAGAAAATTCGG - Intergenic
981099250 4:140812272-140812294 CCTTATAAAGAGGGGAAATTTGG - Intergenic
981429094 4:144640210-144640232 CCTTATAAAAAGGAGAAATTTGG + Intergenic
981547830 4:145912631-145912653 CCTTATAAAAGGGGGAAATTTGG + Intronic
981773278 4:148334995-148335017 CTTTATACAAAGGGGAAATTGGG - Intronic
981898050 4:149827967-149827989 TTTCATACAAAAGGGGTATTTGG - Intergenic
982233597 4:153231790-153231812 CCTTACAAAAAGGGGGAATTTGG - Intronic
982823536 4:159974310-159974332 CTTTAAAAAAAGGGGTAATTTGG - Intergenic
983176213 4:164590816-164590838 CTTTATAAAAAGAGGAAATTTGG + Intergenic
983433568 4:167682601-167682623 CTTTATAAAAAGGGAAAATTTGG + Intergenic
983627889 4:169820943-169820965 TTTTCTACAAAGGGTTAATTTGG - Intergenic
983631406 4:169853187-169853209 CTTTTTCCAAAGGGGGTTTTTGG - Intergenic
983887867 4:173001017-173001039 CTTCATAAAAAGGGGAAATTTGG + Intronic
984049252 4:174843410-174843432 CCTTATATAAAGAGGAAATTTGG + Intronic
984821855 4:183889276-183889298 CCTTATAAAAAGGGGAAACTGGG + Intronic
985045194 4:185933644-185933666 GTTTATAAAAAGGGGAAGTTTGG - Intronic
985152108 4:186958127-186958149 GTTCATACAAAGGGAGAATCTGG - Intergenic
985197980 4:187452403-187452425 CCTTATAAATAGGGGAAATTTGG - Intergenic
985657839 5:1141228-1141250 CCTTATTAAAAGGGGGAATTTGG - Intergenic
985712999 5:1440668-1440690 CCTCATAAAAACGGGGAATTTGG + Intronic
985802253 5:2012396-2012418 CTTTATAGAAAGGAGACATTGGG - Intergenic
985820166 5:2154157-2154179 CTTTATTCACAGGGTGACTTGGG + Intergenic
985860074 5:2464018-2464040 CCTTATCAAAAGGGGGACTTGGG + Intergenic
986113514 5:4746092-4746114 CTTTATAAGAAGAGGGGATTAGG - Intergenic
986462538 5:7987120-7987142 CTTTATGCGAAGAGGAAATTTGG + Intergenic
986480472 5:8181643-8181665 CTTTATAATGAGTGGGAATTTGG - Intergenic
986635083 5:9813125-9813147 CTTTATAAAAAGGGGGAAATTGG + Intergenic
986666650 5:10110231-10110253 CTTTATAAAAGGGGGAGATTTGG + Intergenic
986668628 5:10124834-10124856 CTTTATCAAAAGGGGAAATTTGG + Intergenic
986744985 5:10736030-10736052 CTTTATAAAAAGGGGAAGTTTGG + Intronic
986745236 5:10737898-10737920 CCTTATGAAAAGGGGAAATTTGG + Intronic
986778927 5:11046235-11046257 CCTTACAGAAAGGGGAAATTTGG + Intronic
986869218 5:12027851-12027873 CTTAATGCAAAGGGGGAATGTGG - Intergenic
986925667 5:12745846-12745868 TTTTAGAGAAAAGGGGAATTAGG - Intergenic
987639483 5:20594427-20594449 CCTTATAAAAAGGGGAAATTTGG - Intergenic
987826758 5:23040146-23040168 CCTTACACAAAGGGGAAATTTGG + Intergenic
988414050 5:30923521-30923543 CCTTATAAGAAGGGGAAATTTGG + Intergenic
988503955 5:31805829-31805851 CTTTATAAAAAGGGCAAATTCGG + Intronic
988800610 5:34693066-34693088 CTTTATGTAAAGGAGGAATCTGG - Intronic
988851937 5:35189056-35189078 TCTTATAAAAAGGGGAAATTTGG + Intronic
989094618 5:37770297-37770319 CTTTATAAGAAGAGGAAATTTGG + Intergenic
989333007 5:40281757-40281779 CTTTATAAACACGGGAAATTTGG - Intergenic
989619288 5:43368695-43368717 CTTCATATAAAGGGGAATTTTGG + Intergenic
989767928 5:45108373-45108395 TCTTATAAAAAGGGGAAATTTGG + Intergenic
990332197 5:54739186-54739208 CTTTATAAAAAGGGGAAATGTGG + Intergenic
990417712 5:55601872-55601894 CTTTATAAGAAGGGGAAACTTGG + Intergenic
990597173 5:57323441-57323463 CCTTAAAAAAAGGGGGAATTTGG + Intergenic
990785268 5:59411631-59411653 CTTTATAAAGGGAGGGAATTTGG - Intronic
991400482 5:66246090-66246112 CCCTATAAAAAGGGGAAATTTGG - Intergenic
991437331 5:66610240-66610262 CCTTATAAAAAGGGGAAATGTGG - Intronic
992202438 5:74397663-74397685 CCTTATAAGAAGAGGGAATTTGG - Intergenic
992908351 5:81370514-81370536 CTTTATAAAAAGGGGAAATTTGG + Intronic
992936140 5:81707397-81707419 CCTTATAAAAAGGAGAAATTTGG + Intronic
993150559 5:84156207-84156229 CTTTATATGAAGGAGGAATAGGG + Intronic
993571241 5:89541659-89541681 ATTTACATAGAGGGGGAATTTGG - Intergenic
993695696 5:91059076-91059098 CTGTATACATAGGAGGATTTGGG + Intronic
994049276 5:95344237-95344259 CTTAATAAAAAGGGGGAATTTGG - Intergenic
994178698 5:96740496-96740518 CCTTATAAAAAGGGGAAATTTGG - Intronic
994210580 5:97084025-97084047 CTTTACAAAAATGAGGAATTTGG - Intergenic
994287580 5:97988574-97988596 CTTTGTAAAAAGGAGGAAATTGG + Intergenic
994671398 5:102765823-102765845 CCTTATAAAAAGGGGAAACTTGG - Intronic
994992694 5:107017256-107017278 CCTTATAAAAAGGGGACATTTGG + Intergenic
995212900 5:109560799-109560821 CTTCATCAAAAGGGGAAATTTGG - Intergenic
996029713 5:118691722-118691744 TTTTATACAAACGAGGAAATGGG - Intergenic
996371497 5:122757907-122757929 CCTTATAAAAAGGGAAAATTTGG + Intergenic
996655066 5:125925659-125925681 TATTATGCAAAGGGAGAATTGGG + Intergenic
997045606 5:130313179-130313201 CTTCATAGGAAGTGGGAATTTGG - Intergenic
997365952 5:133325316-133325338 CTTTATACACAGGCAGAATGTGG + Intronic
997853042 5:137349796-137349818 CCTTATGAAAAGGGGAAATTTGG - Intronic
998223403 5:140306590-140306612 CTTTATAAAAAGGGGAACTTTGG + Intergenic
998274876 5:140742946-140742968 CTTTATACAAACTGGGGATTGGG - Intergenic
998326182 5:141281888-141281910 CCTTATAAAAAGGGACAATTTGG - Intergenic
998360409 5:141581123-141581145 CCTTATAAAAAGAGGAAATTTGG + Intronic
998465718 5:142342271-142342293 TTTTATACCAACGGGGAAATGGG + Intergenic
998534742 5:142919199-142919221 CCTTGTAAAAAGGGGAAATTTGG + Intronic
998717709 5:144905141-144905163 CTTTATGCAAAGTGGGAATCAGG + Intergenic
998726070 5:145016240-145016262 CCTTATAAAAAGGGGAAATTTGG - Intergenic
998868280 5:146527757-146527779 TCTTATAAAAAGGGGAAATTTGG - Intergenic
999200884 5:149815322-149815344 CCTTATCAAAAGGGGCAATTGGG + Intronic
999273608 5:150313585-150313607 TCTTATAAAAAGGGGAAATTTGG + Intronic
999308411 5:150535624-150535646 CATTCTACAAAGGGGGGATAAGG + Intronic
999346007 5:150820220-150820242 CTGGATACAATGGGGGTATTGGG + Intergenic
999592917 5:153168402-153168424 CTTTACAGAAAGAGGAAATTTGG - Intergenic
999849010 5:155517255-155517277 CCTTATAAAAAGGGGAAATCTGG - Intergenic
1000282513 5:159794300-159794322 CATTATAAAAAGAGGAAATTTGG + Intergenic
1000399317 5:160809054-160809076 CCTTGTAAAAATGGGGAATTTGG - Intronic
1001377816 5:171279463-171279485 CTTTATAAAAAGGTTGAGTTTGG - Intronic
1001926048 5:175637935-175637957 CCTTATAAAAAGGGGATATTTGG + Intergenic
1003143405 6:3490210-3490232 CCTTATAAAAAGGGGAAATTTGG + Intergenic
1003677857 6:8223305-8223327 CCTTATAAAAAGGAGAAATTTGG + Intergenic
1003825924 6:9951922-9951944 CCTTATAAAAAGTGGAAATTTGG + Intronic
1004147155 6:13078322-13078344 CTTTACAAAAAAGGGAAATTTGG - Intronic
1004326811 6:14682506-14682528 CCTTGTAAAAAGGGGAAATTAGG + Intergenic
1005165102 6:22910367-22910389 CCTTATACAAAGGGGAAATTTGG + Intergenic
1005427209 6:25715407-25715429 CCTTATAAAAAGAGGAAATTTGG - Intergenic
1005803153 6:29447173-29447195 TTTTATGCAAATGGGGAATTAGG - Intronic
1006336417 6:33423283-33423305 ATTTATACAAAGGGGAAAAGAGG - Intronic
1007509393 6:42363730-42363752 CCTTATAAAAAGGGGATATTTGG + Intronic
1008343330 6:50394138-50394160 ATTTATACAAAGAGAGCATTAGG + Intergenic
1008486117 6:52038079-52038101 CTTTATAAAAAGGGGAATTTGGG + Intronic
1008836762 6:55841724-55841746 CTTTATAAAAAGAGGACATTTGG - Intronic
1008962764 6:57282652-57282674 CTTTATGCAAAGAGGATATTAGG + Intergenic
1009410058 6:63356057-63356079 CCTTATAAAAAGGGGAAATTTGG - Intergenic
1009671680 6:66761447-66761469 CTTTATTAAAATTGGGAATTCGG - Intergenic
1009729025 6:67575124-67575146 CATTCTACAAGGAGGGAATTAGG - Intergenic
1010349553 6:74856622-74856644 CATTTTAAAAAGGAGGAATTTGG - Intergenic
1011071923 6:83394501-83394523 CTTTATACAAAGGGATGATGCGG + Intronic
1011157361 6:84348005-84348027 TTTCATATAAAGGTGGAATTTGG - Intergenic
1011724291 6:90193335-90193357 CCTTATAAAAAGGGAAAATTTGG + Intronic
1011788004 6:90867823-90867845 TTCTATAAAAAGGGGAAATTTGG + Intergenic
1011900713 6:92292370-92292392 CTATTTACAAAGGTGGGATTGGG - Intergenic
1012227288 6:96718644-96718666 CTTTATAAAATGGGGAAATTTGG - Intergenic
1012837923 6:104293894-104293916 CTTTATAAAAAGGAGAAATTTGG + Intergenic
1013140546 6:107329527-107329549 CCTTATAAAAAGGGGAAATTTGG - Intronic
1013447960 6:110250371-110250393 CCTTATAAAAAGAGGAAATTTGG - Intronic
1013635547 6:112026127-112026149 CCTTATAACAAGGAGGAATTTGG - Intergenic
1013943245 6:115691429-115691451 CCTTTTACAAAGGAGAAATTTGG + Intergenic
1013971756 6:116028680-116028702 ACTTATATAAAGGGGAAATTTGG - Intronic
1014002627 6:116382075-116382097 CTTTATAAAGAGTGGAAATTTGG - Intronic
1014615529 6:123593647-123593669 CCTTATGGAAAGGGGAAATTTGG - Intronic
1014628183 6:123755664-123755686 CCTTATACAAAGAGAAAATTTGG - Intergenic
1015093428 6:129386145-129386167 CTTAATTCAAAGGAGGATTTAGG - Intronic
1015130031 6:129798872-129798894 TCTTATAAAAAGGGAGAATTTGG + Intergenic
1015546037 6:134362380-134362402 CCTTATAAAAAGGGGAAATTGGG - Intergenic
1015678604 6:135779458-135779480 CCTTATAAAAAGAGGAAATTTGG - Intergenic
1015695110 6:135971171-135971193 CCTTATAAACAGGGGAAATTTGG + Intronic
1016113552 6:140256156-140256178 CTATATAAAAAGGTGAAATTTGG + Intergenic
1016231438 6:141810022-141810044 CCTTATAAAAAGGAGGAATTTGG + Intergenic
1016303535 6:142658090-142658112 CCTTATAAACAGGGGAAATTTGG - Intergenic
1016367587 6:143336458-143336480 TCTTATACAAAGGGGAAATTTGG - Intronic
1016368181 6:143341520-143341542 CTTTGTAAAAAGGGGGAATTAGG + Intergenic
1016397649 6:143642659-143642681 TCTTATAAAAAGAGGGAATTTGG + Intronic
1016799374 6:148153316-148153338 CATTATAAAAAGGGGAAATTTGG + Intergenic
1017350369 6:153433956-153433978 TTTTATAAAAGGGGGGAATTTGG - Intergenic
1017878523 6:158543669-158543691 CCTTATAAAAAGGGGAGATTTGG - Intronic
1017937081 6:159015214-159015236 CCTTATAAGAAGGGGAAATTTGG + Intergenic
1018035098 6:159874984-159875006 CTTTATAAGAAGAGGAAATTAGG + Intergenic
1018491029 6:164293562-164293584 CTTTATAAAAAGAGGAAATTTGG + Intergenic
1018997532 6:168721543-168721565 CCTTATAAAAAGGGGAAGTTTGG + Intergenic
1019826539 7:3289263-3289285 CCTTATAAAAAGAGGAAATTAGG - Intergenic
1020468986 7:8514040-8514062 CTTTATAAAAAGGAACAATTGGG - Intronic
1021621156 7:22552303-22552325 CTTCATATAAAGGGGAAATTTGG - Intronic
1021816132 7:24449276-24449298 CTTTACAAGAAGGGGAAATTTGG - Intergenic
1021905402 7:25328370-25328392 CCTTATAAAAGGGGGAAATTTGG + Intergenic
1021951721 7:25781334-25781356 CTTTATAAAATGGGCAAATTTGG + Intergenic
1021959141 7:25854875-25854897 ATTTAAAGAAAGGGGGAAATAGG + Intergenic
1021972603 7:25980516-25980538 CCTTATAAGAAGGGGAAATTTGG + Intergenic
1022876266 7:34533802-34533824 CAGAATACAAAGGGGGACTTTGG + Intergenic
1023380347 7:39600703-39600725 TTTTATTAAAAGGGGAAATTTGG + Intronic
1023483896 7:40664001-40664023 CCTTATAAAAAGGGAAAATTTGG + Intronic
1024214219 7:47232822-47232844 CCTTATAAAAAGGAGAAATTTGG + Intergenic
1024499218 7:50085130-50085152 CCTTATAAAAAGGGGAAATTTGG + Intronic
1024608298 7:51040768-51040790 CTTTATGCAAACAGGGAATATGG - Intronic
1025953273 7:66162899-66162921 CCTTATAAAAAGGGGAAATTTGG + Intergenic
1026004971 7:66593175-66593197 CTTTATAAAAAGAGGAAATTTGG - Intergenic
1026013063 7:66651995-66652017 CTTTATAAAAAGAGGAAATTTGG + Intronic
1026108903 7:67443052-67443074 CTTTATAAGAAGAGGAAATTTGG + Intergenic
1026866407 7:73826773-73826795 CATTGTACAAAGGAGGAAGTTGG + Intronic
1027771823 7:82416645-82416667 CCTTATAAAAAGGAAGAATTTGG - Intronic
1028124754 7:87100050-87100072 CCTTATAAAAAGGGGAAATTTGG - Intergenic
1028397885 7:90392470-90392492 CCTTATAAAAAGGGTAAATTTGG - Intronic
1028538343 7:91914517-91914539 CCTTATAAAAAGGGGAAATTTGG + Intergenic
1028749911 7:94371765-94371787 CTTTATAAAAAGAGGACATTTGG + Intergenic
1028882028 7:95891085-95891107 CCTTATAGGAAGGGGAAATTAGG + Intronic
1028921000 7:96309951-96309973 CCTTATACGAAGAGGAAATTAGG + Intronic
1029157042 7:98524760-98524782 CCTTATAAAAAGGGGAAATTTGG + Intergenic
1029519246 7:101049690-101049712 CCTTATAAGAAGGGGAAATTTGG - Intronic
1030221854 7:107106518-107106540 CTTTATGCAAAGGAGAAATTTGG - Intronic
1030346944 7:108444685-108444707 CCTTATAAAAAGAGGCAATTTGG - Intronic
1030589424 7:111463199-111463221 CTTTATAAACAGGGGAAATTGGG - Intronic
1031478354 7:122249273-122249295 CCTTTTAAAAAGAGGGAATTTGG + Intergenic
1032444496 7:131970267-131970289 CTTTATGAAAAGGAGAAATTTGG + Intergenic
1032512023 7:132480053-132480075 CTTTATAGATATGGGGACTTGGG - Intronic
1032527990 7:132594222-132594244 CTTTATAAAAAGGGGAAATTTGG + Intronic
1032753166 7:134863062-134863084 CCTTATGAAAAGGGGAAATTTGG - Intronic
1033003539 7:137534929-137534951 TTTTATATAAAGAGGGAATTTGG + Intronic
1033018474 7:137696896-137696918 CTTTATAAAAAGGGGAGATTTGG + Intronic
1033983615 7:147196032-147196054 CCTTATAAGAAGGGGAAATTAGG + Intronic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1034445001 7:151109535-151109557 CCTTATAAAAGGGGGGAATTTGG - Intronic
1034715355 7:153236509-153236531 TCTTATACAAAGGGGAAATCTGG - Intergenic
1034900640 7:154906112-154906134 CCTTATGAAAAGGGGGAATTGGG - Intergenic
1035067231 7:156115621-156115643 TCTTATACAAAGGGGAAATTTGG + Intergenic
1035778966 8:2212185-2212207 CCTTACACAAAGGGGAAATCTGG + Intergenic
1036435074 8:8725640-8725662 CCTTATGAAAAGGGGAAATTTGG + Intergenic
1036475902 8:9093041-9093063 CCTTATAAAAAGCGGAAATTTGG - Intronic
1036489814 8:9214500-9214522 CCTTATAAATAGGGGAAATTTGG + Intergenic
1036524406 8:9521420-9521442 CCTTATAAAAAGTGGAAATTTGG + Intergenic
1036732466 8:11277893-11277915 CCTTATACTAAGAGGAAATTTGG - Intergenic
1037200441 8:16246660-16246682 CTTTATACAAAGCGACAATTTGG + Intronic
1037215242 8:16443029-16443051 CTTTAAACAATGTGGGAATTAGG - Intronic
1037381062 8:18285696-18285718 TATTATAAAAAGGGGAAATTTGG - Intergenic
1037533780 8:19806193-19806215 CCTTTTTCAAAGGGGAAATTTGG - Intergenic
1037662361 8:20938928-20938950 ATTTATACACAGGAGGAATTGGG + Intergenic
1038199471 8:25398715-25398737 CCTTATAAAAAGGGGAAATTTGG - Intronic
1038368291 8:26960663-26960685 CTTTATAAGAAGAGGAAATTAGG + Intergenic
1038501975 8:28052477-28052499 CTTTAAAAAAAGGGGAAATTTGG + Intronic
1038527812 8:28291818-28291840 CTTGATAGAAAAGGGAAATTAGG - Intergenic
1039022923 8:33227345-33227367 TTTTATAAAAAGAGAGAATTGGG + Intergenic
1039071648 8:33654305-33654327 CTTTATGAAAAGGGAAAATTTGG + Intergenic
1039099347 8:33924202-33924224 CTTTATAAGAAGGAGGAAATTGG - Intergenic
1039564852 8:38544040-38544062 CCTTATAAAAAGAGGCAATTTGG + Intergenic
1039810977 8:41048067-41048089 CCTTATAAAAAGTGGAAATTTGG + Intergenic
1040715596 8:50248064-50248086 CTTTATAAATAGGGGAAATTTGG - Intronic
1040866895 8:52056527-52056549 TTTTATACAAAGAGGAGATTAGG + Intergenic
1040978085 8:53215970-53215992 CCTTATAAAAAGAGGGCATTAGG - Intergenic
1041436379 8:57846552-57846574 CCTTATAAAAAGGAGAAATTTGG - Intergenic
1041459986 8:58100664-58100686 CCTTATAAAAAGGGGCAATTTGG - Intronic
1041671384 8:60494924-60494946 GTTTGTACAAAAGGAGAATTTGG - Intergenic
1041954248 8:63539916-63539938 CTTTATAAGAAGAGGAAATTAGG + Intergenic
1042133733 8:65614885-65614907 CTGAATGCAAAGGGAGAATTGGG - Intronic
1042579941 8:70265767-70265789 CTTGGTACACAGGGTGAATTTGG - Intronic
1042737906 8:72009445-72009467 TCTTATAAAAAGGGGAAATTGGG + Intronic
1042749063 8:72138385-72138407 TCTTATAAAAAGGGGAAATTTGG - Intergenic
1042775774 8:72429325-72429347 CCTTATAAAAAGGGAAAATTTGG + Intergenic
1043515457 8:80990948-80990970 CTTTATAAAATGGGGAAACTTGG + Intronic
1043520438 8:81039350-81039372 ATTTATAAAATGGGGGGATTTGG + Intronic
1043831130 8:84990752-84990774 CCTTATAAAAAGTGGAAATTTGG - Intergenic
1043979384 8:86620462-86620484 CTTTATAAGAAGGGGATATTTGG - Intronic
1044110198 8:88263679-88263701 CCTTATATAAAGGAGAAATTTGG - Intronic
1044250365 8:89998914-89998936 CTTTTTCCAAAGGGGGTTTTGGG - Intronic
1044297861 8:90549190-90549212 CTTTATAAAAAGAGGAAATTTGG + Intergenic
1044706494 8:95013913-95013935 CCTTATACAATGGGGAAATCTGG + Intronic
1045469057 8:102494955-102494977 CCTTAGAAAAAGGGGAAATTTGG + Intergenic
1045548329 8:103148180-103148202 CCTTATGAAAAGGGGAAATTTGG + Intronic
1045873723 8:106954487-106954509 CTTTATATAAAGGGGAAATTTGG + Intergenic
1046839212 8:118838865-118838887 CCTTATGAAAAGGGAGAATTTGG - Intergenic
1046839395 8:118840605-118840627 CCTTATAAAAAGGAGGAATTTGG + Intergenic
1047153256 8:122288307-122288329 ATTTATTAAAAGGGGAAATTTGG + Intergenic
1047164408 8:122421175-122421197 CTTTAAATAAAGGGTGGATTGGG + Intergenic
1047172764 8:122510010-122510032 CCTTATAGAAAGGGGAAATTTGG + Intergenic
1047221763 8:122924348-122924370 CTTTATGAAAAGGGGAAACTCGG - Intronic
1047434646 8:124826053-124826075 CCATATAAAAAGGGGAAATTTGG - Intergenic
1047663329 8:127062401-127062423 TCTTATACAAAGGGGAAATTTGG - Intergenic
1048106607 8:131417917-131417939 TCTTATAAAAAGGGGAAATTTGG + Intergenic
1048847153 8:138612623-138612645 CCTTATAAAAAGGGGAACTTTGG + Intronic
1048933638 8:139337286-139337308 CTCTGTAAAATGGGGGAATTAGG - Intergenic
1049925855 9:406533-406555 CCTTAAACAAAGGGGGCATTTGG + Intronic
1050014466 9:1219405-1219427 CTATTTACAAAGGGGCAGTTAGG + Intergenic
1050022010 9:1294022-1294044 CCTAATAAAAAGGGGAAATTTGG + Intergenic
1050128311 9:2382697-2382719 CCTTATTAAAAGGGGAAATTTGG - Intergenic
1050185041 9:2964367-2964389 CTTTACAAAAAGTGGAAATTTGG + Intergenic
1050272385 9:3959848-3959870 CTTTATAGAAAGAGGAAATTTGG + Intronic
1050974469 9:11919688-11919710 CTTTGTAAAAAGGGAAAATTTGG + Intergenic
1051720281 9:20029706-20029728 CATTTTACAAAGGTGGAAATGGG + Intergenic
1052417958 9:28202104-28202126 TCTTATAAAAAGGGGAAATTTGG - Intronic
1054122788 9:61227260-61227282 CTCTTTAAAAAGTGGGAATTGGG - Intergenic
1054711208 9:68512614-68512636 CCTTATTAAAAGGGGAAATTTGG - Intronic
1054760551 9:69000638-69000660 CCTTATGCAAAGGGGAATTTTGG - Intronic
1054855077 9:69890793-69890815 CTTTATACAAATGTGGATTAAGG - Intronic
1054857678 9:69918601-69918623 CCTTATAACAAGGGGGAATTTGG - Intergenic
1054868690 9:70028735-70028757 CTTTTTACATCGGGGGAATTTGG + Intergenic
1054879490 9:70130060-70130082 CCTTATAAAAAGGAGAAATTTGG - Intronic
1055010703 9:71561792-71561814 CCTTATAAAAAGGGGAAATTTGG + Intergenic
1055054967 9:72015110-72015132 GCTTATAAAAAGGGGAAATTTGG - Intergenic
1055100454 9:72459509-72459531 CTTTATACATAGGGGCACTTGGG - Intergenic
1055847978 9:80590882-80590904 ATCTATAAAAAGTGGGAATTTGG - Intergenic
1055996539 9:82166380-82166402 CCTTATGAAAAGGGGAAATTTGG + Intergenic
1056085812 9:83148385-83148407 CCTTATACAAAGGGAAAATTTGG + Intergenic
1056197636 9:84243931-84243953 CATTTTACAAAGAGGGAACTGGG - Intergenic
1056832075 9:89925183-89925205 CCTTATGTAAAGGGGAAATTTGG - Intergenic
1057306146 9:93913097-93913119 CCTTATAAAAAGGGGGAAATTGG + Intergenic
1058093984 9:100837926-100837948 CCTTATAAAAAGGAGAAATTTGG + Intergenic
1058411252 9:104735031-104735053 CTTTGTAAAAAAGGGCAATTAGG + Intergenic
1058585615 9:106503492-106503514 ATTTGTACAACGGAGGAATTTGG - Intergenic
1058813963 9:108666954-108666976 CTTTATAAAAAGGGGAAATTTGG + Intergenic
1058881749 9:109291418-109291440 CTTCAGACTAAGTGGGAATTGGG - Intronic
1058918259 9:109588187-109588209 CCTTATAAAAAGGGGATATTTGG + Intergenic
1058939255 9:109798166-109798188 CCTTATGAAAAGGGGAAATTTGG - Intronic
1060020794 9:120129398-120129420 CCTTATAAAATGGGGAAATTTGG - Intergenic
1061094678 9:128448789-128448811 CCTTACAAAAAGGGGAAATTTGG + Intergenic
1061551556 9:131337652-131337674 CCTTATAAAAAGGGGAAATGTGG + Intergenic
1061915854 9:133753464-133753486 CCTTGTAGAAAGGGGGAACTTGG - Intergenic
1062275634 9:135729079-135729101 CTTTATACAAAGGAGGAATGGGG + Intronic
1062492066 9:136810055-136810077 CTTTATACATAGCTGGCATTCGG + Intronic
1185673193 X:1827488-1827510 CCTTATGAAAAGGGGGAAATGGG + Intergenic
1185787337 X:2901980-2902002 CTTTATGAAAAGAGGAAATTTGG + Intergenic
1186113309 X:6278257-6278279 CCTTATAAAAAGGGGAAGTTTGG - Intergenic
1186363651 X:8869394-8869416 CCTGATACAAAGTGAGAATTTGG + Intergenic
1186442627 X:9599242-9599264 CCTTATAAAAAGGGGAAATTTGG - Intronic
1186606818 X:11100871-11100893 ATTTATTCAAAGCTGGAATTTGG - Intergenic
1186694790 X:12018716-12018738 CTTTATAACAAGGGGAAATCTGG - Intergenic
1188063300 X:25627368-25627390 CCTTATAAAAAGGGGAAATTTGG + Intergenic
1188206405 X:27364338-27364360 CCTTATAAAAAGGGGAAATTTGG - Intergenic
1189288470 X:39868517-39868539 CTTTATAAGAAGAGGAAATTAGG - Intergenic
1189312518 X:40029806-40029828 CCTTATAAAGAGGGGGAATTTGG + Intergenic
1189559547 X:42177969-42177991 CCTTATAAAAAGGAGAAATTTGG - Intergenic
1189651111 X:43190220-43190242 CTTTATAAAAAGGGGAAATTTGG + Intergenic
1189801026 X:44692038-44692060 CCTTATAAAAAGGGAAAATTTGG - Intergenic
1189961569 X:46329452-46329474 CCTTATAAAAAGGGGAAATTTGG + Intergenic
1190146405 X:47895276-47895298 CCTTATAAAAAGGGGAAATTTGG + Intronic
1190251981 X:48733749-48733771 CTTTATAAAAAGCGGAAATTTGG + Intergenic
1191077717 X:56473093-56473115 CCTTATAAAAATGGGAAATTTGG - Intergenic
1191776711 X:64822352-64822374 CCTTATTCAAAGAGGAAATTTGG + Intergenic
1193473013 X:81929341-81929363 CTTTATAAAAAGCAGAAATTTGG - Intergenic
1195196613 X:102503230-102503252 CTTCATAAAAAGGGGAAATGTGG + Intergenic
1195209553 X:102640064-102640086 CCTTATAAAAAGGGGAAATTTGG + Intergenic
1195425784 X:104728606-104728628 CCTTATAAAAAGGGGAACTTTGG + Intronic
1196372908 X:114998825-114998847 CTTTGTCCCAAGGGGGACTTTGG - Intergenic
1197530278 X:127615602-127615624 CTTTAAACAAAATTGGAATTGGG + Intergenic
1197701292 X:129602010-129602032 CCTTATAAAAAAGGGAAATTTGG + Intergenic
1197822679 X:130557102-130557124 ACTTATAAAAAGGGGAAATTTGG + Intergenic
1197878091 X:131132981-131133003 CCTTATCAAAAGGGGAAATTTGG + Intergenic
1198041211 X:132854079-132854101 CTTTTTCCAAATGGGGAATATGG - Intronic
1198316910 X:135477264-135477286 CCTTATAAAAAGGGGAAATTTGG - Intergenic
1198436770 X:136624766-136624788 CCTTATAAAAAGGGGAAATTGGG + Intergenic
1198483221 X:137060152-137060174 CCTTATAAAAAGGGGAAATTTGG - Intergenic
1198487245 X:137099944-137099966 CCTTATAAAAAGGGGAAATTTGG + Intergenic
1198685831 X:139227116-139227138 CTTTTTAAAAAGGGGAAATTTGG + Intergenic
1198710068 X:139491785-139491807 CTTTATAAAAAGGGGAAATTTGG - Intergenic
1198865203 X:141115050-141115072 TTTAATAAAAAGGGGAAATTTGG + Intergenic
1198934488 X:141891955-141891977 CATTTTAAAAAGGGGAAATTTGG + Intronic
1198960531 X:142177668-142177690 CATCATACAAAGGGAAAATTTGG - Intergenic
1199079034 X:143555999-143556021 CTTTATAAAAAAAGGAAATTTGG - Intergenic
1199412137 X:147536372-147536394 CCTTATAAAAAGAGGGAATTTGG + Intergenic
1199453055 X:147995037-147995059 CCTTATAAAAAGGGGAAACTTGG + Intronic
1199506728 X:148570908-148570930 CCTTATAAAAAGGGGACATTTGG - Intronic
1199685369 X:150260642-150260664 CCTTATAGAAAGAGGAAATTCGG - Intergenic
1199694251 X:150332246-150332268 CCTCATATAAAGGGGAAATTTGG + Intergenic
1199706138 X:150427106-150427128 CTGTATAAAAAGGGGAAATTTGG - Intronic
1199815647 X:151394690-151394712 CCTTATAAAAAGGGAAAATTTGG + Intergenic
1201223820 Y:11797092-11797114 CCTTATAAAAAGGGAAAATTCGG - Intergenic
1201483642 Y:14468806-14468828 CCTTATAAAAAGGGGGAGTTTGG + Intergenic
1201612831 Y:15862034-15862056 CTTCATATAAATGGAGAATTGGG + Intergenic
1202081072 Y:21084864-21084886 CCTTATCCAAAGGGGGCATTGGG + Intergenic