ID: 1179334627

View in Genome Browser
Species Human (GRCh38)
Location 21:40439057-40439079
Sequence ACAGCTAATGGGTGGTAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179334627_1179334633 10 Left 1179334627 21:40439057-40439079 CCTGTTTACCACCCATTAGCTGT 0: 1
1: 0
2: 1
3: 9
4: 113
Right 1179334633 21:40439090-40439112 GCAAATTGCTGAACCTCTCTGGG 0: 1
1: 6
2: 42
3: 303
4: 1015
1179334627_1179334632 9 Left 1179334627 21:40439057-40439079 CCTGTTTACCACCCATTAGCTGT 0: 1
1: 0
2: 1
3: 9
4: 113
Right 1179334632 21:40439089-40439111 GGCAAATTGCTGAACCTCTCTGG 0: 1
1: 6
2: 49
3: 300
4: 922

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179334627 Original CRISPR ACAGCTAATGGGTGGTAAAC AGG (reversed) Intronic
900850614 1:5139729-5139751 ACAGCCAATGGGTGTCAGACTGG - Intergenic
902636933 1:17740822-17740844 ACAGGTAGTGGGAGGGAAACAGG - Intergenic
903517361 1:23920471-23920493 ACAGCTATTCAGTGGCAAACTGG - Intergenic
905016915 1:34784017-34784039 ACAGCTGCTGGGTGGTGAAGAGG - Intronic
907497020 1:54851992-54852014 ACAGCTAATGAGTTCTAAACGGG + Exonic
907614069 1:55905963-55905985 ACAGCTAATAAGTGGTGGACAGG - Intergenic
908502137 1:64754222-64754244 TCAGCTAATTGGTGGTAGAGTGG + Intronic
909045530 1:70705060-70705082 ATAGCCAATCGGTGGCAAACGGG + Intergenic
909087382 1:71183719-71183741 ACTGCTAATGAGTAGTAAATTGG + Intergenic
909147215 1:71951095-71951117 ACAGCTAATAGATTTTAAACTGG + Intronic
909208008 1:72785014-72785036 ACAGCTAAAGAATTGTAAACTGG + Intergenic
911272657 1:95822164-95822186 ACAGCTAATGCAAGGTTAACAGG - Intergenic
911378235 1:97078204-97078226 ACAGCAAAAGAGTGGTAACCAGG + Exonic
916486990 1:165268648-165268670 ACAGCTAATAAGTGGTAGAGTGG - Intronic
919408990 1:197220596-197220618 ACAGCTAATGTTTGGCAAAGTGG + Intergenic
922584045 1:226720413-226720435 ACAGCTGATGGGTGGCAGAGAGG + Intronic
923223132 1:231914424-231914446 ATATCTATTGGGTGGTTAACTGG + Intronic
923891151 1:238216184-238216206 ACAGCTAGTGTGGTGTAAACAGG + Intergenic
923927405 1:238648357-238648379 ACACCTAATTGGTGTTAAATAGG + Intergenic
1063901585 10:10738238-10738260 ACATCTAAAGGGTTTTAAACTGG - Intergenic
1065494473 10:26314671-26314693 CCAGCTAATGGGTGATTATCTGG - Intergenic
1066057264 10:31693821-31693843 ACAGCTAATGTGTGGTGTGCTGG - Intergenic
1069313540 10:67069132-67069154 AGAGGAAATGGGAGGTAAACTGG + Intronic
1071039536 10:81289678-81289700 ACAGCTAAAGCGTGTTAAAAGGG + Intergenic
1073838780 10:107474547-107474569 ACAGCTTGTAAGTGGTAAACTGG - Intergenic
1085760905 11:79240552-79240574 ACAACTAATAAATGGTAAACTGG + Intronic
1088080539 11:105906650-105906672 CCAGCTAATACGTGGTAAGCTGG + Intronic
1089584157 11:119499282-119499304 TCAGATACTGGGTGGTAAAATGG - Intergenic
1090425770 11:126606022-126606044 AGAGATAATGAGTGGTCAACTGG - Intronic
1096399520 12:51293871-51293893 ACTGCTGATGGGTGGTAAACTGG + Intronic
1100082141 12:90865642-90865664 ACAGCTAATTGATGGTAGACAGG + Intergenic
1102027273 12:109720603-109720625 ATAGCCAATGGGCAGTAAACAGG + Intronic
1110490772 13:76103299-76103321 CCATCTAATGGGTGTAAAACAGG - Intergenic
1111642612 13:90988840-90988862 AAAGCAAATGAGTGGTTAACAGG + Intergenic
1116053810 14:39838663-39838685 ACAGCTGGTAGGTGGAAAACTGG + Intergenic
1117731971 14:58732072-58732094 ACAGCTAATAGTTTGTAGACTGG + Intergenic
1117889824 14:60407629-60407651 ATAGCTAATGGAGGGTTAACAGG - Intronic
1122257878 14:100492382-100492404 GCAGCTCATGGGTTTTAAACAGG - Intronic
1122355388 14:101120069-101120091 ACAGCTGGTGGGTGGAAGACAGG + Intergenic
1127694024 15:61426419-61426441 ACAGCTGATGCCTGGTAAAAAGG + Intergenic
1131105284 15:89729638-89729660 ACAGAAAATGGGTGTTACACAGG - Intronic
1135006498 16:18828278-18828300 GCAGCCAATGGGAGGTAAGCAGG + Intronic
1137927542 16:52555020-52555042 GCAGCTGATGGGTGGTGGACTGG - Intergenic
1140047508 16:71451911-71451933 ACAGCAAATGAGTCTTAAACAGG + Intronic
1141014318 16:80434128-80434150 GCAGCTAAAGGCTGGTATACAGG - Intergenic
1141108814 16:81255292-81255314 ACAGCTAGCGAGTGGTAATCTGG - Intronic
1145924389 17:28634841-28634863 ACAGCTACTGGATGCTAAAGTGG - Exonic
1146702485 17:34973435-34973457 ACAGCTAATTGGTGGCAAAGTGG - Intronic
1148937371 17:51174393-51174415 ACAGCTATCGGGTTGGAAACTGG - Intergenic
1150891213 17:69152417-69152439 ACATGTAATGGGTGGTCAAGAGG + Exonic
1151788201 17:76286904-76286926 AGATCGAATGGGAGGTAAACAGG + Intronic
1153693932 18:7621213-7621235 ATAGCTAATAATTGGTAAACTGG + Intronic
1159875771 18:73809273-73809295 ACAGCTAATGGGTGCAGAACAGG + Intergenic
1164043978 19:21518363-21518385 ACAGCTAATGTGAGGTTAAAAGG - Intronic
1166764032 19:45241952-45241974 TCAGGGAATGGGTGCTAAACAGG + Intronic
925870760 2:8268235-8268257 ATAGCTAATCAGTAGTAAACTGG + Intergenic
926114410 2:10203318-10203340 ACAGCTAGTGGGTGGCAGTCGGG - Intronic
926213927 2:10891956-10891978 ACAGCAAATGAGAGGAAAACTGG + Intergenic
932205605 2:69878765-69878787 ACAGCTAATGGGTGGGAGTTTGG + Intronic
933322917 2:80799444-80799466 ACAGCTAAGGGCTGGAGAACTGG + Intergenic
933588973 2:84210632-84210654 TCAGCTAATGAGTGGCAAGCTGG - Intergenic
933783552 2:85819404-85819426 ACAGTTAATGAGTGGTAGACAGG - Intergenic
937495213 2:122411961-122411983 ACAGCTTATAGGTGGTAACTGGG - Intergenic
938823463 2:134981470-134981492 ACAGCTAATAGCTGTAAAACAGG - Exonic
943662192 2:190571051-190571073 ACAGCTAATGGATGGAAGCCAGG - Intergenic
948626039 2:239268648-239268670 ACAGGAAATGGGTGGTCACCTGG - Intronic
1173378782 20:42516355-42516377 ACAGCTAATATGTGGTAAAAGGG - Intronic
1176991882 21:15507011-15507033 CAAGCTAATGGGTGATAAAAAGG + Intergenic
1179334627 21:40439057-40439079 ACAGCTAATGGGTGGTAAACAGG - Intronic
951277426 3:20705540-20705562 ACAGCTAATAACTTGTAAACAGG - Intergenic
953001786 3:38940910-38940932 ACAGATAATGAGTATTAAACTGG + Intronic
953002233 3:38946440-38946462 ACACCTAAAGAGTTGTAAACTGG - Intronic
955634034 3:61006013-61006035 ACAGCTCTTGGGTGGTAAGTAGG + Intronic
957388448 3:79529612-79529634 ACAGCTAATAAGTGACAAACAGG + Intronic
963158142 3:142121417-142121439 TCAGCTAAAGGGTGGGAATCAGG + Intronic
964638883 3:158886923-158886945 CCAGCCAGTGTGTGGTAAACTGG - Intergenic
964991504 3:162818563-162818585 AAAAGTAATGGGTGGTAAATAGG + Intergenic
966821710 3:183929991-183930013 ACAGGTATTTGGTGGAAAACTGG + Intronic
968415202 4:426190-426212 ACATGTAATGGGTGGTCAAGAGG + Intronic
968529737 4:1085073-1085095 ACAGCCAATGGGAGGCAGACAGG + Intronic
969100895 4:4767564-4767586 ACAGCTGATGAGTGGTTTACAGG + Intergenic
971149805 4:24020165-24020187 TCAGCTTTTGGGTGGTAGACTGG - Intergenic
971377518 4:26067079-26067101 ACAGGTAATAGGTGGTAACAGGG + Intergenic
975492547 4:75004594-75004616 ACTGCTCATGAGGGGTAAACTGG + Intronic
975912870 4:79289622-79289644 ACAGCTAGTTGGTGGGAAGCTGG + Intronic
977089162 4:92649243-92649265 ATAGCTTATAGATGGTAAACTGG - Intronic
979818790 4:125144534-125144556 AAAGCTAATCTGTGGGAAACAGG + Intergenic
981665011 4:147214491-147214513 ACAGCTAAGGCGTGGTAAGAGGG - Intergenic
987336687 5:16903492-16903514 AGAGCTAACAGGTGGTAAACGGG + Intronic
991718256 5:69472269-69472291 ACAGATAATGGGTGGTTATTTGG + Intergenic
998923781 5:147100162-147100184 ACAGCTAGTGGCTGGTAGTCTGG + Intergenic
999575823 5:152975338-152975360 ACAGCTAGTGAGTGGCAAATTGG - Intergenic
1002758996 6:187313-187335 GCAACTAATGGGGGGTAAGCGGG - Intergenic
1004053791 6:12113915-12113937 ACAAATAATGTGTGATAAACAGG - Intronic
1005997768 6:30941860-30941882 ACAGCTAGAGGGAGGTAAGCAGG + Intronic
1008806453 6:55434982-55435004 ACAGGTAAAGTGTGGTAAACTGG + Exonic
1010025179 6:71206845-71206867 ACAGCTAGTTGGTGAAAAACTGG + Intergenic
1015870216 6:137768760-137768782 ACAGCTAATACGTGGTGAATAGG + Intergenic
1016485054 6:144528586-144528608 ACAGCTACTGGGTGCTGAGCGGG + Intronic
1019503265 7:1376243-1376265 ACAGCTGATGGGCCGTAAGCTGG + Intergenic
1020143763 7:5627186-5627208 ACGGCTAGTTGGCGGTAAACTGG + Intronic
1021008341 7:15429013-15429035 GCAGTTAATGGGGGGAAAACAGG - Intronic
1021436124 7:20618179-20618201 ACAGCTAATGAGAGGGATACAGG - Intronic
1023189403 7:37563504-37563526 GCACCTAGTGGGTGGTCAACAGG - Intergenic
1027551962 7:79609498-79609520 ACAGGCAAGGGGAGGTAAACAGG + Intergenic
1030694355 7:112568701-112568723 ACAGCTAATGCCTGGCAAATGGG - Intergenic
1032083552 7:128872188-128872210 CCAGCTGAAGGGTGGCAAACAGG + Intronic
1033100432 7:138465423-138465445 TCAGCTAATGAGTAGCAAACTGG + Intronic
1033168233 7:139059976-139059998 ACAGCTAATGGGTGGCAAGGTGG + Intronic
1036163353 8:6408671-6408693 CCAGCTACTGGGTGGGAAATGGG - Intronic
1041688151 8:60663320-60663342 ACTGCTCCTGGCTGGTAAACAGG - Intergenic
1043822088 8:84879228-84879250 ATAGCTACTGGGTGGGAAAGAGG + Intronic
1047392854 8:124467766-124467788 ACAGCTAAATCTTGGTAAACAGG + Intergenic
1048048843 8:130798187-130798209 GTGGCTATTGGGTGGTAAACAGG + Intronic
1048477746 8:134758381-134758403 ACAGCTAGTAGGAGGTAAAGTGG - Intergenic
1050588426 9:7137734-7137756 AAAGATAATGGCTTGTAAACAGG - Intergenic
1051068240 9:13130898-13130920 ACAGGTAATGGATGGGAAATGGG + Intronic
1052512554 9:29440234-29440256 TCAGCTTGTGGGTGGGAAACAGG - Intergenic
1052916910 9:33930213-33930235 ACCGCCAGTGGGAGGTAAACAGG + Intronic
1053510639 9:38685206-38685228 ACAGCTAATGTGAGGACAACTGG - Intergenic
1058184084 9:101833505-101833527 ATAGCTATTGGGTGGAGAACGGG - Intergenic
1061673132 9:132200543-132200565 ACAGCACATGGCTGGCAAACGGG - Intronic
1061974485 9:134061466-134061488 CCAGCTAAAGGGTGGGAGACAGG + Intronic
1192702367 X:73488636-73488658 ACAGCTAATGGATGCTAGGCTGG - Intergenic