ID: 1179337645

View in Genome Browser
Species Human (GRCh38)
Location 21:40473056-40473078
Sequence ATGTTGTTCTGGGGGAATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 191}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179337638_1179337645 14 Left 1179337638 21:40473019-40473041 CCATACGGGGCACGGATTTATTT 0: 1
1: 0
2: 0
3: 0
4: 31
Right 1179337645 21:40473056-40473078 ATGTTGTTCTGGGGGAATAAAGG 0: 1
1: 0
2: 1
3: 14
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179337645 Original CRISPR ATGTTGTTCTGGGGGAATAA AGG Intronic
900664169 1:3802994-3803016 AGGATGTTCTGGGGTAACAATGG + Intergenic
906078935 1:43071022-43071044 ATGTTTGTCTTGAGGAATAAAGG + Intergenic
907240355 1:53077670-53077692 TTGTTGTTCTGGGGGATGGAAGG - Exonic
916630635 1:166608516-166608538 ATGTTGTTCTGCGGAAGTAGTGG + Intergenic
917707494 1:177649040-177649062 ATGATGTTCAAGGGGAAAAATGG + Intergenic
921376603 1:214480798-214480820 ATTATGTGCTGTGGGAATAATGG - Intronic
921636768 1:217504758-217504780 ATCATGTTTTGGGGGCATAATGG + Intronic
922008635 1:221557948-221557970 ATGTGTTTCTTGGGGAATTAGGG - Intergenic
922181282 1:223234929-223234951 ATGTTGTTCTCCTGCAATAAAGG - Intronic
923648902 1:235853525-235853547 CAGTAGTTCTGGGGGAAGAATGG + Intronic
924190229 1:241543800-241543822 TTGTTTTTATGGGAGAATAAGGG - Intronic
924355223 1:243166224-243166246 TTGGTATCCTGGGGGAATAAGGG - Intronic
1064432757 10:15285423-15285445 ATGTGGCTCTGGGTGAAGAATGG + Intronic
1069181098 10:65359349-65359371 ATGGTGTTCTGGGGTATTACAGG + Intergenic
1071330609 10:84555283-84555305 GTCTAGTTCTGTGGGAATAAGGG - Intergenic
1072160877 10:92765238-92765260 ATGTAGTGCTGGGGACATAAAGG + Intergenic
1073409475 10:103328430-103328452 ATGCTGTACTGTGGTAATAACGG - Intronic
1073644948 10:105292228-105292250 ATTTTGTTCTGGAGGAAACACGG + Intergenic
1076028206 10:127134731-127134753 ATGTTCTTCAGGGAGAAGAAGGG - Intronic
1079698791 11:23518457-23518479 ATGTTGTTTTGGGGGGAAATAGG - Intergenic
1085997804 11:81942722-81942744 ATATTGAACTCGGGGAATAAAGG - Intergenic
1087670583 11:101101631-101101653 ATGTTGTTTTGGTGGAAGCATGG - Intronic
1088533563 11:110836640-110836662 ATGCTGTTCTGGTCAAATAAGGG - Intergenic
1092715578 12:11386218-11386240 TTGTTGCTGTGGTGGAATAAAGG + Intronic
1093235325 12:16603416-16603438 ATGTTCTTCTGGTGGAAGAGGGG - Intronic
1093262516 12:16956913-16956935 ATATTGTACTAGGGGAGTAAAGG - Intergenic
1093268789 12:17031995-17032017 ATGTTGTTCTGTAGGAATTAGGG - Intergenic
1096237518 12:49939799-49939821 ATGTTGCTCCGGGGGACTACTGG + Intergenic
1096626366 12:52898559-52898581 CTGTTGTTCTGGGCCAAGAAGGG - Intronic
1097728387 12:63100025-63100047 ATGTTGTTCTGTGGAAGAAATGG - Intergenic
1098580650 12:72094939-72094961 TTATTGCTGTGGGGGAATAAAGG + Intronic
1098914932 12:76247521-76247543 ATGCTGTTCTGTGGGAATTAGGG - Intergenic
1101915153 12:108890103-108890125 ATGTTGTTCTGTGGGCCCAAAGG - Intronic
1104203296 12:126613232-126613254 ATGCAGTTTTGGGGGAACAATGG + Intergenic
1106224791 13:27776938-27776960 ATGATGTTTTGGGAGAATAAAGG + Intergenic
1107093599 13:36511209-36511231 AGGTTGTTTTGGGGGTAGAAAGG - Intergenic
1111226237 13:85274815-85274837 CTATGGTTCTTGGGGAATAAGGG - Intergenic
1112504425 13:99967823-99967845 GTGTTGTTCAGGGGGCCTAAGGG + Intronic
1114876193 14:26721674-26721696 TTGCTGTTCTGTAGGAATAAAGG + Intergenic
1115257054 14:31414561-31414583 CTGATGTGCTGGAGGAATAATGG - Intronic
1115760513 14:36576338-36576360 ATGTTTTTCTGGAAGAAGAATGG + Intergenic
1115877881 14:37881056-37881078 TTGTTGCTCTGGGGGAAAAAGGG - Intronic
1115896208 14:38090561-38090583 GTGATGTTCTGTGGTAATAACGG + Intergenic
1120211605 14:81639273-81639295 AAGTTGTTATTGGGGAGTAAAGG + Intergenic
1120510522 14:85408231-85408253 ATGTTATTCTAGAGGAAAAATGG + Intergenic
1122332020 14:100925913-100925935 ATGTTGTTCTAAGGGAATAAAGG + Intergenic
1126070857 15:44863746-44863768 AGGTTGTGCTGGAGGCATAAAGG + Intergenic
1126238400 15:46412560-46412582 TTGTTGTTCTGAGAGATTAAAGG + Intergenic
1129205259 15:74033522-74033544 ATCTTATTCAGTGGGAATAAGGG - Intronic
1130698698 15:86157150-86157172 AGGTATTTCTGGGGGAATAATGG + Intronic
1131678750 15:94699744-94699766 CTGTTGTTTTTGGGGAGTAAAGG + Intergenic
1132967005 16:2662334-2662356 AGGATGTTCTGGGGTAAAAAAGG + Intergenic
1134211326 16:12279873-12279895 CTGTTCCTCTGGGGGAACAAGGG + Intronic
1136704274 16:32173087-32173109 ACGTGGTTCTGGGAGAAGAAAGG - Intergenic
1136763636 16:32756319-32756341 ACGTGGTTCTGGGAGAAGAAAGG + Intergenic
1136804463 16:33114067-33114089 ACGTGGTTCTGGGAGAAGAAAGG - Intergenic
1140680939 16:77383958-77383980 AGGCTGTTATGGGGGAAAAAAGG - Intronic
1203065785 16_KI270728v1_random:1016640-1016662 ACGTGGTTCTGGGAGAAGAAAGG + Intergenic
1142934199 17:3313483-3313505 ATATTGTTCCAGGGGATTAATGG - Intergenic
1146260607 17:31417756-31417778 TTGTTGCTGTGGGGGAATATGGG + Intronic
1147837004 17:43340457-43340479 AGGATGTTCTGGGGTAACAATGG + Intergenic
1149160655 17:53688075-53688097 ATGTCTTTGTGGAGGAATAATGG + Intergenic
1149186927 17:54009096-54009118 GTGTTTTTCTGGGGGAAAGAAGG - Intergenic
1149280609 17:55101232-55101254 ATATTCTTCTGTTGGAATAAGGG + Intronic
1149430593 17:56593585-56593607 TTGTTGTTTGGGGGGAAGAAGGG + Intergenic
1155183826 18:23370640-23370662 CTGTAGTCCTGGGGGAAAAACGG - Intronic
1155797035 18:30052560-30052582 ATTTTGTTCTGTGTGAATATAGG - Intergenic
1159063494 18:63542095-63542117 AAGTTGTTTAGGGAGAATAAGGG + Intergenic
1159485881 18:69056590-69056612 ATGGTGTGCTGGGGAAATAGAGG + Intergenic
1160910579 19:1472046-1472068 AGGTTGTTTTGGGGGAAGAGGGG + Exonic
1161357059 19:3825067-3825089 ATCTTGCTCTGCAGGAATAAGGG + Intronic
1164456275 19:28409961-28409983 AGGTTGTTGTGGGGTAAAAATGG - Intergenic
1166966421 19:46531881-46531903 ATGTTGTCCAGGTGGAAGAAGGG + Intronic
925758956 2:7165740-7165762 AAGTGGTTCTCAGGGAATAAAGG + Intergenic
926977394 2:18528965-18528987 ATGCAGTTCTAGGGGCATAAGGG + Intergenic
929117759 2:38458501-38458523 GAGTTGTTTTGGGGGAAAAAAGG - Intergenic
930535866 2:52645358-52645380 ATGTTATTATGGGAAAATAATGG + Intergenic
931685242 2:64786860-64786882 CTGGTGTTTTGGGGGAATGAGGG + Intergenic
931952868 2:67384912-67384934 ATACTTTTCTGGGGGAATATAGG - Intergenic
932311040 2:70741399-70741421 GTGGTGCTCTGGGAGAATAAAGG + Intronic
933448313 2:82411702-82411724 ATGGTTTCCTGGAGGAATAACGG + Intergenic
934612722 2:95752974-95752996 ATGGACTTTTGGGGGAATAAGGG - Intergenic
934687559 2:96333039-96333061 AGGCTGTTCTGTGGGAATAATGG - Intergenic
936479975 2:112877133-112877155 ATGTAATTCTGGGGGTACAATGG + Intergenic
936863144 2:117046100-117046122 ATGTTGTTGAGGGGGAACAATGG + Intergenic
938164725 2:129016705-129016727 AGCTTGTTCTGGGGGAAAATAGG + Intergenic
938311878 2:130295997-130296019 ATATTGTTGTGGGAGAATGATGG + Intergenic
939054395 2:137345960-137345982 TTGTTGTGGTGGGGGAATAGGGG + Intronic
939379876 2:141421129-141421151 ATGTTTTTGTGGAGGAACAAGGG + Intronic
940450532 2:153829905-153829927 ATTTTGTTTTGAGGGAATAGTGG + Intergenic
943868097 2:192955327-192955349 AAGTTGTTGTGGGAGAATGAGGG - Intergenic
945165277 2:206936622-206936644 ACATTGTTCTAGGGGAAAAAGGG - Intergenic
946192301 2:218013957-218013979 TTGCTTCTCTGGGGGAATAAGGG - Intergenic
946870119 2:224077267-224077289 ATGCTGTTCTGGTGGGATGATGG - Intergenic
948292741 2:236838480-236838502 ATGTGGCTTTGGGGGAAAAAAGG - Intergenic
1170974363 20:21148627-21148649 ATGTTCTTCTGGTTGAAGAACGG + Intronic
1172966960 20:38842912-38842934 TTGCTGTTCAGGGGGAATATGGG - Intronic
1175711807 20:61227282-61227304 ATGTTGATGTGGGGGAAGGAGGG - Intergenic
1177960523 21:27660692-27660714 ATTTTGTTCTGGGGGGCTAGTGG + Intergenic
1178066707 21:28912392-28912414 ATTTAGTTCAGGGGAAATAAGGG - Intergenic
1179337645 21:40473056-40473078 ATGTTGTTCTGGGGGAATAAAGG + Intronic
1180990647 22:19933744-19933766 ATGCTGTTCTGTGGGAGGAAGGG + Intronic
1182810465 22:33111821-33111843 ATGTGCTTCTGGAGGAATTATGG + Intergenic
949236903 3:1819975-1819997 ATGTCGTTCTGGTGAAAGAAGGG - Intergenic
949561380 3:5205820-5205842 ATTTTGATCTGGGTGACTAATGG - Intronic
949936253 3:9118600-9118622 ATGTTTTTCTGGGGAATAAATGG - Intronic
952183263 3:30941778-30941800 ATGCTGTTGTGGGGGCATAGTGG - Intergenic
952295736 3:32060531-32060553 TTATTGCTCTGGGAGAATAAAGG - Intronic
955814369 3:62826415-62826437 ATGTTATTGTTGGGGAAAAATGG + Intronic
958263484 3:91409275-91409297 ATGTTGCTCTGTGGGAAGTAGGG + Intergenic
960821533 3:121738326-121738348 CTGTTTTTATGTGGGAATAAAGG - Intronic
962885579 3:139622917-139622939 AAGTTGCTCTGGGTGAATCAAGG + Intronic
964336525 3:155660533-155660555 ATGTTTTTCAGGGGCAAAAATGG - Intronic
964491571 3:157241853-157241875 ATGTTGTTGATGGGGAAAAAGGG + Intergenic
965643803 3:170859008-170859030 AGGATGTTCTGGGGTAACAAAGG - Intronic
967664956 3:192160000-192160022 ATGATGAACTGGGCGAATAATGG - Intronic
969753099 4:9128090-9128112 ATGTTGTTCTGCAGAAGTAATGG - Intergenic
971343066 4:25788327-25788349 ATGCTGTTCTGGGGGCAGCAAGG - Exonic
971747427 4:30601700-30601722 ATGTTTTCTTGGGTGAATAAAGG - Intergenic
972501417 4:39681365-39681387 ATGTTGTTCTTTGGGTATCAAGG + Intergenic
973231279 4:47841753-47841775 ATGTGGTTCTGTGGAAATAAAGG + Intergenic
973337092 4:48967677-48967699 AACTTGTGCTGGGTGAATAAAGG - Intergenic
974213174 4:58809415-58809437 ATGTTGTTTTGGGACAATGAGGG + Intergenic
975377977 4:73667491-73667513 AGGATGTTCTGGGGTAACAATGG + Intergenic
977239153 4:94545426-94545448 ATGTTTTTCCGGGGGAAAAAAGG + Intronic
977275167 4:94968534-94968556 ATGTGTTTATGGGGGAATATTGG + Intronic
978953129 4:114585220-114585242 CAGTTGTTCTGGGGTAAAAAAGG + Intergenic
980193321 4:129554392-129554414 ATTTTTTTCTAAGGGAATAATGG + Intergenic
982694436 4:158583294-158583316 AAGTTGTACTTGGGAAATAATGG - Intronic
983854796 4:172630688-172630710 ATGTTGAGTTGGAGGAATAAAGG - Intronic
983917501 4:173308218-173308240 TTTTAGTTGTGGGGGAATAAAGG + Intronic
984278285 4:177636629-177636651 ATGTTTTTGTGTGGGTATAATGG + Intergenic
984815003 4:183827911-183827933 AGGTTATACTGGGGCAATAAAGG - Intergenic
986832241 5:11592720-11592742 ATGCTTTTCTGGGGGGGTAAGGG + Intronic
987045434 5:14103323-14103345 GTGCAGTTTTGGGGGAATAAGGG - Intergenic
988918440 5:35919534-35919556 ATGTTGTGCAGGGGGGATGATGG + Intronic
989581784 5:43040248-43040270 ATGTTTTTCTGTCGGAATTACGG - Exonic
990949946 5:61288788-61288810 ATATAGTCCTGGGTGAATAAGGG - Intergenic
993053710 5:82955318-82955340 CTGAGGATCTGGGGGAATAAAGG + Intergenic
996197779 5:120631480-120631502 GTGTTGTTATGGGGGCACAATGG + Intronic
996374210 5:122786946-122786968 GTGATGGTGTGGGGGAATAAAGG + Intronic
996628653 5:125601201-125601223 ATGTTTTGCTGAGGGAAGAAAGG - Intergenic
996903048 5:128565833-128565855 ATGTTGTTCCAGGAGAATTATGG - Intronic
997148919 5:131470481-131470503 ATGTGGGGCTGAGGGAATAAGGG - Intronic
997414489 5:133714677-133714699 ATGGTGTTCTGGGAGAGTAAAGG - Intergenic
1005278797 6:24248247-24248269 ATGGTGTCCTGTGGTAATAATGG - Intronic
1005969376 6:30749296-30749318 ATGGTGATCTGGGGGAAGATGGG - Intergenic
1007351307 6:41275509-41275531 ATCTTCTTCTGGGGAAATACTGG - Exonic
1008865207 6:56202270-56202292 TTGTTTTTCTGGAGGAAAAAGGG + Intronic
1008991950 6:57613702-57613724 ATGTTGCTCTGTGGGAAGTAGGG - Intronic
1009180551 6:60512650-60512672 ATGTTGCTCTGTGGGAAGTAGGG - Intergenic
1010211545 6:73366329-73366351 ATTTTGTTATTGGGGAAAAAGGG - Intergenic
1010734072 6:79422970-79422992 ATATTTTTCCTGGGGAATAAAGG + Intergenic
1010831112 6:80530714-80530736 GTGTTGTTCTGGAGAAATCACGG + Intergenic
1011309970 6:85970935-85970957 ATGTTTTGCTGGAGAAATAAGGG - Intergenic
1014510447 6:122314660-122314682 ATCTTGTTAGGGGAGAATAATGG - Intergenic
1014683770 6:124469055-124469077 ATGGTGTTCTCTGGGAATATGGG - Intronic
1014845231 6:126267834-126267856 TTGTTTTTCTGGGTGATTAAGGG + Intergenic
1015357123 6:132291561-132291583 ATGTTGTACTGTGGTAATTATGG - Intergenic
1015505837 6:133986761-133986783 ATTTTGTTCTGGGCAATTAAAGG - Intronic
1019831952 7:3339566-3339588 AATTTGTTCTGTGGCAATAATGG + Intronic
1020595787 7:10205327-10205349 AAGGAGTTTTGGGGGAATAATGG + Intergenic
1021287065 7:18793508-18793530 ATGTTGTTATGTGGGAATTGCGG + Intronic
1022230220 7:28406863-28406885 ATGTGGGGCTGGGGGAATTATGG + Intronic
1023755184 7:43409580-43409602 ATTTTGTTCTGGCAGAATACTGG + Intronic
1024487875 7:49940545-49940567 ATGTTTTCATGGGGGAATGAGGG - Intronic
1027635411 7:80666596-80666618 ATTTTGTTGTGGGGATATAAAGG - Intronic
1028769719 7:94604093-94604115 TTGTTGGTTTGGGGGAATTATGG + Intronic
1028821777 7:95219910-95219932 GTGTTGTCCTGGAGAAATAAGGG + Intronic
1029345772 7:99977447-99977469 AGGATGTTCTGGGGTAACAAAGG - Intergenic
1029835137 7:103301481-103301503 CTGTTGTTCTGTGTAAATAAAGG - Intronic
1033374762 7:140747655-140747677 ATATTTTTCTGGAGGAATTATGG - Intronic
1033403091 7:141045994-141046016 ATGTTTTTCTTGGGGAGTCATGG + Intergenic
1033937285 7:146602924-146602946 ATGCTGTTATCTGGGAATAACGG - Intronic
1036671561 8:10791914-10791936 ATGTTGTCCTGGGGGTCTCAGGG - Intronic
1036688168 8:10925234-10925256 CTGTTGTTCTGGAGGAGGAAAGG + Intronic
1036770259 8:11574105-11574127 ATGTTTATCTTTGGGAATAAGGG - Intergenic
1039018441 8:33179240-33179262 ATCTTTTTATGGTGGAATAATGG - Intergenic
1040771568 8:50983574-50983596 ATGATGGACTGGGAGAATAATGG + Intergenic
1043916013 8:85922813-85922835 ATATAGTTCTGAGGGAATCAGGG - Intergenic
1044161694 8:88925714-88925736 ATGTAGGTCTAAGGGAATAAAGG + Intergenic
1045440724 8:102207252-102207274 ATATTTTTTTGGGGGAAAAAGGG - Exonic
1048357262 8:133663805-133663827 ATGTTGTTCTGGTTGAATCATGG + Intergenic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1049054628 8:140226105-140226127 ATGTGGTTCTGGTGGGATCAAGG + Intronic
1049588845 8:143445880-143445902 ATGTATTTCTGGGAGAATAATGG + Intronic
1049881182 8:145064734-145064756 AGGATGTTCTGGGGTAACAAAGG - Intergenic
1052488273 9:29130534-29130556 TTTTTGCTCTGGGGGAATTATGG - Intergenic
1053239058 9:36481690-36481712 ATGCTGTTCTGGGGGCTCAAGGG - Intronic
1053507656 9:38657470-38657492 ATGTTGTTTTTGGGGAAGAATGG + Intergenic
1053522149 9:38791200-38791222 ATGTCTATCTGGGGGAAGAAAGG - Intergenic
1054194373 9:62015664-62015686 ATGTCTATCTGGGGGAAGAAAGG - Intergenic
1054644034 9:67573026-67573048 ATGTCTATCTGGGGGAAGAAAGG + Intergenic
1054880836 9:70142952-70142974 ATGTTGTTTAGGAGGAATAAAGG + Intronic
1056091367 9:83208757-83208779 AAGTTGTTCTGGGAGCTTAAAGG + Intergenic
1057893523 9:98887944-98887966 ATATTATTCAGGGGGAAAAATGG - Intergenic
1059888961 9:118779650-118779672 AAGTTGATCTGGGGAAAAAAGGG + Intergenic
1189638346 X:43037687-43037709 GAGATGTTTTGGGGGAATAAGGG - Intergenic
1192614882 X:72609258-72609280 ATGCTGCTCATGGGGAATAAAGG - Intronic
1193902963 X:87205123-87205145 ATGTTTCTGTGGGGAAATAAGGG - Intergenic
1194901421 X:99516191-99516213 ATGTTGTTCTTGAACAATAATGG - Intergenic
1195021327 X:100831702-100831724 ATTTTGTTCTCAGGGAAGAAGGG - Intronic
1196606008 X:117657856-117657878 ATGTTTCTATGGGGGAATGAGGG - Intergenic
1196968764 X:121086299-121086321 AAGATGCTTTGGGGGAATAAAGG - Intergenic
1197017161 X:121639030-121639052 ATGTTTTACTGGGAAAATAAAGG - Intergenic
1198314016 X:135448985-135449007 TTGTTGTTTTGGAGGAAAAAAGG - Intergenic
1202039581 Y:20668034-20668056 ATGTAGTTCTGGGGGCATTTGGG - Intergenic