ID: 1179338455

View in Genome Browser
Species Human (GRCh38)
Location 21:40481009-40481031
Sequence CCTGAAATGCTGCAGCTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 1, 2: 4, 3: 36, 4: 261}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179338446_1179338455 14 Left 1179338446 21:40480972-40480994 CCATGCTTTTGCCCTCTGGGCCT 0: 1
1: 0
2: 3
3: 42
4: 376
Right 1179338455 21:40481009-40481031 CCTGAAATGCTGCAGCTAGAAGG 0: 1
1: 1
2: 4
3: 36
4: 261
1179338450_1179338455 -6 Left 1179338450 21:40480992-40481014 CCTAGGATGCCCTACACCCTGAA 0: 1
1: 0
2: 1
3: 8
4: 112
Right 1179338455 21:40481009-40481031 CCTGAAATGCTGCAGCTAGAAGG 0: 1
1: 1
2: 4
3: 36
4: 261
1179338448_1179338455 3 Left 1179338448 21:40480983-40481005 CCCTCTGGGCCTAGGATGCCCTA 0: 1
1: 0
2: 3
3: 10
4: 138
Right 1179338455 21:40481009-40481031 CCTGAAATGCTGCAGCTAGAAGG 0: 1
1: 1
2: 4
3: 36
4: 261
1179338449_1179338455 2 Left 1179338449 21:40480984-40481006 CCTCTGGGCCTAGGATGCCCTAC 0: 1
1: 0
2: 0
3: 14
4: 133
Right 1179338455 21:40481009-40481031 CCTGAAATGCTGCAGCTAGAAGG 0: 1
1: 1
2: 4
3: 36
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179338455 Original CRISPR CCTGAAATGCTGCAGCTAGA AGG Intronic
901649227 1:10733892-10733914 CATGAAATAATGCAGCTAAAGGG + Intronic
903262777 1:22140261-22140283 ACTGAAAAGCTGCCTCTAGAAGG - Intronic
903754611 1:25652180-25652202 CCTGACATGCGGCAGCAGGAAGG - Intronic
904039819 1:27577332-27577354 CCTGCCGTGCGGCAGCTAGAGGG + Intronic
904798596 1:33076589-33076611 CATGAAATTATGCAGCAAGAAGG - Intronic
905987842 1:42303450-42303472 CCAGAAATGAGGCAGCAAGAAGG + Intronic
907233087 1:53019095-53019117 CCAGATATGATGCACCTAGAAGG - Intronic
907615817 1:55925688-55925710 CCTGAAATGTTGGGGATAGAGGG - Intergenic
908418228 1:63934018-63934040 CCTGCAAAGCAGCAGCTAGCTGG - Intronic
908544581 1:65149888-65149910 CTTGAAATGCTGCGGTTTGAGGG + Intronic
909293156 1:73910635-73910657 CCTCAAATGCTGTAGCTAGTTGG + Intergenic
909707818 1:78608088-78608110 CCTGCTACGCTGCAGCTTGATGG + Intergenic
909815469 1:79986961-79986983 CCTTAAATTATGAAGCTAGAGGG - Intergenic
910915117 1:92279876-92279898 CCTGCGAGGCTGCAGCTAGACGG + Intronic
911261107 1:95686879-95686901 CCTGAAATACTGCTGCTATTAGG + Intergenic
911571469 1:99522515-99522537 CATGAAATGATGCAGCAAGAAGG - Intergenic
915077352 1:153320122-153320144 CCTGGAATGCTGGAGCTTGCTGG - Intergenic
915335873 1:155140756-155140778 CCTTAAATGTTGCAACAAGATGG + Intergenic
915625507 1:157111830-157111852 CCTGGAATGCTGCATCCGGAGGG + Intergenic
918138068 1:181694588-181694610 CATGAGATGATGCAGCAAGAAGG + Intronic
918497344 1:185156231-185156253 GCAGGAATGCTGCAGATAGAAGG - Intronic
920208095 1:204307721-204307743 CAGGAGTTGCTGCAGCTAGAGGG - Intronic
920701353 1:208219999-208220021 CCTTAAATTCTCCAGCTGGATGG + Intronic
920813998 1:209313977-209313999 CATGAAGTCCTGCAGCAAGAAGG + Intergenic
921668573 1:217901720-217901742 CCTGAAATCATGAAGCTAAAGGG - Intergenic
922007248 1:221543869-221543891 TGTGAAATGTTGGAGCTAGAGGG - Intergenic
924262808 1:242249293-242249315 CATGAAATGGTACAGCAAGAAGG + Intronic
924940092 1:248807182-248807204 CCTGAAAAACTGCACATAGAAGG - Intergenic
1062887346 10:1027643-1027665 CCTATAATGCTGCAGGTAGGAGG + Intergenic
1064492879 10:15878263-15878285 CCTGCAACGCTGCAGCTTGGTGG - Intergenic
1064924630 10:20556203-20556225 CCGCAAATGCTGCTGCTTGATGG - Intergenic
1065564362 10:26994216-26994238 CCTCAAAAGGTCCAGCTAGAAGG + Intronic
1066725430 10:38387637-38387659 CATGAAATGGTACAGCAAGAAGG - Intergenic
1067325905 10:45266191-45266213 CCTGAGATGCTGCAGATTGGCGG + Intergenic
1067999435 10:51314334-51314356 CCTGAAATGCTGGAGTTGGCAGG + Intronic
1068265940 10:54649910-54649932 CATAAAATGCGTCAGCTAGAAGG - Intronic
1068382040 10:56267522-56267544 CATGATATGATGCAGCAAGATGG + Intergenic
1069895543 10:71678248-71678270 CAGGAAGTGCTGCAGCTGGAAGG + Intronic
1069933141 10:71896994-71897016 CCTGAAGTGCTCCAGCTAGCAGG + Intergenic
1070145281 10:73769406-73769428 CCTGAACTGCTGCACCCAGCTGG + Exonic
1071013181 10:80963363-80963385 CATGGAATGATGCAGCAAGAAGG - Intergenic
1071341302 10:84651499-84651521 CCTGGAATGCTCCAGCTTGGTGG - Intergenic
1071758463 10:88572917-88572939 CCTGAGATTCTGCAGCTTCAAGG - Exonic
1074423590 10:113331007-113331029 CCTGGGATGATGCAGCAAGAAGG - Intergenic
1079017396 11:16880886-16880908 CTTAAAATGCTACAGCTGGAGGG - Intronic
1079749368 11:24177817-24177839 CCAGAAATCCTACAGCTAGGAGG - Intergenic
1080501497 11:32875504-32875526 CCTGAGATGATGCAGCAAGAAGG + Intergenic
1082216631 11:49578367-49578389 CCTGATCTTCTGAAGCTAGAAGG - Intergenic
1083310063 11:61779484-61779506 CCTGCATGGCTGCAGCAAGAGGG - Exonic
1083447632 11:62719866-62719888 CATGGAATGATGCAGCAAGAAGG + Intronic
1085773544 11:79345629-79345651 CCTGAACTCCTACAGCTAAATGG - Intronic
1085811793 11:79689679-79689701 CATGAAATGATGCAGATAGCAGG + Intergenic
1087003455 11:93444794-93444816 CCTGTGATGCTGCAGCTTGGTGG - Intergenic
1088733489 11:112705441-112705463 CTTGAACTTCTGCAGATAGATGG + Intergenic
1089149161 11:116351414-116351436 CAGGAAATGCTGGAGCTATATGG + Intergenic
1089416425 11:118296010-118296032 CCTCATCTCCTGCAGCTAGAGGG + Intergenic
1089726151 11:120482147-120482169 CCTGAAATGCTTCGGGTAGTTGG + Intronic
1090326235 11:125888213-125888235 CCACAAAAGGTGCAGCTAGAAGG - Intronic
1090393357 11:126403726-126403748 CCTGAAATGTTAGAGCTGGAGGG + Intronic
1092304367 12:7283843-7283865 CCTGGGATGCTCCAGCTTGATGG + Intergenic
1092949244 12:13485861-13485883 CCTGAGGTCATGCAGCTAGAAGG - Intergenic
1093416610 12:18927777-18927799 ACTCAAATCCTGCAGCTAAAAGG + Intergenic
1093592595 12:20921625-20921647 TCTGAAATGCTGCAAGTACATGG - Intergenic
1095830955 12:46586056-46586078 CCTGCCTTGCTGCAGCTGGATGG - Intergenic
1097429483 12:59486893-59486915 CTTGAAATGCTCCAGCTGCAAGG + Intergenic
1097443286 12:59637930-59637952 CATGAAATGATGCAGCAGGAAGG + Intronic
1098770848 12:74551318-74551340 CCTGACATGCTGTACATAGAAGG + Intergenic
1099012804 12:77312201-77312223 CCTGAGATGATGCTGCCAGAGGG - Intergenic
1100075138 12:90771315-90771337 CATGTCATGCTGCAGCAAGAAGG - Intergenic
1100397469 12:94197496-94197518 CATGGAATGATGCAGCAAGAAGG + Intronic
1100900802 12:99238319-99238341 CATGCAATGCTGCAGCTTGACGG + Intronic
1101867542 12:108532027-108532049 TCTCAAATTCTGCAGCTACAAGG - Intronic
1102571917 12:113831901-113831923 CCTGCACTGCTGCAGGGAGAAGG + Intronic
1106697867 13:32197439-32197461 CCTGAAATACTCCAGATGGATGG - Intronic
1108164622 13:47679112-47679134 CCTGAGATGCTCCAGTTGGAGGG - Intergenic
1109945433 13:69425436-69425458 CCAGAAACCCTACAGCTAGAAGG + Intergenic
1110591499 13:77267858-77267880 CCTGAAACACTGGAGCAAGATGG - Exonic
1110767645 13:79299244-79299266 CCTAAACTTCTGCAGCTAGTGGG - Intergenic
1110826316 13:79975351-79975373 CCTGGAATGCTGGAGCTTGGTGG + Intergenic
1110860049 13:80338512-80338534 CCTTAGATTCTGCAGCTAAAAGG + Intronic
1111206222 13:85014248-85014270 CATGGAATCCTGCAGCAAGAAGG + Intergenic
1112115757 13:96351434-96351456 CCTGAGAAGCTGGAACTAGAGGG + Intronic
1112458748 13:99584582-99584604 CCTGCAATACTGCAGCTGGTGGG - Intergenic
1114342578 14:21760462-21760484 CCTGCGATGCTGCGGCTTGATGG + Intergenic
1115365721 14:32554792-32554814 CCTGAAATGCTTCACTGAGATGG - Intronic
1115530229 14:34320284-34320306 CCTCTAATGCAGCAGCCAGAAGG - Intronic
1115931560 14:38502580-38502602 CCCGAAATTCTGCATCTGGAAGG + Intergenic
1118700195 14:68425533-68425555 CATGCAATGATGCAGCAAGAAGG + Intronic
1119406336 14:74401938-74401960 CCTGGAACGCTGCAGCAGGAAGG - Intergenic
1121125311 14:91403040-91403062 CCTGAAATGCTACAGTTGCATGG - Intronic
1122184864 14:99984106-99984128 CCTGAAATGCTGTCCTTAGAAGG - Intronic
1122929142 14:104925505-104925527 CCTTAAATGCTCCAGGCAGACGG - Intronic
1124244895 15:28060268-28060290 CCTGCAGTGCCCCAGCTAGAGGG - Intronic
1126765198 15:52004631-52004653 CATGAGATGATGCAGCAAGAAGG - Intronic
1127570619 15:60237565-60237587 CCTGTGATGCTGCAGCTGGATGG + Intergenic
1128134121 15:65250077-65250099 GGTGCAAGGCTGCAGCTAGAGGG - Intronic
1128291589 15:66482443-66482465 CCAGGTATGCTGCAGTTAGAAGG - Intronic
1129176373 15:73842453-73842475 CCTGAAAAGAGGCAGCAAGAGGG + Intergenic
1130827821 15:87567510-87567532 CCTGAACTCCTCCAGCTAAAAGG + Intergenic
1131175952 15:90209977-90209999 GCTGCTATGCTGCAGCCAGAGGG - Intronic
1131419258 15:92290537-92290559 CCTGCACTGCAGCAGCTTGAGGG - Intergenic
1133774548 16:8886597-8886619 CCTGTAAGGCTGCAGCTGTACGG - Intergenic
1134260360 16:12646377-12646399 TCTGAAATGTTAGAGCTAGAAGG - Intergenic
1134359599 16:13518852-13518874 CATGGAATGATGCAGCAAGAAGG - Intergenic
1135678905 16:24440362-24440384 CATGAAATGCAGTAGCAAGAAGG + Intergenic
1136126659 16:28187970-28187992 CCTAAGATGTAGCAGCTAGAAGG + Intronic
1136511021 16:30738411-30738433 CCTGACATGCTGCGGACAGACGG - Exonic
1137952122 16:52793332-52793354 ACTGAAATGCAGCAGTTGGAAGG + Intergenic
1139598023 16:67969150-67969172 CAGGAGAGGCTGCAGCTAGAGGG - Intronic
1140207876 16:72948265-72948287 CCTGAAATGGTGCATCTGGCCGG - Intronic
1142103471 16:88288632-88288654 TCTAGAATGCTGGAGCTAGACGG + Intergenic
1142288180 16:89179984-89180006 CCTGAAATGAGGCTGCAAGACGG + Intronic
1143100992 17:4504652-4504674 CCTGAAATCTTGAAGGTAGAAGG + Intronic
1144366017 17:14545590-14545612 CCTGCAGTGCTGCAGCTCGTAGG + Intergenic
1144596900 17:16577521-16577543 CATGGAATGATGCAGCAAGAAGG - Intergenic
1144891419 17:18496432-18496454 CCTGAGACGCTGCTGCTGGAAGG + Intergenic
1145140802 17:20447885-20447907 CCTGAGACGCTGCTGCTGGAAGG - Intergenic
1145809512 17:27756115-27756137 CCTGAGATGCTACTGCTAGAAGG + Intergenic
1145892259 17:28425458-28425480 CCTGCAAGGCTGCAGCCAGTGGG + Intergenic
1147917593 17:43898083-43898105 CCTGAGTGGCTGCAGGTAGAGGG - Intronic
1149192971 17:54086040-54086062 CCTGAAATGCTGCAGCTGGATGG + Intergenic
1152153289 17:78616322-78616344 CCTCTAATGCTTCAGCCAGAGGG - Intergenic
1156115300 18:33780308-33780330 CCTGAAAAGCTACTGCTAAATGG - Intergenic
1156146864 18:34192936-34192958 CATGAAATGATGCAGCAAGAAGG + Intronic
1156554648 18:38053463-38053485 ACTGAAGTGCTCCAGCCAGAAGG + Intergenic
1156910623 18:42407737-42407759 CCTGCAATGATGCAGCAAGAAGG - Intergenic
1164278714 19:23749012-23749034 TCTGCAATGCAGGAGCTAGAAGG + Intronic
1165580682 19:36860665-36860687 CCTGAGATGATGCAGCAAGAAGG - Intronic
1165735845 19:38175080-38175102 CCCGAAATGATGTAGCTAGTGGG - Intronic
1168136855 19:54357535-54357557 CCTGAAGCCCTGCAGCTAGCGGG + Intronic
1168170538 19:54585515-54585537 CCTGCGATGCTGCAGCTGGATGG - Intronic
925686801 2:6481444-6481466 CCTGTCATGCTGATGCTAGAGGG + Intergenic
927393261 2:22620295-22620317 CCTGTAATGCTGCAGCGGGCTGG + Intergenic
930014736 2:46962566-46962588 CCTGGAGGGATGCAGCTAGAGGG + Intronic
931092267 2:58898965-58898987 CTTGAAATTCTGCAGTAAGAAGG + Intergenic
931306562 2:61034728-61034750 CCAGCAACGCTGCAGCTTGATGG + Intronic
931721673 2:65071673-65071695 GCAGAGATGCTGCAGCTGGAAGG - Exonic
932868706 2:75374624-75374646 CCTGTGATACTGCAGCTGGATGG - Intergenic
933648736 2:84832164-84832186 CCTGAAATGCTGCAGCTCTCAGG + Intronic
934546875 2:95224942-95224964 CATGGAATGATGCAGCAAGAAGG + Intronic
936649865 2:114413724-114413746 CCTGCGATGCTGCAGCTGGATGG - Intergenic
936798553 2:116237360-116237382 CCTGAATTACTGCAGTCAGATGG + Intergenic
940687839 2:156876293-156876315 CCTGAAATGTGGAAGCTATAGGG + Intergenic
941486177 2:166085358-166085380 CTTGAGCTGCTGCAGCCAGAAGG + Intronic
942084867 2:172434297-172434319 CCTGAACTGGGGCAGGTAGATGG + Intronic
942250812 2:174046396-174046418 CATGTGATGCTGCAGCAAGAAGG - Intergenic
946157886 2:217818751-217818773 ACTGAAGTGCTGCAGAGAGATGG + Exonic
947440589 2:230117840-230117862 CCTGCGATGCTGCAGCTTGATGG - Intergenic
947799489 2:232919768-232919790 CCTGAAATGCTGCAGAAATCTGG - Intronic
948204187 2:236153565-236153587 ACTGAAATGGTGCAGTTAGATGG - Intergenic
1169861694 20:10159457-10159479 CCTGCAATGCTGCAGCTTGATGG + Intergenic
1170985218 20:21251631-21251653 CCTGACATGCTGCCGGGAGACGG + Intergenic
1173650239 20:44659174-44659196 CATGGAATGATGCAGCAAGAAGG - Intergenic
1175641045 20:60630712-60630734 CCTGCAAGGTTGCAGCTGGAAGG + Intergenic
1175965809 20:62659699-62659721 CCTGCAAGGCTGCAGCCAGGCGG - Intronic
1177425891 21:20922391-20922413 CCTGGAATGCTCCAGCTTGGTGG + Intergenic
1178507709 21:33176513-33176535 CATGGAATGGAGCAGCTAGAGGG - Intergenic
1178951076 21:36986206-36986228 CATGAGATGATGCAGCCAGAAGG + Intronic
1179033911 21:37743628-37743650 CATGAAATGATGCAGCAAGAAGG + Intronic
1179338455 21:40481009-40481031 CCTGAAATGCTGCAGCTAGAAGG + Intronic
1182425247 22:30268137-30268159 CCTGAGCTGCTCCAGCTGGAGGG + Intergenic
1182817518 22:33178978-33179000 CCTGTTATGATGCAGCAAGAAGG - Intronic
1184106227 22:42368897-42368919 CCGGAGATGCTGCAGCTCGAGGG + Intergenic
950157513 3:10734127-10734149 CATGGAATGCTGCAGCATGAAGG + Intergenic
950560627 3:13719565-13719587 CTTAAAATGATGCAGCTAGTTGG + Intergenic
950593329 3:13955333-13955355 CTTGAAATCCTCCAGCTACAGGG + Intronic
951546231 3:23829012-23829034 TCTGACAAGCTGTAGCTAGAGGG + Intronic
952313441 3:32211315-32211337 CATGAGATGATGCAGCAAGAAGG + Intergenic
952810702 3:37399973-37399995 CATGTAATGATGCAGCAAGAAGG - Intronic
952813985 3:37431103-37431125 CTTGAGATGCTGCAGCTTGGCGG - Intronic
952988541 3:38810439-38810461 CCTCAAATTCTGCTTCTAGATGG + Intergenic
954712226 3:52510880-52510902 CCTGAAATGCTCCACATGGAAGG - Intronic
955506460 3:59638028-59638050 CATGATATGATGCAGCAAGAAGG - Intergenic
957210346 3:77250717-77250739 CAGGGAATGCTGCAGCAAGAAGG - Intronic
957245335 3:77709341-77709363 CATGAGATGATGCAGCTGGAAGG - Intergenic
957268217 3:77995136-77995158 CCTGTGCTGCTGCAGCCAGAGGG - Intergenic
960526065 3:118711850-118711872 CCTGAAATGATGCACCGAGCAGG - Intergenic
961406377 3:126682489-126682511 CCTGAGGTCATGCAGCTAGAAGG - Intergenic
963222883 3:142830372-142830394 CCTGTAAAGATGCAGCCAGAGGG + Intronic
963690256 3:148490664-148490686 CTTCAAATGCAGCAACTAGATGG + Intergenic
964696749 3:159516566-159516588 CCTTCCATTCTGCAGCTAGATGG + Intronic
965108011 3:164383322-164383344 CATGGAATGATGCAGCAAGAAGG + Intergenic
967183474 3:186926840-186926862 CATGTGAGGCTGCAGCTAGAAGG - Intergenic
967744572 3:193040835-193040857 CCAGAATCTCTGCAGCTAGAAGG + Intergenic
969322638 4:6422018-6422040 CCTGAGACGCTGCAGCCGGATGG + Intronic
970025867 4:11623407-11623429 TCTGAAATGCTGGAGATAGGAGG + Intergenic
971117214 4:23662534-23662556 CATGGAATGATGCAGCAAGAAGG + Intergenic
972962744 4:44474001-44474023 CCTGGGATGCTGCAGCTTGGTGG + Intergenic
973111715 4:46405075-46405097 CCTGTAACACTGCAGCTTGACGG + Intronic
974566911 4:63589999-63590021 CCTGCGATGCTGCAGCTTGATGG + Intergenic
975291194 4:72679732-72679754 CCTGCAATGCTGCAGCTTGATGG + Intergenic
976407825 4:84679532-84679554 CCTGCTGTGCTGCAGCTAGATGG + Intronic
977318975 4:95487025-95487047 CATGGAATGATGCAGCAAGAAGG + Intronic
977326472 4:95580521-95580543 CCTGTGATGCTACAGCTTGAAGG - Intergenic
977421420 4:96804770-96804792 CATGGAATGATGCAGCAAGAAGG + Intergenic
977771710 4:100868526-100868548 CCTGCTATGCTGCAGCTGGAAGG - Intronic
978464541 4:108994376-108994398 CCTGCGAGGCTGCAGCTTGATGG + Intronic
978530874 4:109711865-109711887 CCTGACATGATGCAGTGAGAAGG + Exonic
980049405 4:128024160-128024182 CATGAAATAATGCAGCAAGAAGG - Intronic
980480873 4:133385490-133385512 CTTGCAAGGCTGCAGCTGGAGGG - Intergenic
980532324 4:134071362-134071384 TCTGATAAGATGCAGCTAGAAGG - Intergenic
980842282 4:138278353-138278375 CATGACATGATGCAGCAAGAAGG + Intergenic
982286935 4:153745720-153745742 CATGAAATGATGCAGCAAGATGG - Intronic
982909222 4:161118098-161118120 CCTGAGATGCTCCAGCTTGGTGG - Intergenic
983182351 4:164663079-164663101 CATGTAATGATGCAGCAAGAAGG + Intergenic
984372425 4:178884319-178884341 CCTGCAACACTGCAGCTTGATGG + Intergenic
985417346 4:189750213-189750235 CCGGAAATGATGCAACGAGAAGG - Intergenic
986541289 5:8846873-8846895 CTTAAAATGCAGCAGCAAGAAGG - Intergenic
986656368 5:10016767-10016789 CCTGCAATGCTGCTGCTTGGCGG - Intergenic
987451650 5:18092032-18092054 CCTGAGATTCTGAAGCAAGATGG - Intergenic
988822326 5:34899551-34899573 CCTGGAATGCTGCTGCTAAGTGG - Intergenic
989350398 5:40479410-40479432 CATGAGATGATGCAGCAAGAAGG + Intergenic
989358066 5:40567109-40567131 CCTGGGATGCTGCAGCTAGTTGG - Intergenic
989687626 5:44108384-44108406 CCTGAAATGCTCGAGCTTGGTGG - Intergenic
989985309 5:50690150-50690172 CCTGAGAGGCTGCAGGAAGAAGG - Intronic
990971781 5:61515426-61515448 CATGGAATGATGCAGCAAGAAGG - Intronic
991100879 5:62791234-62791256 CATGGAATGCTGCAGCAAGAAGG + Intergenic
991242332 5:64474339-64474361 CCTGGAATGCTCCAGCTTGGTGG + Intergenic
991572121 5:68065897-68065919 CATGACAAGGTGCAGCTAGAAGG + Intergenic
992420309 5:76597305-76597327 TCTGAAAAGCTGCAGGCAGAGGG - Intronic
992985572 5:82225521-82225543 CCTACAAAGCAGCAGCTAGATGG - Intronic
993591497 5:89800823-89800845 CCTGTGATGCTGCAGCTTGATGG + Intergenic
993620621 5:90163564-90163586 CCAGACATGCTGCAGATGGAGGG + Intergenic
994529647 5:100953160-100953182 CATGAAATGGTGCAGTAAGAAGG - Intergenic
995389417 5:111623937-111623959 CCTAAAGTCCTGCAGCCAGAAGG - Intergenic
995827994 5:116322848-116322870 CATGTAATGATGCAGCAAGAAGG - Intronic
996427919 5:123335197-123335219 CCTGAGATGCTCCAGCTTGGTGG - Intergenic
996726854 5:126680162-126680184 CCAGAAAACCTGCAGCCAGATGG + Intergenic
996863049 5:128086397-128086419 CCTGAAAAGCTGAAGCTAAGAGG - Intronic
999519600 5:152337647-152337669 CATGAAATGATGCAGCAAGAAGG + Intergenic
999535026 5:152506648-152506670 CCTCATCTCCTGCAGCTAGAGGG - Intergenic
1001347792 5:170922540-170922562 ACTGCGATGCTGCAGCTTGACGG - Intronic
1003268812 6:4589598-4589620 CCTGCACTGCTCCAGCTAAAGGG + Intergenic
1003489706 6:6610637-6610659 CCTAAAATGGTCAAGCTAGAAGG + Intronic
1003971013 6:11299259-11299281 CCTGCAACGCTGCAGCTTGAGGG + Intronic
1005267780 6:24130847-24130869 CCTGAAAAGCTACAACTGGAAGG + Intronic
1005935975 6:30521199-30521221 CCTGGCATGCTGCAGCTTGTTGG + Intergenic
1006106027 6:31717394-31717416 CCTGATGTGATGCAGCAAGAAGG - Intronic
1008147281 6:47907233-47907255 CCTGAGATTCTGCAGCCAAATGG + Intronic
1008263930 6:49400490-49400512 GTAGAACTGCTGCAGCTAGAGGG - Intergenic
1008478541 6:51959950-51959972 CCTGAAAGGCTGCCACAAGATGG - Exonic
1008947484 6:57114636-57114658 ACAGAAATGCTGCATCTAGAAGG - Intronic
1009355492 6:62739789-62739811 CCTGAATAGATGCAGCTGGAAGG + Intergenic
1012597996 6:101062399-101062421 CCTGCGATGCTGCACCTTGACGG + Intergenic
1013436645 6:110116454-110116476 CCTGTGACGCTGCAGCTTGACGG + Intronic
1013512216 6:110855550-110855572 CCTGAATTCCTGCATCTAGAAGG + Intronic
1014013299 6:116501266-116501288 CCTGAGATGCTGAAGCTTGGCGG + Intronic
1014380977 6:120741796-120741818 AATGAAATTCTGCAGCTTGAAGG - Intergenic
1015383102 6:132592321-132592343 CCTGAAATTATGAAGCCAGATGG + Intergenic
1016483488 6:144508088-144508110 CCTGGAATGCTGGAGCTTGGTGG - Intronic
1018432973 6:163737384-163737406 CCTGAAAAACAGCAGCAAGAGGG - Intergenic
1019443137 7:1057416-1057438 CCAGAAGTGCTGCAGGTACAGGG - Intronic
1020834035 7:13126569-13126591 CCTGCAACACTGCAGCTTGACGG - Intergenic
1022943783 7:35262255-35262277 CCAGAAAAGCTGCAGCTGGCCGG - Intergenic
1023191076 7:37583801-37583823 CTTCAAATGCAGCAACTAGATGG + Intergenic
1023673475 7:42604661-42604683 CATGAAATGCTGCAGTTTGAAGG - Intergenic
1023969998 7:44983885-44983907 CCCAAGATGCTGGAGCTAGAGGG - Intergenic
1027201897 7:76069251-76069273 CCTGGAAGGCAGGAGCTAGAGGG - Intergenic
1028413012 7:90551253-90551275 CCTGTGATACTGCAGCTTGACGG - Intronic
1028902593 7:96118127-96118149 GCTGGAATGCTTCAGGTAGAGGG - Intergenic
1031345498 7:120660806-120660828 TTTTAAATGCTGGAGCTAGAGGG - Intronic
1031632586 7:124062539-124062561 CATGAGATGATGCAGCAAGAAGG + Intergenic
1031687907 7:124754896-124754918 CCTGAAATGCTGCAAGGACAAGG - Intronic
1033922872 7:146416512-146416534 CCTGAGTAGCTGCAACTAGAGGG + Intronic
1035763513 8:2086777-2086799 CCTGGAATGTTGCAGCAGGAAGG - Intronic
1036757105 8:11477828-11477850 CCTGAAATTCCCCAGTTAGATGG - Intergenic
1039194923 8:35020361-35020383 CATGAGATGATGCAGCAAGAAGG - Intergenic
1039553931 8:38463366-38463388 AATGAAATTCTCCAGCTAGAAGG - Intronic
1039706402 8:40011869-40011891 CCTGACAGGCTGCAGCTATTAGG - Intronic
1040586533 8:48748569-48748591 CCTGGGATGATGCAGCAAGAAGG + Intergenic
1041316229 8:56565206-56565228 CATGGTATGATGCAGCTAGAAGG + Intergenic
1041951695 8:63510480-63510502 CCTGCAAAGCTGCAGCTTGACGG - Intergenic
1042332676 8:67596944-67596966 CCTGAAATGATGCACTGAGAAGG - Intronic
1042874100 8:73424954-73424976 CCTGGAGTGCTGCAGGGAGAAGG + Intronic
1043228675 8:77769596-77769618 CCTGAAATGTTGCAGATGTAAGG - Intergenic
1043624981 8:82244967-82244989 CATGAGATGATGCAGCAAGAAGG + Intergenic
1047249640 8:123172043-123172065 CCCCAAATGATGCAACTAGATGG + Intergenic
1048237659 8:132707614-132707636 CATGAGATGATGCAGCAAGAAGG + Intronic
1048264789 8:132976289-132976311 CATGGAATGATGCAGCAAGAAGG - Intronic
1048357171 8:133663171-133663193 CCTGAAATGCTGCAGAAAGAAGG - Intergenic
1049602928 8:143516282-143516304 CCTCAAACGCTGCAGACAGAGGG + Intronic
1049803316 8:144528064-144528086 CAGGAAAAGCTGCAGATAGAGGG + Exonic
1051425572 9:16928293-16928315 CCTGCAAGGCTGCAGCAGGATGG - Intergenic
1051571489 9:18563862-18563884 CCTGAAATGCTGGAGCTTGGTGG - Intronic
1052981337 9:34451837-34451859 CCTGAAAAGCTGCAGTTGGGTGG - Intronic
1054861785 9:69961270-69961292 CATGAGATGATGCAGCAAGAAGG + Intergenic
1056348462 9:85723416-85723438 CCTGCAATGCTGCAGCTTGGTGG - Intronic
1060933126 9:127501192-127501214 CCTCAAATTCTGCAGGTACAGGG + Intronic
1062233076 9:135493551-135493573 CCTGCACTGCTGTAGCAAGATGG - Intergenic
1188301695 X:28512277-28512299 ACAAAAATGATGCAGCTAGAGGG + Intergenic
1188801212 X:34532504-34532526 CATGTAATGGTGCAGCAAGAAGG + Intergenic
1189061515 X:37758495-37758517 ATTGAAGTGCTGCAGCTAGAAGG - Intronic
1191088716 X:56597516-56597538 CCTGAGATGCTCCAGCTTGGTGG - Intergenic
1191711384 X:64152992-64153014 CCTGCAATGCTGCAGCTTGATGG + Intergenic
1192072172 X:67952638-67952660 CATGAGATGATGCAGCAAGAGGG - Intergenic
1192629026 X:72760721-72760743 CCTGCTATGCTGCAGCTTGACGG - Intergenic
1192652684 X:72960093-72960115 CCTGCTATGCTGCAGCTTGACGG + Intergenic
1194759479 X:97777353-97777375 CTTGAAAAGCTGCAATTAGAGGG + Intergenic
1197157223 X:123283535-123283557 CCTGAGATGCTGGAGCTTGGTGG + Intronic
1197608119 X:128607950-128607972 CCTGAACTGGTGTAGCCAGAGGG + Intergenic
1199293449 X:146131004-146131026 CCTGTGATGATGCAGCAAGAAGG - Intergenic
1199408959 X:147496895-147496917 CCTGTTATGCTGTAGCAAGAAGG + Intergenic
1201320418 Y:12692633-12692655 CCTGGTAAGCTGCAGCAAGAAGG - Intergenic