ID: 1179337462

View in Genome Browser
Species Human (GRCh38)
Location 21:40471269-40471291
Sequence AACTCTAAGAAACCACATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179337460_1179337462 26 Left 1179337460 21:40471220-40471242 CCTGCAGAAAAAGTCATCTGTTT 0: 1
1: 0
2: 1
3: 19
4: 282
Right 1179337462 21:40471269-40471291 AACTCTAAGAAACCACATTAGGG 0: 1
1: 0
2: 0
3: 15
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179337462 Original CRISPR AACTCTAAGAAACCACATTA GGG Intronic
900871806 1:5309518-5309540 AATTTTAAGAAATCACATTAAGG + Intergenic
905955198 1:41987644-41987666 AACGCCAAGAACCCACATTGGGG + Intronic
907317837 1:53583854-53583876 AACTTTACGGAACCACATTATGG + Intronic
908590389 1:65626020-65626042 AACACTGAGAAACCACTTCATGG - Intronic
909406734 1:75298719-75298741 AACTTTAATAGACCAAATTATGG + Intronic
912890702 1:113526574-113526596 AGGTCTTATAAACCACATTAAGG + Intronic
914972986 1:152328306-152328328 AACTATAAGAAACCATGTTTTGG + Intergenic
917145183 1:171883128-171883150 AACTGTAATAAAGAACATTAGGG - Intronic
917194610 1:172452169-172452191 AACTCTTAGAATCCATATAAAGG - Intronic
919296440 1:195707590-195707612 AAATCTAAGAAACATCATTCTGG + Intergenic
921566823 1:216731542-216731564 ATCTCTAGAAAACCACATTTTGG + Intronic
922213471 1:223502528-223502550 AAGTCTAAGAAGTCACATGAGGG + Intergenic
922974328 1:229771167-229771189 GACTGTCAGAAAACACATTAAGG - Intergenic
923732378 1:236564916-236564938 AAATGGAAGAAACCACATCACGG + Intronic
1067365781 10:45627336-45627358 AACTCTGAGAAACAGCAGTAAGG - Intronic
1070222746 10:74467662-74467684 ATCTCTAAGAAGTCAGATTATGG + Intronic
1071096155 10:81977632-81977654 AATTAAAACAAACCACATTATGG + Intronic
1071559620 10:86634756-86634778 AAATCTCAGAAACCAAACTAAGG + Intergenic
1073576792 10:104632737-104632759 ACTTCTCAAAAACCACATTATGG + Intergenic
1074786041 10:116841848-116841870 AACTCTAAAAGACAAAATTATGG + Intergenic
1079890274 11:26043011-26043033 TCATCTAAGAAACCACATCAGGG - Intergenic
1081058637 11:38444893-38444915 AGTTCTAAGAAACAATATTATGG - Intergenic
1082291512 11:50379191-50379213 CAATCTAAGAAAGAACATTACGG + Intergenic
1082815935 11:57509291-57509313 AACTCTAAGAAAACACAGGCCGG + Intronic
1083050821 11:59774966-59774988 AAACCTAAGAAACCATAGTATGG - Intronic
1085207584 11:74745793-74745815 AACTGTAACCAACCACTTTATGG + Intergenic
1087148898 11:94840202-94840224 AATTGTAAGAAACCACACCACGG - Intronic
1090030754 11:123204072-123204094 CACTCTTCCAAACCACATTATGG + Intergenic
1092129334 12:6097869-6097891 CTTTCTAATAAACCACATTAAGG + Intronic
1092714276 12:11372324-11372346 AAATGAAAGAAACCAAATTAGGG + Intronic
1093775169 12:23065096-23065118 AACTCTCAGAAATGACATTTGGG + Intergenic
1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG + Intronic
1094078606 12:26506799-26506821 AAAACAAAGAAACCACCTTAAGG + Intronic
1097390237 12:59003061-59003083 ATCTCTAAGAAATCACATATTGG - Intergenic
1097672006 12:62551070-62551092 AACTATAAGAAAGTACATCATGG - Intronic
1097908035 12:64940525-64940547 AACTGTAAGATACCACTTTATGG + Intergenic
1098213074 12:68186531-68186553 AACTCCAATAAACCACCTTCAGG + Intergenic
1098806240 12:75023158-75023180 TACTCTATGAAAACACAATATGG - Intergenic
1099216194 12:79856550-79856572 AAGTCTTAGATAACACATTACGG - Intronic
1100388462 12:94125613-94125635 AAGTCTAAGAAAACACCTTCTGG - Intergenic
1100959368 12:99945516-99945538 AAATCTCAGACACCAAATTAAGG + Intronic
1103857994 12:123987832-123987854 AAATCTGAGAAACCACAGAAAGG - Intronic
1104070857 12:125344310-125344332 AAATCTGAGAAACCAAATTGGGG + Intronic
1106508785 13:30395065-30395087 AACTTAAAGAAGCCACATTCTGG + Intergenic
1107470509 13:40687237-40687259 ACCTATAAGCAACCGCATTAGGG + Intergenic
1107697566 13:43015172-43015194 AACACTAAAAAACCACCTTAAGG - Intergenic
1108510919 13:51155224-51155246 AACTCAAAAAAACTACATTTTGG + Intergenic
1109965593 13:69690223-69690245 AAGTTTAATAAGCCACATTAGGG + Intergenic
1110594290 13:77301662-77301684 GACACTAAGTAAACACATTAAGG + Intronic
1111063543 13:83057773-83057795 AAATCTTAAAAACCTCATTATGG + Intergenic
1113369356 13:109708380-109708402 AACCCAAATAAACCACATTATGG + Intergenic
1113714761 13:112495184-112495206 AAATCTAAGACCTCACATTATGG - Intronic
1114891798 14:26933967-26933989 AAATCTAAGAAAATAAATTATGG + Intergenic
1116576319 14:46580762-46580784 ACTTCTAAGAAACCACAGCAGGG - Intergenic
1117497866 14:56323607-56323629 GACTCTAAGAAAAAATATTAAGG - Intergenic
1120681230 14:87483224-87483246 AGCTCTAGGAAAACACATTCAGG + Intergenic
1121116547 14:91347169-91347191 AACACTAAGAAAGCACTTAAGGG + Intronic
1121399434 14:93659607-93659629 ACATCTTAGATACCACATTAAGG - Intronic
1125325400 15:38531401-38531423 AAGTCTAAGAAATCTCACTAAGG + Intronic
1126255318 15:46618283-46618305 AATTCAAAGAAACCACATCCAGG + Intergenic
1128860208 15:71063974-71063996 AACTTTAACAAACCACATCCTGG + Intergenic
1129914671 15:79258408-79258430 AAATCTAAGAAACCCAAGTAAGG + Intergenic
1130295359 15:82643855-82643877 AAATCTAAGAGACAGCATTATGG + Intronic
1132081407 15:98869061-98869083 AAATCTGAGAAACCACTTTTAGG - Intronic
1133111871 16:3552638-3552660 AACCCTAAGAAACCTCCCTAGGG + Intronic
1135721882 16:24824322-24824344 AACTCCACGATACCACAATAAGG - Exonic
1136049291 16:27639072-27639094 AACAATAAGAAAGCACATTTGGG + Intronic
1136744330 16:32570959-32570981 AAATCTAAGAAAAGACATTTGGG + Intergenic
1140160014 16:72480022-72480044 AAATCTAAGAAAACATATAAAGG + Intergenic
1140596478 16:76420894-76420916 AACTATAAAAATTCACATTATGG - Intronic
1203025269 16_KI270728v1_random:504273-504295 AAATCTAAGAAAAGACATTTGGG - Intergenic
1203046452 16_KI270728v1_random:830158-830180 AAATCTAAGAAAAGACATTTGGG + Intergenic
1145229989 17:21166510-21166532 ATGTCTGAGAAGCCACATTAAGG - Intronic
1147554927 17:41472248-41472270 AACTCTTAGAAGCCACGGTAGGG + Intergenic
1149790977 17:59476804-59476826 AACTATAAGAACCAAAATTAAGG + Intergenic
1149891876 17:60397251-60397273 ATATCTAAGAAAGCATATTAAGG - Intronic
1151640473 17:75388817-75388839 AACTCTAACCAACCAAACTAGGG + Intronic
1155434267 18:25795149-25795171 GACTCTAGGAAACAACATTGTGG + Intergenic
1155872527 18:31045056-31045078 AACTCGAAGAAAACATATTATGG + Intergenic
1156138079 18:34069193-34069215 AACTCTAAGAAAACACCAAATGG + Intronic
1156654518 18:39269320-39269342 AAATCTCACAAACAACATTAAGG + Intergenic
1158096704 18:53780338-53780360 ATCTCCAAGACACCACATAATGG + Intergenic
1159969582 18:74632822-74632844 AAATCTTAGAGACCACATGAAGG + Exonic
926016375 2:9455432-9455454 AGCTGTAAGAAAGCACCTTATGG - Intronic
926064988 2:9831520-9831542 AACTTTATCAAACCACCTTATGG - Intergenic
926090680 2:10047144-10047166 AACTCACAGAACTCACATTAAGG - Intronic
929301422 2:40308081-40308103 AAGCCTAAGAAACCCCATTTTGG + Intronic
929469080 2:42173062-42173084 ATCTATAAGAAACAACATTCTGG + Intronic
930788760 2:55300810-55300832 AACTTTAAGAAACCAATTTTTGG - Intronic
931327189 2:61238592-61238614 AAATCTAAAAAACCACATTCTGG + Intronic
933230703 2:79803747-79803769 AATTCTAAGGAACTACATCATGG - Intronic
935802254 2:106709917-106709939 AGCTATAAGTAGCCACATTAAGG + Intergenic
936742707 2:115533712-115533734 AACTCAAAGAAAGCACAGTCTGG + Intronic
938992618 2:136644817-136644839 AACTCTAAGATTCCACAACATGG + Intergenic
939791659 2:146585963-146585985 AATTTTAAGAAAACATATTAGGG - Intergenic
940615706 2:156046661-156046683 AACTCTAAGGAACATCATTCTGG + Intergenic
941736797 2:168986431-168986453 AACTTTAAAAAACTACATAAAGG - Intronic
942160651 2:173182701-173182723 AACTTTTAGAAACCACACCATGG + Intronic
942588499 2:177513543-177513565 AAGTGTAGGAAACCACATTCAGG + Intronic
945263245 2:207864274-207864296 AACTCCAATAAACCCCAGTAAGG + Intronic
1169847069 20:10005508-10005530 AAATCAAAGAAAACACAGTATGG + Intronic
1172753277 20:37266125-37266147 AACTGTAAGACAGCAGATTAGGG - Intergenic
1174962582 20:55175005-55175027 AACTCTAAGAAACCTCCTTGTGG + Intergenic
1176890755 21:14315688-14315710 AACTCTAAGAAGCAAGAATAGGG - Intergenic
1177655862 21:24016038-24016060 AACTCCCAGAATCCACATTTTGG - Intergenic
1179337462 21:40471269-40471291 AACTCTAAGAAACCACATTAGGG + Intronic
1183332662 22:37229743-37229765 AACTCTGAGTCACCACCTTATGG + Intronic
950328179 3:12132950-12132972 AAGTGTAAGAAAACACATTCAGG - Intronic
951498895 3:23362154-23362176 TGATCTGAGAAACCACATTAGGG + Intronic
952214388 3:31262343-31262365 AACTGAAAGAAAGCAGATTAGGG + Intergenic
954096022 3:48328867-48328889 AACACCAAGTAACAACATTAGGG - Intergenic
954334397 3:49907884-49907906 AACTCTCAGAAACTGCATGAGGG + Intronic
954520574 3:51221963-51221985 AACACTAGGAAACCAGAATATGG - Intronic
956408915 3:68958289-68958311 AACACTTATAAATCACATTAAGG - Intergenic
957922657 3:86765909-86765931 AACTTTAAGAAACCACCTACAGG - Intergenic
959517771 3:107288947-107288969 TACTTTAAAAAATCACATTATGG - Intergenic
959942578 3:112095021-112095043 AACTCTAAGACAGGAAATTAAGG - Intronic
960191146 3:114707585-114707607 AACTCAAAGCTACCACATGAAGG + Intronic
960439316 3:117667284-117667306 GACTCTAAGAAAAGGCATTATGG + Intergenic
964557752 3:157959074-157959096 AAGACTAGGAAATCACATTATGG + Intergenic
964659748 3:159107034-159107056 AACTCTAAGAAAAAAAAGTAGGG - Intronic
965455408 3:168894039-168894061 AAATCTAGGAAACAACATGATGG + Intergenic
968912579 4:3483644-3483666 GACTATAAAAAACCACATTACGG - Intronic
971621406 4:28858108-28858130 GGCTATAAGAAAACACATTAGGG + Intergenic
971903504 4:32695178-32695200 AAGTCTACGAAGCCACATTTTGG - Intergenic
972081668 4:35159365-35159387 AACTCTCAGATACCAGATTATGG - Intergenic
973001433 4:44956348-44956370 AAACCTAGGAAACCCCATTATGG - Intergenic
975890994 4:79027399-79027421 AACTCTTTGTCACCACATTAAGG + Intergenic
976218225 4:82734505-82734527 AGCTGTGAGAAACCACATAAAGG + Intronic
979412807 4:120399870-120399892 AACTCTAAGAAACCTAATTCTGG + Intergenic
979784329 4:124696543-124696565 AATACCAAGAAACCACATTTTGG + Intronic
981497144 4:145406975-145406997 AATCCTAAGAAATCACATTTTGG - Intergenic
981679744 4:147382988-147383010 AAATCTAGGAAACAACATTCTGG + Intergenic
983343687 4:166500154-166500176 AAATCTAAGAGATCAAATTATGG + Intergenic
983506541 4:168559025-168559047 AACTAAAAGAAACTATATTAGGG - Intronic
984470095 4:180158196-180158218 AACTCCAAGAACACACATTGGGG + Intergenic
984601066 4:181727253-181727275 AACTCTTAGATACCACAAGATGG - Intergenic
986779805 5:11054945-11054967 TGCTCTCAGAAAACACATTAAGG - Intronic
986885441 5:12228300-12228322 AACTTTAAAAAACCACATTCTGG - Intergenic
987881156 5:23748289-23748311 ACCACAAAGAAACAACATTAGGG + Intergenic
990250151 5:53905361-53905383 ATCTCTATGAAAGCATATTATGG + Intronic
991121067 5:63014932-63014954 AACACTAAGAACTCATATTAAGG + Intergenic
994314642 5:98318355-98318377 GACTCTCAGAAACTGCATTATGG + Intergenic
995364711 5:111345387-111345409 GACTGTAAGAAACTAAATTAAGG - Intronic
996703360 5:126471919-126471941 AATTCTAAGGAATCTCATTAGGG - Intronic
1002953622 6:1840641-1840663 TACTCTAAGAAACCAAAGTGTGG + Intronic
1003996373 6:11545012-11545034 AACTCTTAGCAACCAAATTTGGG - Intronic
1004115880 6:12767625-12767647 TACACCAAGAAACCAGATTAGGG + Intronic
1004459829 6:15825557-15825579 AGCTCTAAGAAATGACATGATGG - Intergenic
1004552986 6:16667670-16667692 ATCTCTAAGGCACCACAGTAAGG + Intronic
1005162548 6:22880921-22880943 AATTCTATGAAACAACATTCTGG - Intergenic
1005894700 6:30167992-30168014 AACTCTAAGAAGGCATAGTAGGG + Intronic
1007691928 6:43707999-43708021 AACACAAAGAAACCACATGCAGG + Intergenic
1007883033 6:45188221-45188243 CAATTTAAGAAACCACTTTATGG - Intronic
1009828986 6:68905202-68905224 AACTCAAATAAACCACAACATGG - Intronic
1010996197 6:82536006-82536028 AACTCTATGAAACAACAAAATGG + Intergenic
1011333498 6:86235262-86235284 AACTCTAAGAGAGAACATTCGGG - Intergenic
1011689552 6:89853980-89854002 AACTCTGAGAAATCTGATTATGG - Intronic
1012634586 6:101521258-101521280 AAGTCTATTAAAGCACATTAAGG - Intronic
1013665989 6:112348952-112348974 CACTCTAAGAAAACTAATTAAGG - Intronic
1014011674 6:116483233-116483255 AACTTTAAGAAAACATATTGTGG - Intergenic
1014155493 6:118104629-118104651 TACTTTAAAAAATCACATTAGGG - Intronic
1015395796 6:132733092-132733114 AAATCTAAGAAACACCATTCTGG + Intronic
1015455460 6:133422548-133422570 AACTCTTAGAAACCATGTTATGG + Intronic
1015755949 6:136606567-136606589 GACTTTAGGAAACCACTTTATGG - Intronic
1016299226 6:142611369-142611391 AATTCTATAAATCCACATTAGGG + Intergenic
1016553566 6:145309858-145309880 AAATCTAAGAAAGAACATTTTGG + Intergenic
1017663605 6:156697207-156697229 ATCTCTAAGAAACTACAAAAAGG + Intergenic
1017921214 6:158873803-158873825 AAATCTAACAAACCACGTAAAGG - Intronic
1020720513 7:11738898-11738920 AGCTGTAAGATACCACATTTGGG + Intronic
1023296114 7:38716749-38716771 AACTCTAAGAATATACATTTCGG - Intergenic
1027944994 7:84733266-84733288 AACTCTTAGAGGCCACAGTAGGG + Intergenic
1030594096 7:111515564-111515586 AATTCTCAGAGACCACAATAAGG - Intronic
1030986470 7:116247084-116247106 AACTATAAGAAACACCATGATGG + Intronic
1031238870 7:119212880-119212902 AAGTGTAATACACCACATTAAGG - Intergenic
1032590567 7:133188339-133188361 GACTGCAAGAGACCACATTAGGG - Intergenic
1034646220 7:152650115-152650137 AACACTGAGAAACCTAATTAGGG - Intronic
1043125929 8:76394593-76394615 AATTCTAAGACTCCATATTAAGG - Intergenic
1043264865 8:78252787-78252809 AACTCTAAAAAATTACATTTAGG + Intergenic
1043354038 8:79391791-79391813 AACTGTAAGGAACCAAATTCTGG - Intergenic
1044674721 8:94717987-94718009 AACCCTAAAAACCCACATTAGGG - Intergenic
1045456879 8:102389310-102389332 AACTCTGAGCTACCATATTAAGG + Intronic
1047825810 8:128573510-128573532 GAATTTAAGAAATCACATTAAGG + Intergenic
1048027637 8:130601366-130601388 AACTCAAAGAGACCACACCAGGG + Intergenic
1050899545 9:10929074-10929096 GACACTAAGAAACCACTTAATGG - Intergenic
1051685645 9:19655712-19655734 TCCTCTAAGAAACCACAAGAAGG + Intronic
1051788861 9:20776694-20776716 AACTCTAAAAAGCTACTTTATGG + Intronic
1053143425 9:35696256-35696278 AACTCTAGGACAGCCCATTAGGG - Intergenic
1055541794 9:77315607-77315629 TCCTCCAAGAAAACACATTAAGG - Intronic
1055992132 9:82118033-82118055 AATACTAATAAACGACATTAAGG + Intergenic
1056855340 9:90123654-90123676 AACTCAAAGAACCCACACCAAGG - Intergenic
1059577497 9:115506543-115506565 AAATCTAGGAAACAACATTCTGG - Intergenic
1187309445 X:18127069-18127091 AACTCTAAGAAACAACCAAAAGG + Intergenic
1188965946 X:36551468-36551490 AACTTTTAGAAACCACACTTTGG + Intergenic
1190364546 X:49679273-49679295 AGCTTTCAGAAACCACATAATGG - Intergenic
1190767313 X:53486214-53486236 AACTCTTAGAAACTTCATTGAGG + Intergenic
1191264259 X:58367861-58367883 CAATCTAAGAAACCACTTTGTGG - Intergenic
1193805368 X:85987380-85987402 AAATGAAAGAAACAACATTAAGG + Intronic
1194659949 X:96619872-96619894 ACCTCTATGAAAACACAGTATGG + Intergenic
1195348445 X:103975051-103975073 TTCTCTAAGAAACCTCCTTATGG - Intergenic
1195358997 X:104063789-104063811 TTCTCTAAGAAACCTCCTTATGG + Intergenic
1198710912 X:139502665-139502687 AAAACTAAGAAAACACATTATGG + Intergenic
1200779501 Y:7201610-7201632 AACTTTAAGAAGCCAAATGAAGG + Intergenic