ID: 1179335378

View in Genome Browser
Species Human (GRCh38)
Location 21:40446844-40446866
Sequence AACAGGACTTTGAAAGTCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 247}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179335378_1179335383 -3 Left 1179335378 21:40446844-40446866 CCTATGACTTTCAAAGTCCTGTT 0: 1
1: 0
2: 4
3: 22
4: 247
Right 1179335383 21:40446864-40446886 GTTGGGGAAATACTAATGACAGG 0: 1
1: 0
2: 0
3: 7
4: 121
1179335378_1179335384 -2 Left 1179335378 21:40446844-40446866 CCTATGACTTTCAAAGTCCTGTT 0: 1
1: 0
2: 4
3: 22
4: 247
Right 1179335384 21:40446865-40446887 TTGGGGAAATACTAATGACAGGG 0: 1
1: 0
2: 0
3: 13
4: 192
1179335378_1179335389 28 Left 1179335378 21:40446844-40446866 CCTATGACTTTCAAAGTCCTGTT 0: 1
1: 0
2: 4
3: 22
4: 247
Right 1179335389 21:40446895-40446917 CAAATGCAGCAAAGATGACAAGG 0: 1
1: 0
2: 1
3: 36
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179335378 Original CRISPR AACAGGACTTTGAAAGTCAT AGG (reversed) Intronic
904394171 1:30206957-30206979 AAATAGATTTTGAAAGTCATGGG - Intergenic
908032128 1:60012515-60012537 AATAGCACTTTGAAGGTCTTGGG - Intronic
908116396 1:60944541-60944563 AACAAAACTTTGAAAATCAAAGG + Intronic
909696984 1:78478911-78478933 AACACTACTTTAAAATTCATAGG - Intronic
910484289 1:87695346-87695368 AACATGGGTTTGAAAGGCATGGG + Intergenic
911182435 1:94873154-94873176 AAAAGGGCTGTGAAAGGCATTGG - Intronic
911518044 1:98892613-98892635 AAGTGGACTTTGAAAGTCATGGG - Exonic
914424872 1:147566443-147566465 AAGGAGACTATGAAAGTCATGGG + Intronic
915727543 1:158028539-158028561 ACCAGGCCTTTGCAAGGCATAGG + Intronic
916010940 1:160705153-160705175 AACAGGAACTTGAAAGCCCTGGG - Intronic
916680023 1:167095217-167095239 AACTGGACTTGGAAGGTCATAGG + Intronic
917776848 1:178346639-178346661 AACAGCACTTGGAAAATGATTGG + Intronic
921205367 1:212844274-212844296 AAATGGATTTTGAAAGTTATGGG - Intronic
923135669 1:231116356-231116378 TCCAGGACTTTGAAAGTCCAAGG + Intergenic
923514338 1:234681874-234681896 AACAGGAGTTTCAAAGTTAGGGG + Intergenic
923771667 1:236942904-236942926 AACAGGAGTATGAGAGTCAAGGG + Intergenic
924020092 1:239771799-239771821 AACAGGGCTTTGAAACCTATGGG - Intronic
1063016824 10:2086630-2086652 AACAGAACTCTGGAAGTCACAGG + Intergenic
1063271564 10:4515020-4515042 AACATGACATGGAAATTCATGGG + Intergenic
1065035784 10:21637489-21637511 AGCAGGTCTTTGAAATTTATTGG + Intronic
1067713195 10:48666642-48666664 AAAAGGACTTTGAAAAGCAGGGG - Intergenic
1068009227 10:51427060-51427082 AACAATATTTTGAAATTCATAGG - Intronic
1068976832 10:63019471-63019493 AACAGTACTTTGAAAACCACTGG - Intergenic
1069028594 10:63571205-63571227 AAAAGTACTTTGAAACTCGTAGG - Intronic
1069642918 10:69967948-69967970 AACAACATTTTAAAAGTCATAGG - Intergenic
1069803621 10:71102173-71102195 AACAACACTTTGAAAGACATTGG + Intergenic
1069803667 10:71102727-71102749 AACAACACTTTGAAAGACATTGG - Intergenic
1071725527 10:88194626-88194648 AACAAGACTTTGAACATCACTGG - Intergenic
1072350140 10:94549389-94549411 AAAATGACTTTGACATTCATTGG + Intronic
1073706302 10:105988378-105988400 AGAAAGACTTTGACAGTCATGGG + Intergenic
1073911801 10:108354109-108354131 AACAGTAATTTGAAAGTGACCGG + Intergenic
1076205638 10:128599097-128599119 AACAGCACTTTGACAGGCACTGG - Intergenic
1076254309 10:129008985-129009007 AACAAGACTTTGAAGGTGGTTGG - Intergenic
1076579635 10:131498541-131498563 TACAGGACTTGGAAATTGATTGG + Intergenic
1078486125 11:11725082-11725104 GTCAGGACTCTGAAAGGCATAGG - Intergenic
1079664100 11:23082394-23082416 ACCAGCACTTTGAGAGGCATAGG + Intergenic
1080293953 11:30703854-30703876 AACAGGAAATTGAAAGTGAAAGG + Intergenic
1080514240 11:33005298-33005320 AAAAGGCCTTTGAAAGTCACAGG + Intergenic
1082909774 11:58357708-58357730 AAGATGTCTTTGATAGTCATAGG + Intergenic
1085556047 11:77422580-77422602 ATTAGGGATTTGAAAGTCATTGG - Intronic
1086942025 11:92808400-92808422 AACAGGACACTGCAAGTTATAGG + Intronic
1087444439 11:98230964-98230986 AACAGGAAGTTGAAAATCAGAGG + Intergenic
1090681905 11:129068701-129068723 AACAGGATTTTGGTAGTAATAGG - Intronic
1091384903 12:87359-87381 AACACTTCTCTGAAAGTCATGGG + Intronic
1093693030 12:22128605-22128627 AACAGGACTCTGGAAGTGACAGG + Intronic
1094338878 12:29388933-29388955 AGGATGAATTTGAAAGTCATTGG - Intergenic
1094456239 12:30637365-30637387 AATAGGTCTTTGAAAATAATTGG - Intronic
1094475017 12:30834087-30834109 ACTGGGACTTTGAGAGTCATAGG + Intergenic
1094750584 12:33402204-33402226 AAGAGGACATTTAATGTCATAGG - Intronic
1095302215 12:40598082-40598104 TAGAGGACTTTGAAGGCCATGGG + Intergenic
1095821104 12:46479265-46479287 GACAGGACTTTGCAATTGATAGG - Intergenic
1096446093 12:51693435-51693457 AACAGTAATTTGAAAGAGATTGG - Intronic
1096778676 12:53979359-53979381 CACAGGTCTTTGAAAGGCAGGGG + Intergenic
1097383894 12:58926358-58926380 AACAGCAATTTGGAAGTAATAGG - Intergenic
1100078226 12:90814380-90814402 AACAGGAGTTTGCACTTCATGGG + Intergenic
1101357627 12:103995315-103995337 AACAGGAGTTGGAAAGGTATTGG - Intronic
1104530604 12:129566927-129566949 AGCAGGAGTTTCCAAGTCATAGG - Intronic
1106446865 13:29841969-29841991 AAGGGGATTTGGAAAGTCATTGG - Intronic
1106636181 13:31530542-31530564 AACTGTACTTAAAAAGTCATAGG - Intergenic
1106954241 13:34918155-34918177 AAGAGGACTCTGAAACACATGGG + Intergenic
1107812786 13:44216209-44216231 AACAGGACTTAGTAACTGATGGG + Intergenic
1108036850 13:46299066-46299088 GACAGGACTTTGTAAGTTATTGG - Intergenic
1108244230 13:48498778-48498800 CTCTGGACTTTGAAAGTCAAAGG - Intronic
1108961995 13:56246117-56246139 AAGAGGACTTAGAAAGAGATGGG - Intergenic
1110299130 13:73905258-73905280 AACAATAATTTGAAAGTTATAGG - Intronic
1111152878 13:84281454-84281476 AACAAAAGTTTGAAAGTCACTGG - Intergenic
1112640373 13:101267379-101267401 AAGAGGAATTTGAAAATCACTGG - Intronic
1115135584 14:30103669-30103691 AACAGGAATTTGAACTGCATGGG + Intronic
1115832868 14:37361855-37361877 AACAGCACTTTGAAAGGCCAAGG - Intronic
1118488524 14:66236357-66236379 AACAGGCCATTGAGAATCATTGG + Intergenic
1119577659 14:75741852-75741874 GACAAGTCTTTGAAAGTGATTGG + Intronic
1119900275 14:78253716-78253738 AAGGGGACTTCAAAAGTCATTGG + Intronic
1121190177 14:92020761-92020783 AAAATCACTTAGAAAGTCATTGG + Intronic
1121583330 14:95046490-95046512 AACAGGATTTTAAAAGGCAAGGG + Intergenic
1121790532 14:96696357-96696379 AAGAGGGCTTTGAGAGTCAGAGG - Intergenic
1123168089 14:106345690-106345712 AACTGGGTTTTGAAAGTAATGGG - Intergenic
1125292796 15:38168125-38168147 GAGAGGACTTGGAAACTCATTGG - Intergenic
1126503279 15:49372502-49372524 AACAGGACTCTGACAGGCAGAGG - Intronic
1126555841 15:49986687-49986709 AACAGGACTTTTAAAATCAAGGG + Intronic
1126875435 15:53035921-53035943 AACATGGTTTTGAAAGCCATTGG - Intergenic
1127408538 15:58680488-58680510 AACAGTACTTTTAAAGATATTGG + Intronic
1128074653 15:64818612-64818634 CACAGGGCTTTGAAAATGATTGG + Intronic
1128271100 15:66310705-66310727 AACAGGACTCTGAAATTAGTGGG + Intronic
1129952722 15:79606351-79606373 AACTGGGTTTTGAAAGTCTTTGG + Intergenic
1130339249 15:82985492-82985514 GACAGGACTTGGCAAGTGATTGG + Intronic
1131035985 15:89222232-89222254 AACATGACTTCAAAACTCATCGG + Intergenic
1131228854 15:90646187-90646209 AACAGGACCTCGTAAGGCATAGG - Intergenic
1131881998 15:96871776-96871798 GCCAGCACTTTGAAAGCCATGGG + Intergenic
1132779653 16:1615384-1615406 AGCAGGCTTTTGAAACTCATTGG + Intronic
1133984436 16:10657513-10657535 AAAATCACTTTGGAAGTCATTGG - Intronic
1134403455 16:13933818-13933840 TTCAGGATTATGAAAGTCATGGG + Intronic
1134426393 16:14151441-14151463 AACATGACTTTGAACTTCATGGG - Intronic
1140929112 16:79610632-79610654 AACATGACTTTGAAAGGGACAGG + Intergenic
1144298837 17:13904270-13904292 AACAGGGCCTTGAAAGACAAAGG - Intergenic
1146631760 17:34475090-34475112 AAAAGCACTTTGTAAGTCACAGG + Intergenic
1148751712 17:49949067-49949089 AACAGTGCTTGGAAAGTCCTCGG + Intergenic
1148979144 17:51556401-51556423 AATAGGGCTTTGTAAGTCAGGGG + Intergenic
1149945893 17:60926502-60926524 AACAGGATTTTTATAGTGATTGG + Intronic
1150678915 17:67268607-67268629 GCCAGGACTATGAAGGTCATAGG - Intergenic
1151101255 17:71557751-71557773 TACGGGACTTTTTAAGTCATGGG + Intergenic
1151430627 17:74060129-74060151 CACAGGACTGTGGAAGTCACAGG - Intergenic
1152273511 17:79339966-79339988 TACAGGACTCTGAAAGACAGAGG - Intronic
1152982233 18:289514-289536 AAAAGGGCTTTGAAAGTAAGGGG + Intergenic
1153455534 18:5277939-5277961 ATCAAGACTATGAAAGACATGGG + Intergenic
1153919888 18:9779112-9779134 AACATGGGTTTGAATGTCATGGG - Intronic
1154470652 18:14697032-14697054 CTCAGGACTTTGAAAGGCAGAGG - Intergenic
1155051757 18:22154444-22154466 AGCATGACTTTGAAAGTCTTAGG + Intergenic
1155153777 18:23141985-23142007 AGCAGGACTTTGAGACTCCTGGG + Intronic
1155351368 18:24910658-24910680 AAGAGAACATTGAAAGTCAAGGG + Intergenic
1155870279 18:31019047-31019069 AAAAGGTTTTTGGAAGTCATAGG + Intronic
1156267147 18:35499044-35499066 CACAGTACCTTGCAAGTCATTGG + Intergenic
1158020423 18:52835355-52835377 AAAATGAGTTTGAAAGTCAAGGG - Intronic
1165135557 19:33666196-33666218 CACAGGACTGTGAAAGTCAGGGG + Intronic
1165220796 19:34315086-34315108 CACTGGACTTTTAAAGTGATCGG + Intronic
1165477073 19:36037061-36037083 AGCAGGGCTCTGAAAGCCATGGG + Intronic
1168099697 19:54134380-54134402 GACAGGACCTAGAAAGTCAGAGG - Intergenic
925786777 2:7438982-7439004 CTTAGGACTTTAAAAGTCATAGG - Intergenic
927286859 2:21366239-21366261 AACAAGACTATGAAATTCATGGG + Intergenic
927505205 2:23608646-23608668 CACAGCACTTAGAAAATCATCGG - Intronic
928141290 2:28731581-28731603 CACAGGTGTTTGAAAGTCACAGG + Intergenic
929213897 2:39390220-39390242 AACAGGACTTTAAAAATCATTGG - Intronic
931635907 2:64340690-64340712 AACAGGACTTGGACAGCAATGGG + Intergenic
931795694 2:65707576-65707598 AACAGAGCTTTGAAAGGCATAGG + Intergenic
931992333 2:67802918-67802940 AACAGAACTTTGAGAGGCATCGG - Intergenic
932390183 2:71382388-71382410 AACAGGACTGAGAAAGTGACAGG + Intronic
934552081 2:95268804-95268826 AACTGGACTTAGAAAGACAGTGG - Intergenic
935357030 2:102210855-102210877 GACATGACCTTCAAAGTCATTGG + Intronic
935824775 2:106934599-106934621 AACAGGACATTGAATATCAAGGG + Intergenic
936280654 2:111136755-111136777 AACCTGACCTTGAAAGTGATGGG - Intronic
937256079 2:120556784-120556806 AACAGGGCTTTGGAAGTCTCCGG - Intergenic
937393134 2:121510079-121510101 AGCAGTACTTAGAAATTCATAGG + Intronic
937578878 2:123459017-123459039 AACAGAACTTTGGAAATAATTGG - Intergenic
937892666 2:126950627-126950649 AACAGGGCTTTCAAAGGCAGGGG - Intergenic
938111538 2:128569892-128569914 AATAGGTATTTGAAATTCATAGG - Intergenic
938555559 2:132420294-132420316 AAAAGCTCTTTGAAATTCATTGG - Intronic
940673032 2:156694345-156694367 AACAGAACCTTGAAAATCAAAGG + Intergenic
941389352 2:164892072-164892094 AACAGGGCTTAGAAAATCCTAGG - Intergenic
943538626 2:189183670-189183692 AAGAGGACTTTGGGAGTAATAGG - Intergenic
943731040 2:191304221-191304243 AAGAAAACTTTGAAAGTCAAAGG - Intronic
943929409 2:193830726-193830748 AATAAGACTTTGAAAGCTATAGG - Intergenic
945613906 2:212043210-212043232 TTAAGGACTTTGAAAGTCACAGG - Intronic
946162535 2:217844570-217844592 AATAGGATTTTGAAAGTAAACGG - Intronic
948594444 2:239070569-239070591 AAGGAGACTTTGAAAGTCAGTGG - Intronic
1168932300 20:1634000-1634022 ACTAGGACTTGGGAAGTCATGGG - Intronic
1169894304 20:10486059-10486081 AACATGAGTTTGAAATGCATGGG - Intronic
1170446518 20:16433492-16433514 AATAAGATTTTGAAAGGCATTGG + Intronic
1170533624 20:17318707-17318729 AGCAGAACTTTGACATTCATAGG - Intronic
1171087189 20:22248573-22248595 AACAGGACATTTCAAGCCATAGG - Intergenic
1175152988 20:56949613-56949635 ACTAGGAGTTTGCAAGTCATAGG - Intergenic
1175680570 20:60985432-60985454 AAGAGGACTTTGGGAGTCAGTGG - Intergenic
1176803834 21:13460893-13460915 CTCAGGACTTTGAAAGGCAGAGG + Intergenic
1178273253 21:31212986-31213008 AACAGTTCTTTGAAACTAATGGG + Intronic
1179335378 21:40446844-40446866 AACAGGACTTTGAAAGTCATAGG - Intronic
1184315095 22:43681712-43681734 AATAGGATTTAGAAGGTCATGGG - Intronic
949091004 3:28970-28992 TACAGTACTTTCAAAGTAATTGG - Intergenic
953970730 3:47344914-47344936 CAGAGGACTTTTAAAATCATAGG + Exonic
954426584 3:50446588-50446610 ACCAGGGCTATGAAAGTCAGCGG + Intronic
954820679 3:53324158-53324180 AACATGCCTTTGAAAGTGTTTGG - Intronic
955925871 3:64004562-64004584 TCAAGGACTTTGAATGTCATGGG + Intergenic
955976456 3:64484975-64484997 AACAGGACTTTTAGATTGATAGG - Intergenic
956639789 3:71404903-71404925 AAAAGGAGGTTGAAAGCCATGGG - Intronic
957031332 3:75245177-75245199 TACAGTACTTTCAAAGTAATTGG - Intergenic
957944543 3:87046149-87046171 AACAGGACTTTGTAAAGCACAGG + Intergenic
958015341 3:87933847-87933869 TCCAGGTTTTTGAAAGTCATGGG + Intergenic
958107374 3:89093339-89093361 AAGAGGACTGTATAAGTCATAGG + Intergenic
958602097 3:96308146-96308168 AAGAGGACAGTGAATGTCATTGG + Intergenic
958748513 3:98166039-98166061 AACATCACTAGGAAAGTCATAGG + Intergenic
958752210 3:98204764-98204786 AACATCACTAGGAAAGTCATAGG + Intergenic
958753284 3:98219044-98219066 AACATCACTAGGAAAGTCATAGG + Intergenic
961723671 3:128911998-128912020 AACAGGACTGTGAGGGTCAGAGG - Intronic
962952661 3:140233606-140233628 AACAGGAATTTGATATTAATGGG + Intronic
963056159 3:141188086-141188108 AGCAGGACCTTGAGAGTCAGGGG + Intergenic
963200748 3:142583588-142583610 AACAGCCATATGAAAGTCATTGG - Intergenic
963210467 3:142683805-142683827 AATAGGGATTTGAAAGTCATTGG + Intronic
963339593 3:144018922-144018944 AGCAATAGTTTGAAAGTCATAGG - Intronic
963460021 3:145600200-145600222 TACAGGATGTTGGAAGTCATTGG - Intergenic
965268777 3:166585385-166585407 AACAGGAGTTATAAAGACATAGG - Intergenic
966024070 3:175253740-175253762 AACGGGAGTTTGAAAGAAATTGG + Intronic
966365491 3:179182415-179182437 CCCAGCACTTTGAAAGTCAGAGG + Intronic
967253368 3:187565567-187565589 AAGAGCAGTTTGAAAGCCATAGG - Intergenic
969241152 4:5898641-5898663 GATAGGACATTGAAAGTGATGGG - Intronic
970482000 4:16485529-16485551 AACAGAAGTTTGAAAGTCCCAGG - Intergenic
972526029 4:39912399-39912421 AACTGCACTTTCAAAGTTATGGG - Intronic
974124080 4:57674359-57674381 ATCAGGACTTTTCAGGTCATAGG + Intergenic
975823618 4:78296568-78296590 AAAAGCTCTTTGAAAGTGATTGG - Intronic
977612355 4:99049130-99049152 AAAGTGACTTTGAAAGCCATAGG - Intronic
978840992 4:113211706-113211728 TACAGGAATTTGAAATTCACAGG + Intronic
979024846 4:115556626-115556648 AAGTGAACTTTGAAAGTTATAGG - Intergenic
979141336 4:117179617-117179639 AACAGGACTTATTAATTCATCGG + Intergenic
980553216 4:134367582-134367604 AACAGCACTCTGAAAGCCAATGG + Intergenic
981320129 4:143381970-143381992 AACAGGATGTTGGAAGTCAGAGG + Intronic
981450120 4:144887144-144887166 AACTTGACTGTGAAATTCATAGG + Intergenic
981983740 4:150828867-150828889 AACACAAGGTTGAAAGTCATTGG + Intronic
983438595 4:167750529-167750551 AACAGAACTGTAAAAGTTATAGG - Intergenic
983441152 4:167786689-167786711 AAAAAGAGTTTGTAAGTCATTGG - Intergenic
985047990 4:185959939-185959961 AAGAGCATTTTTAAAGTCATAGG + Intergenic
985297602 4:188452249-188452271 AACAGGATTTGAAAAGTCAATGG - Intergenic
986528738 5:8711088-8711110 AATAGGACTTTGTAAATCACTGG - Intergenic
987151529 5:15045568-15045590 AAGAACACTTTGAAAGGCATTGG + Intergenic
988550931 5:32200416-32200438 AATAGGACTTAGAAAGACATGGG - Intergenic
989436269 5:41417139-41417161 AATAGCACTTTGTAAATCATAGG + Intronic
990790548 5:59473625-59473647 ATCTGGACATTGAAAATCATTGG - Intronic
993889776 5:93459777-93459799 CCCAGGATTTTGAAATTCATGGG - Intergenic
993979598 5:94529629-94529651 AACAAGACTAGGAAAGTCAGAGG + Intronic
994794063 5:104270959-104270981 AACAGGACATTCAAGGTCCTCGG - Intergenic
994812318 5:104536606-104536628 AAAAGGACTTTGTATGGCATGGG - Intergenic
995745994 5:115404205-115404227 AAAAGGACTAGGAAAGTAATTGG + Intergenic
995907313 5:117141213-117141235 AACAGTACTTCGTAAGTCATTGG + Intergenic
998763962 5:145464054-145464076 CACAGGCCTTTGGAGGTCATTGG - Intergenic
1000557791 5:162748265-162748287 AACAGGACTTTTATAGCCTTGGG - Intergenic
1005689989 6:28295066-28295088 AACAGGAGTTTGGAAGAAATTGG + Intronic
1008055347 6:46939972-46939994 AACAGGAGTTTGAATTTCAAGGG + Intronic
1008148767 6:47924376-47924398 AAGATGACTTTGAAACTCAGTGG + Intronic
1009276248 6:61684514-61684536 AACAGGACTCTAAAATTCGTAGG - Intronic
1009697546 6:67127553-67127575 AAAAGGAATTTGAAAGTCTGAGG - Intergenic
1009710623 6:67313928-67313950 AACTGAACTTTGAAAGCCTTAGG + Intergenic
1010020166 6:71150211-71150233 AACAGGGCTTTGAGCGTCATGGG - Intergenic
1010720255 6:79275509-79275531 AAAATGACTTTGTAAGTCAATGG + Intergenic
1011566078 6:88673898-88673920 AACAGGATTTTCCAAATCATTGG + Intronic
1012119182 6:95341873-95341895 AGTAGGATTTTGAATGTCATAGG + Intergenic
1012695433 6:102375962-102375984 AACAGGAGTTTGGAAGACATTGG + Intergenic
1015819933 6:137249944-137249966 AACAGGAAGTTGAAAGGCAAAGG - Intergenic
1016232745 6:141826615-141826637 ATCAGGACATGGAAAGTCATGGG - Intergenic
1016869887 6:148806640-148806662 AAAATGAATTTGAAAGGCATAGG - Intronic
1016974993 6:149798810-149798832 ATCAAGACCTTGAAAATCATAGG + Intronic
1017270068 6:152494196-152494218 AAATGGATTTTGAAAGTTATGGG - Intronic
1017832998 6:158148811-158148833 ATCAGTAATCTGAAAGTCATTGG - Intronic
1018288284 6:162264315-162264337 AAGAGGTATTTGAAAGGCATTGG - Intronic
1018665208 6:166129070-166129092 AACAGAGCTTCAAAAGTCATAGG + Intergenic
1023724554 7:43128813-43128835 AACAGGACTTTGGAAGACATTGG + Intronic
1024407210 7:48995541-48995563 AACACGAGTTTGAACTTCATGGG - Intergenic
1024698913 7:51885739-51885761 AGCATGACTTTGGAAGTCAATGG + Intergenic
1025809402 7:64865640-64865662 AGCACTACTTTGCAAGTCATGGG - Intergenic
1027473093 7:78596756-78596778 ATCAGGACTCTGGAAGTAATTGG - Intronic
1027959330 7:84924125-84924147 TACAGGACTTTGAAATAAATGGG + Intergenic
1029947556 7:104549144-104549166 AATATGACTTTAAAAGTAATGGG + Intronic
1031153887 7:118086450-118086472 GAAAGGACTCTGAAAGTCAGGGG - Intergenic
1033462898 7:141563483-141563505 AACAGGACTTAGAAAGAAAATGG - Intronic
1033707314 7:143902153-143902175 TACAGGACTTGGAAAGTCTTAGG + Exonic
1039164993 8:34668630-34668652 AATAGGACTTTCAAAGACTTGGG - Intergenic
1041639454 8:60180774-60180796 ACCAGTATTTTGCAAGTCATAGG + Intergenic
1042287305 8:67127882-67127904 AACAAATATTTGAAAGTCATTGG - Intronic
1042729265 8:71913277-71913299 AAGAGAACTTTGAAGCTCATAGG - Intronic
1043652838 8:82620087-82620109 ACAAAGACTTTGAAAGTTATTGG + Intergenic
1045010595 8:97955428-97955450 AACAGAAACTTGAAAGTCATGGG - Intronic
1045127735 8:99112265-99112287 TACAGAACTTTGACAGTCAGAGG - Intronic
1045710901 8:104982839-104982861 AACTGGAATCTGGAAGTCATAGG + Intronic
1048260054 8:132937589-132937611 AACAGGACAATGAAAATAATTGG - Intronic
1051510277 9:17869860-17869882 AATAGCACTTTGAAAGTTCTTGG + Intergenic
1052303831 9:26982840-26982862 CCCAGCACTTTGAAAGGCATAGG - Intronic
1052689566 9:31800153-31800175 AACAGCACTTTGAAATTTACTGG + Intergenic
1052988966 9:34507603-34507625 AACATGACTTTGAACTACATGGG - Intronic
1055660110 9:78494778-78494800 AATAGGACTTTGTAAATCTTGGG - Intergenic
1055731121 9:79280110-79280132 AAAAGGACTTGGAAAGCCATGGG + Intergenic
1055733069 9:79299011-79299033 AACTGGAATTTCAAAGCCATAGG - Intergenic
1056195484 9:84224618-84224640 AACAGGAGTTTAAAAGTCATGGG + Intergenic
1056806351 9:89731992-89732014 AACTGGAGTTTGAAAGTGACAGG - Intergenic
1058196080 9:101978157-101978179 AACAGAACAGTGAAAGTCAAAGG + Intergenic
1058763712 9:108161430-108161452 ATCAGGATTCTGACAGTCATAGG + Intergenic
1059220436 9:112611704-112611726 AACAGGATTTTTAAAATGATAGG + Intronic
1185855728 X:3533179-3533201 AAGAGTATTTTGAAAGTCAGCGG - Intergenic
1188556441 X:31417514-31417536 AACAGGACTTTAGAAATTATAGG - Intronic
1189111212 X:38291800-38291822 ACCAGGACGTTGTAGGTCATTGG - Intronic
1191013980 X:55790479-55790501 AAATAGATTTTGAAAGTCATGGG + Intergenic
1191614641 X:63156016-63156038 AAAACGACTTTAAAATTCATAGG + Intergenic
1191621655 X:63222911-63222933 AAAACGACTTTAAAATTCATAGG - Intergenic
1192083882 X:68075069-68075091 AACAGTAGTTTTAAAGGCATTGG + Intronic
1193260240 X:79397866-79397888 ACCAGGACTTTGAAAGACTGAGG + Intergenic
1194364795 X:93001958-93001980 TACAGGAGTTTGAGAGACATTGG + Intergenic
1194404122 X:93473199-93473221 AAAAGTATTTTAAAAGTCATGGG + Intergenic
1196767679 X:119263198-119263220 AACAGGACTTTGAATATCACAGG + Intergenic
1197622338 X:128764481-128764503 CATAGGACTTGTAAAGTCATTGG - Intergenic
1197787506 X:130213656-130213678 GTCAAGACTCTGAAAGTCATGGG + Intronic
1200673021 Y:6118216-6118238 TACAGGAGTTTGAGAGACATTGG + Intergenic