ID: 1179335909

View in Genome Browser
Species Human (GRCh38)
Location 21:40453595-40453617
Sequence CTAAGCAATGCTCAGATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 190}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179335909 Original CRISPR CTAAGCAATGCTCAGATGGA TGG (reversed) Intronic
903293379 1:22328793-22328815 CCAAGGAGTCCTCAGATGGACGG + Intergenic
904929466 1:34074883-34074905 CTAAGCAAGGGGCAGATGGAGGG + Intronic
906260874 1:44388816-44388838 CTAAGGGATGCTCAGATGGCTGG - Intergenic
910118412 1:83757843-83757865 CTAAGGAATGCCCAGGTGGCTGG + Intergenic
910167257 1:84340798-84340820 CTAAGAGATGCCCAGATGGCTGG + Intronic
910431774 1:87166568-87166590 CTAAGGGATGCCCAGATGGCTGG - Intronic
910451192 1:87347437-87347459 CTAAGCAATGTTGAGATTGGGGG - Exonic
911475286 1:98366371-98366393 ATGAGCAATACTCAGGTGGAAGG - Intergenic
912436414 1:109665062-109665084 CTAAGGGATGCTCAGATGGCAGG + Intronic
912438504 1:109679781-109679803 CTAAGGGATGCTCAGATGGCTGG + Intronic
912441024 1:109698237-109698259 CTAAGGGATGCTCAGATGGCAGG + Intronic
912604394 1:110973579-110973601 CTAAGGGATGCTCAGATAGCTGG - Intergenic
915350072 1:155218718-155218740 TTGAGCAAGGCACAGATGGAGGG - Intergenic
915353470 1:155240956-155240978 TTGAGCAAGGCACAGATGGAGGG - Intronic
916651065 1:166835230-166835252 CTAAGAGATGCTCAGATAGCTGG + Intergenic
916893514 1:169137426-169137448 ATAAGCAATGAACAGATCGATGG + Intronic
918033415 1:180840379-180840401 CTAAGAAACCCTCAGATGAAGGG - Intronic
919089287 1:192958436-192958458 CTAAGGAATGCCCAGATAGCTGG + Intergenic
920254848 1:204647662-204647684 AGAAGCAAAGCCCAGATGGACGG + Intronic
920462088 1:206148697-206148719 CTAAGGAATGCCCAGATAGCTGG + Intergenic
920791448 1:209096815-209096837 CTGAGCAGTACTCAGATGGACGG - Intergenic
921125986 1:212178605-212178627 CTAAGCAATTGTCATGTGGATGG - Intergenic
921910229 1:220540510-220540532 CTGAGGAATGCTCAGATAGCTGG - Intronic
922233271 1:223704469-223704491 CAAAGAAATTCTCAGATGGGAGG - Intronic
1065333788 10:24633225-24633247 CTAAGCTATCCTCAGATAGCTGG + Intronic
1067164134 10:43851970-43851992 CTAAGGGATGCCCAGATGGCTGG + Intergenic
1068776419 10:60872833-60872855 CTAAGCAATGCTCAGGAAGGTGG + Intronic
1069140264 10:64813219-64813241 CTAAGGAATACTCAGAAAGATGG - Intergenic
1069833617 10:71295555-71295577 CTAATAAATGGACAGATGGATGG - Intronic
1069852587 10:71419690-71419712 CAAAACAATGGTCTGATGGAAGG - Intronic
1074219919 10:111426451-111426473 CTAAGAGATGCCCAGATGGGTGG + Intergenic
1075527783 10:123200705-123200727 CTAAGGGATGCTCAGCTGGCCGG + Intergenic
1075824997 10:125348275-125348297 CTAAGGAATGCCCAGATAGCTGG - Intergenic
1076893010 10:133294010-133294032 CTCCGCAATGCTCAGATACATGG + Intronic
1077359443 11:2134215-2134237 CACAGCAATGCTCAGCTGGAAGG + Intronic
1077901720 11:6495499-6495521 CTAAGGGATGCTCAGATAGCTGG - Intronic
1078318520 11:10311987-10312009 CTAAGGGATGCCCAGATAGATGG + Intronic
1079469473 11:20764700-20764722 CTGAGAACTGCTCAGCTGGAGGG + Intronic
1080016417 11:27511399-27511421 CTAAGTGATGCTCAGATAGCTGG - Intergenic
1080154510 11:29093106-29093128 CTAAGCAATCCTGAGATTAATGG + Intergenic
1085028017 11:73249941-73249963 CTAACGAATGCCCAGATGGCTGG + Intergenic
1085101955 11:73808473-73808495 CTATTCCATGCTCACATGGAGGG - Intronic
1087503818 11:98995160-98995182 CTAAGGGATGCCCAGATAGATGG - Intergenic
1087558159 11:99748906-99748928 CTAAGAGATACTCAGATGGCTGG - Intronic
1088052660 11:105536753-105536775 CAAAGCATTTCCCAGATGGAGGG - Intergenic
1089011252 11:115133541-115133563 CTAAGGAATGCTCAGATATCTGG + Intergenic
1089137584 11:116262159-116262181 CTCATCCATGCTCAGATGGTCGG + Intergenic
1090227116 11:125078340-125078362 CTCAGAAATGCTCATCTGGATGG - Intronic
1090528907 11:127568769-127568791 CTAAGGAATGCCCAGATAGGTGG + Intergenic
1095424363 12:42059711-42059733 CTAAGGAATGCCCAGATAGCTGG + Intergenic
1096521112 12:52185309-52185331 CCAAGCTGTGCTCAGATGGGAGG - Intronic
1099758897 12:86893102-86893124 CTCAACAGTGCTTAGATGGAAGG + Intergenic
1101192681 12:102351469-102351491 CTAAGCAACGCCCAGATAGCTGG + Intergenic
1104136342 12:125942989-125943011 CTAAGGGATGCCCAGATGGTGGG + Intergenic
1104476670 12:129076055-129076077 CTCAGCATTGCTGAGATTGATGG - Intronic
1104550017 12:129748082-129748104 ATGAGCATTGCTCAGATGCATGG + Intronic
1104897588 12:132171905-132171927 CTGAGCAAGCCTGAGATGGAGGG - Intergenic
1105584535 13:21731752-21731774 CTAAGGAATGCCCAGATAGCTGG + Intergenic
1106037656 13:26058730-26058752 GTAAGCTATCCACAGATGGATGG + Intergenic
1106908413 13:34434763-34434785 GTAAGCGATGTTCAGATGCATGG - Intergenic
1107868302 13:44725125-44725147 CTAAGGAAAACTCAGGTGGATGG + Intergenic
1111571007 13:90086519-90086541 CTAAGGAATGCCCACATAGAAGG + Intergenic
1115088058 14:29540810-29540832 ATAAACAATGCTCATATGAATGG + Intergenic
1115125917 14:29993678-29993700 TTAAGGAATGCTCAGATTGCTGG - Intronic
1116190916 14:41664551-41664573 CTTTGCAATGCTGAGATGGGAGG + Intronic
1119459122 14:74783587-74783609 CTAAGCAATACGCAGATTGGTGG - Intronic
1119974933 14:79015026-79015048 CTGAGCAAATCTCAGAGGGAAGG - Intronic
1121674821 14:95743949-95743971 CTAAGCCATGCCCAGATAGCTGG + Intergenic
1122540484 14:102495352-102495374 TTAAGCTAAGCTCAGAGGGAAGG - Intronic
1126739634 15:51764613-51764635 CTTAGCAAGGCGCAGAAGGAAGG + Intronic
1130753012 15:86733455-86733477 CTAAGGGATGCTCAGATAGCTGG - Intronic
1130819575 15:87480163-87480185 GTAGGCAATGCAGAGATGGAAGG - Intergenic
1131348184 15:91671043-91671065 CTAAGCAATGGTAAGATGACAGG - Intergenic
1131849921 15:96527923-96527945 ATAAGCAGTGCAAAGATGGAAGG - Intergenic
1136415671 16:30102011-30102033 CTAAGGAAAGCTCAGAGGGAAGG + Intergenic
1138057031 16:53845964-53845986 CAAAGCAATGTTCACATGGAAGG - Intronic
1138184836 16:54968518-54968540 CTAAGCATTGCTGGAATGGATGG + Intergenic
1138961258 16:62033156-62033178 CCCAGGAATGCTCAGCTGGATGG - Intronic
1142112002 16:88337883-88337905 CTAAACCCTTCTCAGATGGACGG + Intergenic
1142341195 16:89523912-89523934 CTCAGGAAAGCTCAGCTGGACGG - Intronic
1143769913 17:9162042-9162064 CTGAGCAATGCTCATGGGGAGGG + Intronic
1150016410 17:61561820-61561842 TTTAGCATTACTCAGATGGATGG - Intergenic
1151007774 17:70457868-70457890 CTAAAGAATGCTCAGATGGCTGG - Intergenic
1152193860 17:78904660-78904682 CTAAGGGATGCTCAGATAGCTGG + Intronic
1152292427 17:79447729-79447751 CTGAGCAATGCTCACATGGATGG - Intronic
1153411352 18:4797491-4797513 CTAACCTATACTCAGAGGGAAGG - Intergenic
1155662428 18:28265572-28265594 CCAAGCAATGAACACATGGAGGG - Intergenic
1156390429 18:36645133-36645155 CTATGCCAAGCTCAGAAGGATGG + Intronic
1157492405 18:48133311-48133333 CCAAGCAAGGCCTAGATGGAGGG + Intronic
1158411965 18:57214017-57214039 CTAAGGGATGCTCAGATAGCTGG + Intergenic
1159203017 18:65212464-65212486 CTAAGAAATGCTCAGACAGCTGG - Intergenic
1163384490 19:16991146-16991168 CTTAGCAATGCTCAGCTTGTGGG + Intronic
1164601233 19:29564983-29565005 CAAAGCAATCTTCAGATGCACGG - Intergenic
1168048292 19:53809851-53809873 CAAAGCAAAGCTCAGAGCGACGG - Exonic
926985061 2:18613498-18613520 CTAAATAATGCCCAGATAGATGG + Intergenic
927212958 2:20649916-20649938 CTCAGCCATGTGCAGATGGATGG - Intronic
929034557 2:37678220-37678242 CTCTGGAATGTTCAGATGGAGGG - Intronic
930653918 2:53989702-53989724 GTAAGCAATGCCAAGATGAAGGG + Intronic
931056543 2:58478508-58478530 CTAAGAATGGCTCAGATGGCAGG - Intergenic
935585991 2:104800864-104800886 CTGAACACTGCTGAGATGGAGGG - Intergenic
937152441 2:119695290-119695312 GAAAGCAATGCACAGATGTAAGG + Intergenic
939561347 2:143735980-143736002 TGAAGAAATGCACAGATGGATGG - Intronic
943191339 2:184682237-184682259 GTCAGCAATGCTCAGACAGAAGG + Intronic
944530473 2:200663031-200663053 CTAAGCTCTCCTCAGATAGATGG - Intronic
945571385 2:211472193-211472215 CTAAGGAATGTTAAGAGGGAAGG + Intronic
1169035224 20:2445259-2445281 TTAAGCAATCCTCAGATTGTTGG - Intergenic
1172202565 20:33136859-33136881 ATAAGCCATGCTCAGTTGGGAGG + Intergenic
1172205536 20:33160400-33160422 GCAATAAATGCTCAGATGGATGG + Intergenic
1173301430 20:41807151-41807173 CCAAGCAAAGCTGTGATGGAAGG - Intergenic
1175500197 20:59444651-59444673 CTAAGCATTGCTGAGGTTGACGG + Intergenic
1176047134 20:63098567-63098589 GTGAGCAATGGACAGATGGATGG + Intergenic
1176066408 20:63198839-63198861 CTAAGCAATGCTCACAGTGTGGG + Intronic
1177625847 21:23658315-23658337 CTAAAAAATCCTCAGAAGGAAGG + Intergenic
1177629394 21:23706865-23706887 CTAAGGGATGCTCAGATAGCTGG + Intergenic
1178383252 21:32129148-32129170 CTCAGCCAACCTCAGATGGATGG + Intergenic
1179335909 21:40453595-40453617 CTAAGCAATGCTCAGATGGATGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
949509620 3:4756911-4756933 CCAAGAACTACTCAGATGGAAGG - Intronic
949603667 3:5631072-5631094 CTGAGAAATTATCAGATGGAGGG + Intergenic
949686471 3:6577739-6577761 CTAAGACATGCTCAGATAGCTGG + Intergenic
949798629 3:7878549-7878571 CTGAGAAATGCTCAGATAGCAGG + Intergenic
951986636 3:28628499-28628521 CTAAGGAATGCCCAGATAGCTGG + Intergenic
954375481 3:50192177-50192199 CTAGGCAATGCTCAGAAGCCAGG + Intronic
955614082 3:60787322-60787344 TTGAGCAGTGCTCAGAAGGATGG - Intronic
956516899 3:70059722-70059744 CTAAGGGATGCTCAGATAGCTGG - Intergenic
956608019 3:71092538-71092560 CGAAGCAAACCTTAGATGGAAGG + Intronic
961581646 3:127888129-127888151 CTAAGGAATGCCCAGATGGTTGG - Intergenic
961618620 3:128205347-128205369 CTGAGCAGTGCAGAGATGGAGGG + Intronic
962033309 3:131624182-131624204 ATAAGCAATGGTCAGAAAGATGG - Intronic
962196168 3:133365514-133365536 CTAAGCAAATCTCAGAGGCAAGG + Intronic
963472939 3:145766424-145766446 CTAAGGAATGCCCAGATAGCTGG + Intergenic
964038325 3:152226218-152226240 CTAAGGGATGCTCAGATAGCTGG - Intergenic
969649340 4:8454835-8454857 CTAAGCCATGCTGAGATCAAGGG - Intronic
969948043 4:10805072-10805094 CTAAGGAATGCTCAGATGGCTGG + Intergenic
969977147 4:11115288-11115310 CAAAGCACTGCTCAGAGAGATGG - Intergenic
970683105 4:18534329-18534351 CTAAGGAATGCCCAGATAGCTGG + Intergenic
971037755 4:22713631-22713653 CTTAGCAATGCTCTGATGGATGG + Intergenic
971244357 4:24914646-24914668 TTGAGCAAGGCTCAGCTGGATGG - Intronic
975498461 4:75058823-75058845 CTGAGCAATGCTCAGGCAGAAGG + Intergenic
976476548 4:85490401-85490423 CAAAGCAAAGCTCAGATTTAAGG - Intronic
976904979 4:90226216-90226238 CTGAGCAAGGCTCAGCTGGCTGG - Intronic
977089198 4:92649563-92649585 CCAAGCAATGCCCAGATAGCTGG - Intronic
980383060 4:132050902-132050924 CTAAGCAATACCCAGATAGCTGG + Intergenic
982759725 4:159266912-159266934 TTAAGCAAGTCTCAGAGGGATGG - Intronic
985295183 4:188430120-188430142 CTAAGCTATGTTCAGATGAGAGG - Intergenic
989999533 5:50877055-50877077 ATAAGCAATGCTGAGATAGGAGG + Intergenic
991015390 5:61926485-61926507 CTAAGGGATGCTCAGATAGCTGG + Intergenic
992020442 5:72618726-72618748 GTAAGCAAGGCTGAGATCGAGGG - Intergenic
995002553 5:107152192-107152214 CTGAGCAAACCTCAGATGTATGG + Intergenic
995046935 5:107661197-107661219 CTAAGGGAAGCTCAGATGTATGG - Intronic
996844573 5:127885070-127885092 CTAAGGAATGGACAGAAGGAAGG - Intergenic
1001203527 5:169741119-169741141 CTCAGCAATGGTCAGATGGCTGG - Intronic
1003394050 6:5737773-5737795 ATCAGCAATGCACAGATAGACGG - Intronic
1005698512 6:28375445-28375467 CTAACGAATGCTGAGAGGGAAGG - Intergenic
1006652643 6:35564320-35564342 CCAAGAAAAGCTCAGAGGGAAGG - Intergenic
1007281865 6:40718909-40718931 CTAAGGAATGCCCAGATAGCTGG - Intergenic
1008434378 6:51457722-51457744 CTCAGCAGTACTCAGAAGGAAGG + Intergenic
1008559686 6:52711857-52711879 CTAAGAGATGCTCAGATAGCTGG + Intergenic
1008742834 6:54630544-54630566 CTAAGGGATGCTCAGATAGCTGG + Intergenic
1010616949 6:78024536-78024558 TTTAGGAATGCTCAGATTGAAGG - Intergenic
1013020660 6:106213117-106213139 CTAAGTAATGATCAGAAGGCAGG + Intronic
1015000358 6:128206894-128206916 GTAAGCTATGCTAATATGGAAGG - Intronic
1015245104 6:131065974-131065996 TCAAGCAATGCTCAGCTGGGAGG + Intergenic
1015862324 6:137693902-137693924 CTAAGGGATGCTCAGATAGCTGG + Intergenic
1016552018 6:145292160-145292182 CTAAGTAATGTTCAGATCGCTGG - Intergenic
1021189045 7:17599277-17599299 GTAAGCCATGCTCAGATTTATGG + Intergenic
1021927844 7:25550492-25550514 CTGAGCAGTGTTCTGATGGATGG - Intergenic
1022119882 7:27297921-27297943 GTAAGCATTTCTGAGATGGAGGG - Intergenic
1026768051 7:73172773-73172795 CAAAGCATTGCTCAGTTGGGAGG - Intergenic
1027044516 7:74982483-74982505 CAAAGCATTGCTCAGTTGGGAGG - Intronic
1027079122 7:75219877-75219899 CAAAGCATTGCTCAGTTGGGAGG + Intergenic
1027952026 7:84828992-84829014 CTTAGAAATGCTGAGATGGCTGG - Intergenic
1030997756 7:116378739-116378761 CTAAGGAATGCTCAGATAGCTGG - Intronic
1031174426 7:118331931-118331953 CTAAGGAATGTTCAGATAGCTGG + Intergenic
1033223343 7:139543109-139543131 CTAAGCCATCCTCAGGTGGGAGG - Intronic
1033725388 7:144110453-144110475 CTGAGGAATGCTCAGTTGAAGGG + Exonic
1033728088 7:144142879-144142901 CTGAGGAATGCTCAGGTGAAGGG + Intergenic
1034457456 7:151178771-151178793 ATGAGCACTGCTCAGATGCAGGG - Intronic
1035367475 7:158358333-158358355 CTCAGCCATTCTCAGAAGGATGG + Intronic
1036590076 8:10161216-10161238 CTCAGCAATGCTCTGAGGAATGG - Intronic
1037208128 8:16350079-16350101 CTAAGGGATGCCCAGATAGATGG - Intronic
1038731426 8:30131396-30131418 CTTTGCAATGCTGAGGTGGAAGG - Intronic
1039049523 8:33480255-33480277 CGAAGAAATACTGAGATGGAAGG - Intronic
1040432849 8:47361302-47361324 CTAACCAATGGTCAGATGGATGG - Intronic
1041331478 8:56730362-56730384 CTAAGCCGTGCTCAGCTGTAGGG + Intergenic
1042937907 8:74078980-74079002 CTAAGGGATGCTCAGATAGCTGG + Intergenic
1043190596 8:77217438-77217460 CTATGCAATGATCAAATGAAGGG + Intergenic
1044763060 8:95542748-95542770 CTAAGCAATGCAGACATGGCTGG + Intergenic
1045813362 8:106250648-106250670 CTAAGGAATGCCCAGATAGCTGG - Intergenic
1046034483 8:108823990-108824012 TTAAGCACTGCTCTGATAGATGG + Intergenic
1047991991 8:130296165-130296187 CTAAGCAAGACTCATAAGGAAGG - Intronic
1048716857 8:137280839-137280861 CTAAGAAATGCCCAGATAGCTGG + Intergenic
1051281852 9:15449242-15449264 TTGAGCAATGTTCAGATGGTTGG - Intronic
1051447742 9:17158984-17159006 TAAAGCAGTGCTAAGATGGAAGG - Intronic
1052238994 9:26249474-26249496 CAAAGCAATGCTATGATGTAAGG + Intergenic
1052273479 9:26652131-26652153 CTAAAAAGTGCTCAGGTGGAAGG - Intergenic
1056240763 9:84644249-84644271 CTAAGCAATGCCCATATAGCTGG - Intergenic
1056682696 9:88732970-88732992 CTAAGCAGTGGTGAGATGGAAGG + Intergenic
1056936318 9:90917596-90917618 CTAAGGAATGCCCAGATAGCTGG + Intergenic
1185538794 X:885407-885429 CCAAGCAATTATCTGATGGACGG - Intergenic
1188663568 X:32790863-32790885 TTGTGCAATGCTCAGGTGGAAGG - Intronic
1189879622 X:45476795-45476817 CTAAGGAATGCCCAGATAGTTGG + Intergenic
1194354247 X:92861302-92861324 CAAAGCAATGTACAGATTGAAGG + Intergenic
1196063319 X:111434551-111434573 CTAAGAAGTGCTCAGAGAGATGG + Intergenic
1197947915 X:131860559-131860581 CTAAGGGATGCTCAGATAGCTGG - Intergenic
1199202725 X:145111770-145111792 CTAATCACAGCTCAGAGGGAGGG - Intergenic
1199556823 X:149118321-149118343 CTAAGGAATGCCCAGATAGCTGG - Intergenic
1199692336 X:150318109-150318131 TTGAGCATTGCTGAGATGGAGGG - Intergenic