ID: 1179341684

View in Genome Browser
Species Human (GRCh38)
Location 21:40516746-40516768
Sequence ACTCTGCAGTGCCCCAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 3, 3: 58, 4: 309}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179341680_1179341684 4 Left 1179341680 21:40516719-40516741 CCAGGGAGAACATTCGAGAAGGG 0: 1
1: 0
2: 1
3: 6
4: 96
Right 1179341684 21:40516746-40516768 ACTCTGCAGTGCCCCAGTGTGGG 0: 1
1: 0
2: 3
3: 58
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179341684 Original CRISPR ACTCTGCAGTGCCCCAGTGT GGG Intronic
901183989 1:7360372-7360394 ACACTCCAGTGCATCAGTGTAGG - Intronic
901467974 1:9435261-9435283 ACTCTGCAGTCCCAGCGTGTTGG + Intergenic
901916265 1:12502910-12502932 ACTCTGCAGGGCCACTGTGATGG - Intronic
901925528 1:12563798-12563820 ACTCTGCAGAGCCACAGGGGTGG + Intergenic
902550635 1:17217116-17217138 ACTCTGAAGAGTACCAGTGTAGG + Intronic
902600365 1:17536777-17536799 ACTCTGCAGGGCCCCAGGAGTGG - Intergenic
904971598 1:34423357-34423379 GCTCTGCACTGCCCCAGGGAGGG - Intergenic
906538046 1:46562828-46562850 ATTCTGCAGAGCCACACTGTGGG + Exonic
907020128 1:51059264-51059286 ACTTTGCTCTGCCCCAGAGTGGG - Intergenic
907315480 1:53568117-53568139 ACTCTGCAGAGCCACAGGGATGG + Intronic
907469535 1:54664366-54664388 CCTTTGCAGAGCCCCAGGGTGGG + Intronic
907832274 1:58076435-58076457 ACTCTGCAGGAACCCAGAGTTGG - Intronic
909405305 1:75281954-75281976 ACTAGGCAATGCCCCAGTGGAGG - Intronic
909439776 1:75684704-75684726 ACTCTGCAGAGCCACAGGGGCGG - Intergenic
911805425 1:102200788-102200810 CCTCTGCAGTGCCCTAGTAGAGG + Intergenic
912017471 1:105060115-105060137 AAACTGTAGTTCCCCAGTGTTGG - Intergenic
912068687 1:105779801-105779823 ACCAGGCAGTGCCCCAGTGAGGG - Intergenic
912084054 1:105977084-105977106 ACCAAGCAGTGCCCCAGTGTGGG - Intergenic
914492728 1:148162272-148162294 ACTCTCCCGTGCCCCCGTGCTGG - Intergenic
915786993 1:158624222-158624244 ACTAGGCAGTACCCCAGTGAGGG - Intronic
916979458 1:170117343-170117365 CCTCTGAAATGCCCTAGTGTGGG - Intergenic
917152102 1:171956644-171956666 ACTAGGCAGTGCCCCAGTAAGGG + Intronic
917282046 1:173386605-173386627 ACTATGCATTACCCCAGTGGGGG - Intergenic
917506529 1:175632334-175632356 ACTCTGTAGGGCATCAGTGTGGG + Intronic
918198396 1:182244092-182244114 ACTCTGCAGTGACCCTGGGTAGG + Intergenic
918881219 1:190124088-190124110 AATCTTCAGTGCAACAGTGTTGG + Intronic
921169051 1:212529497-212529519 ACTCTGCAGGGCCACATTATTGG + Intergenic
922339879 1:224646815-224646837 ACTCTATAGTTCACCAGTGTAGG - Intronic
922709109 1:227813826-227813848 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
923041964 1:230325910-230325932 ACTCTGCAGTCACCCTGTGTGGG - Intronic
923179143 1:231499236-231499258 ACTAGGTAGTGCCCCAGTGGGGG + Intergenic
923876799 1:238058443-238058465 ACTCTGCAAAGCCACAGGGTTGG - Intergenic
1062770465 10:96340-96362 ACTAGGCAGTGCCCCTGTGGGGG + Intergenic
1063087316 10:2831592-2831614 ATTCTGCAGTGACCCTGTATGGG + Intergenic
1064458313 10:15508936-15508958 AATCTCCAGTGACCCAGTGGTGG - Intergenic
1066975518 10:42364909-42364931 ACTATGCTATGCCCCAGTGAGGG + Intergenic
1067220326 10:44339540-44339562 AGGCTGCAGGGCCCCAGTGCTGG + Intergenic
1067578168 10:47420616-47420638 CCTCTGCGGTGCTCCAGAGTGGG + Intergenic
1068147760 10:53093122-53093144 CCTCTGCACTGCCCTAGTGGAGG - Intergenic
1068147772 10:53093166-53093188 ACTAGGCAGTGCTCCTGTGTAGG - Intergenic
1068365351 10:56042323-56042345 AATCTCCAGTGCAACAGTGTTGG - Intergenic
1068399419 10:56509055-56509077 ACTAGACAGTGCCCCAGTGGTGG - Intergenic
1069106120 10:64385136-64385158 ACTAGGCAGTGCTCCAGTGGGGG + Intergenic
1069713986 10:70509045-70509067 CCTCTGCCGTCCCCCAGAGTCGG + Intronic
1070487286 10:76943044-76943066 TCTCTGCCCTGCCCCAGTATGGG - Intronic
1070581639 10:77724909-77724931 ACTAGGCAGTGGCCCAGTGGGGG - Intergenic
1070831125 10:79418679-79418701 ACTCTGCCCTGCCCCAGTCCTGG - Intronic
1071779992 10:88833813-88833835 ACACTGAAGTGCCCAACTGTTGG - Intronic
1072552350 10:96488452-96488474 AGTCTGCAGGACCGCAGTGTGGG - Intronic
1073232567 10:101984560-101984582 GCTCTGGAGTGGCTCAGTGTTGG - Intronic
1074619667 10:115106088-115106110 ACTCTGCAAAGCCACAGGGTCGG + Intronic
1074657991 10:115616951-115616973 ACTAGGCAGTGCCCCAGTGAGGG - Intronic
1075222691 10:120598752-120598774 GCTCTCCAGAACCCCAGTGTCGG - Exonic
1076395871 10:130136855-130136877 ACTCAGCCGTGCCGCAGTGGCGG + Intronic
1077297706 11:1833909-1833931 CCTCTGCAGCCCCCCAGTCTGGG - Intronic
1080707108 11:34706863-34706885 ACTCAGCACAGCCCCAGTGGTGG - Intergenic
1081111322 11:39137631-39137653 ACTCAGCAGTGGCCCAGTTAGGG - Intergenic
1081863161 11:46345694-46345716 ACTCTGCAGAGGCACAGAGTAGG + Intronic
1082934832 11:58645750-58645772 ATTCTGCACTGCCCCAGTAGAGG + Intronic
1084257177 11:67951124-67951146 GCTCTGCAGGTCCCCAGCGTGGG + Intergenic
1084452088 11:69245208-69245230 AAGCTGCAGTTGCCCAGTGTAGG - Intergenic
1084639268 11:70414755-70414777 TCTCTGCAGTCCCCCAGAGCTGG - Intronic
1084815600 11:71644144-71644166 GCTCTGCAGATCCCCAGCGTGGG - Intergenic
1085387651 11:76166266-76166288 ACTTGGCTGTGCCCCCGTGTTGG + Intergenic
1086056600 11:82654217-82654239 ACTAGGCAGTGCCCCAGTAAAGG - Intergenic
1086406847 11:86505891-86505913 ACTCTGCGGTACCACAGGGTGGG + Intronic
1087205802 11:95392541-95392563 AATCTCCAGTGCAACAGTGTTGG - Intergenic
1087336621 11:96852038-96852060 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
1087495916 11:98890634-98890656 CCTCTGCACTGCCCTAGTGGAGG + Intergenic
1089585957 11:119509717-119509739 AATCTGCTGTGCCCCAGTCTTGG + Intergenic
1089786332 11:120909919-120909941 AATCTGCAATGCAACAGTGTTGG + Intronic
1090424439 11:126597256-126597278 ACTCTGCAGCTCCGCAATGTCGG + Intronic
1091146197 11:133282540-133282562 CCTCTGCACTGCCCTAGTGGTGG - Intronic
1091647607 12:2285592-2285614 ACTCTGCTGTGCCGCAGAGCTGG + Intronic
1095216714 12:39557941-39557963 ACTAGGCAATGCCCCAGTGGGGG - Intronic
1095529832 12:43173960-43173982 AATCTCCAGTGCAACAGTGTTGG + Intergenic
1096304669 12:50463798-50463820 ACTATGCAGTGCCCTAGTGGAGG + Intronic
1097955779 12:65484032-65484054 CCTCTGCAGTGCCCTAGTAGAGG + Intronic
1098257047 12:68627185-68627207 ACCTTGCACTACCCCAGTGTAGG - Intronic
1098859280 12:75689094-75689116 ACCTTGCACTACCCCAGTGTAGG - Intergenic
1099984701 12:89649149-89649171 ACTAAGCAGTGCCCTAGTGGGGG - Intronic
1100230267 12:92600003-92600025 ACTCTGCAGAGCCACAGGGATGG - Intergenic
1100318521 12:93467598-93467620 ACTGGGCAGTCCCACAGTGTTGG + Intronic
1101052110 12:100874246-100874268 ACAAGGCAGTGCCCCAGTGAAGG - Intronic
1102755727 12:115338387-115338409 ACTCTGCAGCGCACCTGTATCGG + Intergenic
1103461298 12:121107200-121107222 ACCTTGCACTACCCCAGTGTAGG + Intergenic
1103581336 12:121917910-121917932 ACACTGCCATGCCCCAGTGATGG - Exonic
1104742031 12:131184718-131184740 ACTAGGCAGTGCCCCAATGTGGG + Intergenic
1105546287 13:21353058-21353080 CCTCTGCAGGGCCCGTGTGTGGG + Intergenic
1110062663 13:71062337-71062359 ACTTAGCAGTGCCCCAGTGGGGG + Intergenic
1111778691 13:92694405-92694427 ACTCTGCAGAGCCACAGGGGAGG + Intronic
1113077657 13:106483839-106483861 ACTCTGCAGAGCCCTAAGGTAGG - Intergenic
1113269314 13:108655534-108655556 ACTAGGCAGTGCCCCAGTGGAGG - Intronic
1114781483 14:25543009-25543031 GCTCTGTAGTGACCCACTGTCGG - Intergenic
1114918521 14:27296741-27296763 CCTCTGCAGTGCCCTAGTACAGG + Intergenic
1115179353 14:30604314-30604336 ACGTTACAGTGCCCTAGTGTAGG - Intronic
1115277353 14:31623023-31623045 ACTCTGCAGAGCCACAGGGGTGG + Intronic
1115340769 14:32291185-32291207 ACTAGGCAGTGCCCCACAGTGGG - Intergenic
1115526329 14:34284185-34284207 GCTCTGCACTCACCCAGTGTGGG + Intronic
1115562407 14:34595039-34595061 GCTGTGCAGTGCCCCAATCTCGG - Intronic
1116095327 14:40359848-40359870 ACTAGGCAATGCCCCAGTCTGGG - Intergenic
1116098875 14:40408260-40408282 ACTAGGCAGTGCCCCAGTGAGGG + Intergenic
1116263577 14:42660959-42660981 CCTCTGCACTGCCCCAGTAGAGG - Intergenic
1116263616 14:42661163-42661185 ACTCTGCAGAGCCACAGGGGTGG + Intergenic
1116485543 14:45444197-45444219 ATTAGGCAGTGCCCCAGTGTGGG - Intergenic
1117341844 14:54798312-54798334 TCACTGCAGGCCCCCAGTGTAGG + Intergenic
1117413085 14:55468258-55468280 ACTCTTCACTGCCACAGTCTGGG + Intergenic
1119411115 14:74431110-74431132 ACTCTGCATTGTCCCAGTTCAGG - Intergenic
1120053225 14:79892582-79892604 ACTCTGCAGTGTCTCACTGTGGG + Intergenic
1121669123 14:95694488-95694510 TCTCTGCTGCGACCCAGTGTTGG - Intergenic
1122055967 14:99098496-99098518 ACTGTGCAGTGGCCAAGTCTGGG - Intergenic
1122362482 14:101175578-101175600 CCTGTGCAGTCCCTCAGTGTGGG + Intergenic
1124464038 15:29920099-29920121 ACCTGGCAGTGCCCCAGTTTCGG - Intronic
1125233382 15:37483739-37483761 ACTCTGCAGAGCCTCAGGGGTGG - Intergenic
1128518338 15:68358301-68358323 GAGCTGCAGTGCCCCAGTGCTGG + Intronic
1129656458 15:77528180-77528202 GCTCTGCAGTGCCCAGGTCTGGG + Intergenic
1131279982 15:91013397-91013419 AATCTGCAGTGCAACAGTGTTGG + Intronic
1131987566 15:98060503-98060525 ACTAGGCAGTGCCCCAGTAGAGG + Intergenic
1132680813 16:1141031-1141053 ACTCTGGAGTCACCCAGTCTGGG - Intergenic
1132928561 16:2446373-2446395 GCTCTGCAGGGCACCAGTGGGGG - Intronic
1133040624 16:3058403-3058425 ACCCTGCAGGGCCCCAGTTCTGG + Exonic
1133076228 16:3283141-3283163 GCTCTCCAGTGCGTCAGTGTCGG - Exonic
1133130376 16:3672982-3673004 CCCCTGCAGAGCCACAGTGTGGG - Intronic
1133436768 16:5786531-5786553 GTTCTGCACTACCCCAGTGTGGG + Intergenic
1134169312 16:11955950-11955972 ACTCTGCAGTGGACCAGAGGAGG - Intronic
1136381543 16:29898319-29898341 CCTCTGCAGAGCCCCAGGGTTGG - Intronic
1137638579 16:50008883-50008905 CCTCTGCATTGCCCTAGTGGAGG - Intergenic
1137892061 16:52173318-52173340 ACTCTGGAGTCCCACAGTCTGGG - Intergenic
1139406697 16:66724746-66724768 ACTCTGCAGTGAGACAGTGAGGG + Intronic
1139698719 16:68693964-68693986 ACTGTGCCCAGCCCCAGTGTTGG - Intronic
1141741218 16:85894338-85894360 ACTCAGCAGAGAGCCAGTGTGGG - Intergenic
1141771091 16:86090038-86090060 ACTCTGCAGCCCCCCAGGGAAGG + Intergenic
1143120056 17:4600761-4600783 CCTCTGCAGAGGCCCAGTGCAGG + Intronic
1143202286 17:5121403-5121425 GCTCTGCAGGGCCTCTGTGTTGG - Exonic
1143255944 17:5558140-5558162 CCTCTGCAGTGCCCGGCTGTGGG - Intronic
1143843754 17:9756271-9756293 AGTCAGCAGTGCCCCTGCGTTGG + Intergenic
1144180907 17:12751907-12751929 AGACTGCAGGGCCCCACTGTGGG - Intronic
1144627132 17:16849734-16849756 GCTCTGCAGGGCCTCTGTGTTGG + Intergenic
1144879307 17:18422978-18423000 GCTCTGCAGGGCCTCTGTGTTGG - Intergenic
1145152931 17:20521409-20521431 GCTCTGCAGGGCCTCTGTGTTGG + Intergenic
1146044348 17:29490978-29491000 AATCTCCAGTGCAACAGTGTTGG - Intronic
1146694700 17:34899663-34899685 AGTCAGATGTGCCCCAGTGTCGG + Intergenic
1147581271 17:41628419-41628441 ACTCTGCAGGGCCTCTGTGTTGG + Intergenic
1148390502 17:47268800-47268822 ACTAGGCAGTGCCCGAGTGGGGG + Intronic
1148587595 17:48791800-48791822 AGTCTCCAGAGCCCCAGGGTGGG + Intronic
1149052675 17:52325479-52325501 ACTAGGCAGTGCCCCAGTAAGGG + Intergenic
1149135573 17:53359676-53359698 ACTAGGCAGTGCCCCTGTGGGGG - Intergenic
1151674551 17:75590807-75590829 ACTCTGCAGGGCTCCAGAGAGGG - Intergenic
1154287632 18:13075067-13075089 ACTCTGCAGTACAACAGTGTTGG + Intronic
1159161421 18:64647111-64647133 ACTTTGCATTGCCCCGGAGTGGG + Intergenic
1159651747 18:70986405-70986427 CCTCTGCATTGCCCTAGTATAGG - Intergenic
1159697316 18:71575851-71575873 ACTAGGCAGTACCCCAGTGGGGG + Intergenic
1160428953 18:78798467-78798489 AATCTGTAGTGACACAGTGTGGG - Intergenic
1161085386 19:2332775-2332797 ACACTGCAGACCCTCAGTGTGGG - Intronic
1161586333 19:5107783-5107805 GCTCAGCAGGGCCACAGTGTGGG - Intronic
1161989920 19:7678800-7678822 GCTCTGCTGTACCCCAGGGTGGG + Intronic
1162349889 19:10142396-10142418 ACCTTGCAGTTCCCCAGTGTGGG - Intronic
1163998712 19:21077291-21077313 ACTCTGCAGAGCCACAGGGGTGG + Intergenic
1164606776 19:29605270-29605292 TCTCAGCAGTGACCCAGTGTTGG - Exonic
1166629191 19:44390269-44390291 ACTCTGCAGAGCCACAGGGGTGG + Intronic
1166638073 19:44469531-44469553 ACTCTGCAGAGCCACAGGGGCGG - Intergenic
1167736473 19:51297358-51297380 ACCCTGCAGTGTCCCATGGTTGG - Intergenic
1168278016 19:55287687-55287709 GCTCTCCAGTGCTCCAGAGTTGG - Intronic
926367303 2:12145048-12145070 AATCTGCAGTCACCGAGTGTGGG - Intergenic
928452505 2:31388989-31389011 ACCCTGCAGTGCCTCGGTGCTGG - Intronic
929414109 2:41729963-41729985 GCTCTGCAGTGACCTAGCGTTGG + Intergenic
931342724 2:61417195-61417217 ACCTTGCACTACCCCAGTGTAGG - Intronic
931904838 2:66831278-66831300 ACTCAGCAGAGCCCAAGTGTAGG + Intergenic
934118309 2:88816101-88816123 ACTCTGCAGAGCCACAGGGGTGG + Intergenic
934144192 2:89075469-89075491 ACTAAGCAGTGCCCCAGTAGGGG - Intergenic
934225051 2:90125079-90125101 ACTAAGCAGTGCCCCAGTAGGGG + Intergenic
935660402 2:105461780-105461802 CCTTTGCAGTGCCTGAGTGTTGG + Intergenic
936792346 2:116164747-116164769 ACTAAGCAGTGCCCCAGTAGGGG - Intergenic
937268807 2:120633925-120633947 CCTCCACAGGGCCCCAGTGTTGG + Intergenic
938117450 2:128611694-128611716 ACTCTCCTGTGCACCAGGGTGGG + Intergenic
938544442 2:132315052-132315074 ACTCTGCAGAGCCACAGGGGTGG - Intergenic
938548044 2:132352971-132352993 ACTCGGCAGTCACCCCGTGTGGG - Intergenic
939249013 2:139662394-139662416 ACTATGCAATGCTCCAGTGGGGG + Intergenic
940288948 2:152059195-152059217 ACTATGCAGTGCCCCAGTGGGGG - Intronic
940425930 2:153532069-153532091 ACTAAGCAGTGCCCCAGTGGGGG + Intergenic
941527001 2:166618487-166618509 ACTAGACAGTGCCCCAGTGGGGG - Intergenic
943092966 2:183395897-183395919 ACTAGGCAGTGCCCCAGTACAGG - Intergenic
943648945 2:190436371-190436393 ATTCTGCAGTGCCCCCTTTTGGG + Exonic
943819680 2:192305063-192305085 AGGCTGCAGTGACCCATTGTTGG - Intergenic
943876200 2:193071142-193071164 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
943964925 2:194320658-194320680 ACTCTGGAAAGCCCCAGAGTTGG - Intergenic
944477750 2:200124810-200124832 ACTAAGCAGTGCCCCAGTGGGGG + Intergenic
944712910 2:202351645-202351667 ATGCTGCTGTGCTCCAGTGTGGG - Intergenic
946155324 2:217803258-217803280 ATTCTGCAGGGTCCCTGTGTTGG - Exonic
947026286 2:225741471-225741493 ACACTGCAGCCCTCCAGTGTGGG - Intergenic
948514449 2:238495007-238495029 TCCCTGGAGTGGCCCAGTGTGGG - Intergenic
1171335600 20:24382472-24382494 AGTCTGCAGAGCCACAGTGGTGG + Intergenic
1171873310 20:30547788-30547810 ACTCTGCAGAGCCACAGGGGTGG - Intergenic
1174556364 20:51398256-51398278 ACTCTGCTGTTCCCCAGTGCCGG + Intronic
1176217021 20:63952778-63952800 ACTGTGCTGTGGCCCAGAGTAGG - Intronic
1177748715 21:25253524-25253546 ACTCTGCAGGGCGTCAGTTTGGG - Intergenic
1177773340 21:25541417-25541439 ACTGTGCAGTGCCCTAGAGTGGG - Intergenic
1178262158 21:31109859-31109881 AGTCTGAAGTACCCCAGTTTGGG - Intergenic
1179033180 21:37737799-37737821 ACCCTGCAGTGGCCCCGTCTAGG + Intronic
1179341684 21:40516746-40516768 ACTCTGCAGTGCCCCAGTGTGGG + Intronic
1180936248 22:19627170-19627192 ACTCTGCCTTGCCCCAGTGTTGG + Intergenic
1181584626 22:23846328-23846350 ACTCCCCTGTGCCCCAGTGATGG - Intergenic
1184198461 22:42947922-42947944 AGAATGGAGTGCCCCAGTGTGGG - Intronic
1184737618 22:46408764-46408786 GCTCTGCTGGGCCCCAGGGTTGG + Intronic
1184928901 22:47665316-47665338 ACTCTGCTTTGCCCTATTGTGGG + Intergenic
949542113 3:5040888-5040910 ACTGTGCAGTGGCCCAGACTCGG + Intergenic
950750381 3:15123596-15123618 GCTCTGCAGGTCCCCAGCGTGGG - Intergenic
951449347 3:22819058-22819080 ACTAGGCAGTGCCCCAGTTGGGG + Intergenic
952589382 3:34932464-34932486 ACCAGGCAGTGCCCCAGTGGGGG - Intergenic
953377954 3:42444701-42444723 ACTGGGCAGTGCCCCAGTGAGGG - Intergenic
956246248 3:67186520-67186542 ACTAGGCAGTACCTCAGTGTGGG + Intergenic
957674309 3:83347068-83347090 CTTCTGCACTGCCCCAGTGGAGG - Intergenic
959673991 3:109013763-109013785 AATCTGCAATGCAACAGTGTTGG + Intronic
959930701 3:111979021-111979043 ACCCTGCAGTGTCCCACTGAGGG - Exonic
960121388 3:113951250-113951272 ACTGGGCAGTGCCCTAGTGGGGG + Intronic
961199279 3:125031246-125031268 ACTCAGCAGTGGCCCAGCTTTGG - Intronic
961282025 3:125771481-125771503 GCTCTGCAGGTCCCCAGCGTGGG - Intergenic
961388233 3:126536448-126536470 GCCCTTCTGTGCCCCAGTGTGGG - Intronic
963538911 3:146562239-146562261 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
966851579 3:184168150-184168172 GCTCTGCTGTCCCCCAGTTTGGG - Intronic
966888146 3:184387924-184387946 CCTCTCCAGTGCCCCCCTGTAGG - Exonic
967633918 3:191778611-191778633 ACCAGGTAGTGCCCCAGTGTGGG - Intergenic
968014771 3:195319464-195319486 ACTCTGCAGAGCCACAGAGGTGG + Intronic
968575922 4:1366106-1366128 CCTCTGCACTGCCCCTGTGCTGG - Intronic
969566531 4:7982030-7982052 ACTCAGCAGTACCCTAGTGCTGG - Intronic
969738256 4:9005436-9005458 GCTCTGCAGGTCCCCAGAGTGGG - Intergenic
969797438 4:9536982-9537004 GCTCTGCAGGTCCCCAGTGTGGG - Intergenic
969997096 4:11324307-11324329 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
970100420 4:12515074-12515096 ACCCTGCAGAGCCACAGTGAGGG + Intergenic
971510482 4:27417524-27417546 ACTAGGCAGTGCCCCAGTAGGGG - Intergenic
971710536 4:30105604-30105626 ACTAGGCAGTGCCTCTGTGTGGG + Intergenic
972647220 4:40980505-40980527 GCTCTGCAGTGCCCCCTCGTGGG - Intronic
973780381 4:54283203-54283225 CCTCTGCAGTGCCCTAGTAGAGG + Intronic
973830193 4:54751404-54751426 AATATGCATTGCTCCAGTGTTGG + Intergenic
974716897 4:65679181-65679203 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
976674885 4:87692759-87692781 ACTCTGCAGAGCCACAGGGGCGG + Intergenic
976715669 4:88120308-88120330 ACTAAGCAGTGCCTCAGTGGGGG - Intronic
977307567 4:95343233-95343255 ACCCAGCATTGTCCCAGTGTTGG + Intronic
977952781 4:102993455-102993477 ACTCTGCAGAGCCACAGGGGCGG - Intronic
978322702 4:107515753-107515775 ACTCTGCACTGCCCTAGTAGAGG - Intergenic
979087235 4:116428498-116428520 AATAGGCAGTGCCCCAGTGGGGG - Intergenic
980618769 4:135269521-135269543 ACTCTGCAGCGTCCCAGTGCAGG + Intergenic
981799318 4:148637300-148637322 ACTAGGCAGTGCCCCAGTTAGGG + Intergenic
982337636 4:154257991-154258013 ACGATGCAGGGCCCCAGTGTGGG + Intronic
982352482 4:154430832-154430854 GCTCTGCAGGGCCACAGGGTAGG - Intronic
982987744 4:162232199-162232221 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
983419214 4:167496290-167496312 ACTAGGCAGTGCCCCAGTTGGGG + Intergenic
983469288 4:168136784-168136806 ACTAGGCAGTGTCCCAGTGTGGG + Intronic
984065603 4:175043988-175044010 TCTCTGCAGTGCCCTAGTAGAGG - Intergenic
985551217 5:534538-534560 CCTCTGCAGGGCCCCAGGGCTGG - Intergenic
986014706 5:3747781-3747803 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
986533424 5:8761979-8762001 ACTAGGCAGTGCCCTAGTGAGGG - Intergenic
986582356 5:9278921-9278943 ACTCTGCACTGCCCTACTGTAGG - Intronic
987154745 5:15077855-15077877 ACTGGGCAATGCCCTAGTGTAGG - Intergenic
987881296 5:23749510-23749532 ACTAGGCAGTGACCCAGTGGGGG + Intergenic
987983876 5:25121578-25121600 ACTGGGCAGTGCCCCAGTGGGGG + Intergenic
990093384 5:52083078-52083100 ACTAGGCAGTGCCCCAGTAGGGG + Intergenic
991122554 5:63032788-63032810 CCTCTGCATTGCCCTAGTGGAGG - Intergenic
991217366 5:64171098-64171120 ACTCTTCAGAGCCACAGTGCTGG - Intronic
991601823 5:68358665-68358687 ACAATGCAGTGCCCTATTGTTGG + Intergenic
993088125 5:83389669-83389691 ACTATGCACTGCTCTAGTGTTGG - Intergenic
993117545 5:83735638-83735660 ACTAGGCAGTGCACCAGTGGCGG - Intergenic
993421813 5:87712203-87712225 ACATGGCAGAGCCCCAGTGTTGG - Intergenic
993556088 5:89340348-89340370 ACTCTGCATTTACTCAGTGTAGG - Intergenic
993831599 5:92766540-92766562 AATCTCCAGTGCAACAGTGTTGG - Intergenic
993967149 5:94372293-94372315 GCTAGGCAGTGCCCCAGTGGGGG + Intronic
994974201 5:106780692-106780714 ACCCAGCAGAGTCCCAGTGTTGG + Intergenic
996098142 5:119420749-119420771 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
997159637 5:131594469-131594491 CCTCTGCACTGCCCTAGTGGAGG - Intronic
999024263 5:148207775-148207797 ACTCTGCAGTGGCACAATCTTGG - Intronic
999331554 5:150676886-150676908 AATCTTCAGTTCCCCAGTCTCGG + Exonic
1000674618 5:164105600-164105622 ACTATGCAGTGTCCCAGTGGGGG - Intergenic
1000751074 5:165097449-165097471 ACTAGGCAGTGCCCCAGTAAGGG + Intergenic
1001082416 5:168677042-168677064 GTTCTGCAGTGCCCCAGTGCTGG + Intronic
1001389333 5:171366279-171366301 ACTTTGCATTACCCCAGTGTAGG + Intergenic
1001904510 5:175460724-175460746 ACTCCCCAGTTCCCCAGGGTGGG - Intergenic
1002392781 5:178928819-178928841 CCTCTGCACTGCCCTAGTATAGG + Intronic
1002776960 6:336488-336510 TCTCTGCTCTGCCCCAGTGAAGG - Intronic
1002805879 6:573433-573455 ACTCTGCAGTGCCCCTGCCATGG - Intronic
1004054556 6:12122446-12122468 ACGCTCCTGTGCCCCAGAGTGGG + Exonic
1007652968 6:43434485-43434507 ACTCTGCACTGCCCTAGTCTTGG - Intronic
1010055149 6:71556377-71556399 ACTAGGCAGTGCTTCAGTGTGGG - Intergenic
1010884422 6:81218458-81218480 ACTCTGCAGTGCCACAGGGGTGG + Intergenic
1011025140 6:82860522-82860544 ACTCTGCAGTGGAATAGTGTTGG - Intergenic
1012649579 6:101736296-101736318 ACTAGGCAGTGCCCCAGTAGGGG + Intronic
1012940576 6:105410388-105410410 ACCCAGCAGTGTCCCAGTGGTGG + Intergenic
1014068112 6:117150571-117150593 ACTAGGCAGTGCCCCAGTAGGGG + Intergenic
1014384646 6:120785815-120785837 ACTTTGCTCTGCCCCAGAGTGGG - Intergenic
1014563053 6:122914089-122914111 ACTAGGCAGTGCCCCAGTTGGGG - Intergenic
1015045133 6:128767882-128767904 ACTCTGCAGAGCCACAGGGATGG - Intergenic
1017509390 6:155100300-155100322 ACACTGCAGTGCCGCCGTGCTGG - Intronic
1018527493 6:164729086-164729108 ACTAGGCAGTGCCTCAGTGAAGG - Intergenic
1018573767 6:165236853-165236875 ACTAGGCAGTGCCCCAGTAGGGG - Intergenic
1019104731 6:169659110-169659132 GCTCAGCAGTGCCCCAGCATGGG - Exonic
1019295667 7:272709-272731 ACTCTGCCTTGCCCTCGTGTGGG - Intergenic
1021096343 7:16539933-16539955 CCTCTGCATTGCCCTAGTGGAGG - Intronic
1021100569 7:16583845-16583867 AAAGTGCAGTGCCCCAGAGTGGG - Intergenic
1021902170 7:25296876-25296898 TCTCTTCAGAGCCCCTGTGTTGG + Intergenic
1022598869 7:31738057-31738079 CCTCTCCTGTGCCCCAGTGCTGG + Intergenic
1023637784 7:42229590-42229612 ACTCTTCAGTGCTACAGGGTAGG - Intronic
1024512689 7:50215916-50215938 AGTCTCCAGTGGGCCAGTGTTGG - Intergenic
1024721994 7:52147916-52147938 ACTTTGCAGTGCCGCAATCTTGG + Intergenic
1027341087 7:77209422-77209444 ACTCTGCAGAGCCACAGGGGTGG - Intronic
1027584781 7:80044629-80044651 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
1029074375 7:97924559-97924581 GCTCTGCAGGTCCCCAGCGTGGG + Intergenic
1031254911 7:119435251-119435273 ACTCTGCAGAGCCACAGGGGTGG - Intergenic
1032859659 7:135865019-135865041 AATCTCCAGTGCAACAGTGTGGG - Intergenic
1033885064 7:145934277-145934299 ACTAGTCAGTGCCCCAGTGCGGG - Intergenic
1034876135 7:154726265-154726287 CCTCTGCACTGCCCCAGTAGAGG + Intronic
1035120691 7:156564261-156564283 ACTCTGCAGAGCCACAGGGGTGG - Intergenic
1035743202 8:1944321-1944343 GCCCTGCAGCGCCCCTGTGTAGG + Intronic
1035842817 8:2830755-2830777 ACACTGCAGTGTCCTAGTGTTGG - Intergenic
1036243330 8:7096731-7096753 GCTCTGCAGGTCCCCAGCGTGGG - Intergenic
1036829398 8:12010461-12010483 GCTCTGCAGGTCCCCAGCGTGGG + Intergenic
1036898498 8:12654699-12654721 GCTCTGCAGGTCCCCAGCGTGGG + Intergenic
1037043278 8:14264358-14264380 GCTCTGCAGTGCCTCACTCTAGG + Intronic
1038004321 8:23417040-23417062 AGTCTCCAGTGTCCCAGTGTTGG - Intronic
1038444780 8:27595794-27595816 ACTGTGAAGTGGCCCAGAGTAGG - Intergenic
1039446130 8:37634463-37634485 ACTGTGCATTGCTCCAGTGACGG + Intergenic
1040559483 8:48511540-48511562 AATCTCCAGTGCAACAGTGTTGG - Intergenic
1040721393 8:50329131-50329153 ACCCTGCAGTGCCACAGGGTGGG - Intronic
1040959703 8:53018972-53018994 AATCTGCAGGGCTCCAGGGTTGG - Intergenic
1041644506 8:60237774-60237796 ACCCTGAGGTGCCCAAGTGTAGG - Intronic
1043993157 8:86780825-86780847 ACTAGGCAGTGCCCCAGTTTGGG - Intergenic
1044718600 8:95124036-95124058 ACTAGGCAGAGCCCCAGTGGGGG - Intergenic
1044947034 8:97398870-97398892 ACTCTCCAGTGCAACAGTGATGG - Intergenic
1045422127 8:102026719-102026741 ACTAGGCAGTGCCCCAGTGGAGG + Intronic
1046146848 8:110171977-110171999 ACTAGGCAGTGCACCAGTGGGGG - Intergenic
1047869977 8:129071684-129071706 ACTAGGCAGTGACCCTGTGTGGG - Intergenic
1048514406 8:135092948-135092970 ACTCAGCATGGCCCCAGAGTGGG - Intergenic
1050053029 9:1622913-1622935 CCTCTGCATTGCCCTAGTATAGG + Intergenic
1051028989 9:12651269-12651291 ACTCAGCAGCTCTCCAGTGTGGG - Intergenic
1052577752 9:30311996-30312018 ATTAGGCAGTGCCCCAGTGTGGG + Intergenic
1053018091 9:34675528-34675550 GCTCTGCAGTCCCAGAGTGTGGG + Intergenic
1053752391 9:41269460-41269482 ACTCGGCAGTCACCCCGTGTGGG + Intergenic
1054257919 9:62833792-62833814 ACTCGGCAGTCACCCCGTGTGGG + Intergenic
1056100879 9:83299671-83299693 ACTGTGCATTGCCCAAGTGAGGG + Intronic
1056386566 9:86101709-86101731 AATCTCCAGTGCAACAGTGTTGG - Intergenic
1057684880 9:97222432-97222454 ACTCGGCAGTCACCCCGTGTGGG + Intergenic
1057961421 9:99461197-99461219 CCTCTCCAGGGCCCCAGGGTAGG - Intergenic
1058230369 9:102417427-102417449 ACTAGGCAGTGCCCCAGTAGGGG - Intergenic
1058499024 9:105591708-105591730 AGTAGGCAGTGCCCCAGTGGGGG + Intronic
1061514112 9:131078785-131078807 ACTTTGCAGTGGGGCAGTGTGGG + Intronic
1062141364 9:134960884-134960906 GGTCTGCAGTGCCCCCGTGGTGG - Intergenic
1062639444 9:137510792-137510814 ACCAGGCAGTGCCCCCGTGTGGG + Intronic
1202800856 9_KI270719v1_random:174588-174610 ACTCGGCAGTCACCCCGTGTGGG - Intergenic
1187133569 X:16525877-16525899 ACTAAGCAGTGCCCCAGTTGGGG + Intergenic
1187180510 X:16939336-16939358 ACTCTGCACTGCCCTAGTAGAGG + Intergenic
1187634421 X:21211268-21211290 CCTCTGCACTGCCCTAGTGGAGG - Intergenic
1187719491 X:22136480-22136502 ACTCAGCATTGGCCCAGTGTGGG - Intronic
1188134918 X:26483648-26483670 ACTAGGCAGTGTCCCAGTGGGGG - Intergenic
1189435712 X:40990949-40990971 ACTAGGCAGTGCCCCAGTGGGGG + Intergenic
1191929806 X:66358829-66358851 CCTCTGAAAGGCCCCAGTGTGGG - Intergenic
1191987711 X:67000549-67000571 ACTAGGCAGTGCCCCAGTGGAGG + Intergenic
1192713556 X:73616474-73616496 ACTAGGCAGTGCCCCAGTGAGGG + Intronic
1193247380 X:79244706-79244728 ACTCAGCACTGTCCCAGTGGTGG + Intergenic
1193370754 X:80694395-80694417 ACTAGGCAGTACCCCAGTGGGGG - Intronic
1193509121 X:82377895-82377917 CCTCTGCATTGCCCCAGTAGGGG + Intergenic
1193865040 X:86720734-86720756 TCTAGGCAGTGCCCCAGTGGGGG + Intronic
1194034568 X:88854610-88854632 ACCCTGCAAAGCCCCAGTGGTGG + Intergenic
1194178838 X:90688387-90688409 ACTATTCAGTGCCCCAGTGGTGG + Intergenic
1194850258 X:98860188-98860210 ACTAGGCAGTGCCCCACTGGGGG - Intergenic
1195536337 X:106012984-106013006 ACTAGGCAGTGCCCCAGTGGGGG - Intergenic
1196425127 X:115561789-115561811 CCTCTCCAGAGCCCCAGGGTCGG - Intronic
1197088651 X:122510134-122510156 ACTAGGCAGTGCCCCAGTGTGGG + Intergenic
1197439954 X:126475890-126475912 ACTAGGCAGTGCCCTAGTGGGGG + Intergenic
1197990545 X:132312415-132312437 AATGTGGAGTTCCCCAGTGTGGG + Intergenic
1198525858 X:137500020-137500042 TCTCTGCATTGCCCTAGTCTAGG - Intergenic
1198941696 X:141963835-141963857 ACTAGGCAGTGCCCTAGTGAGGG + Intergenic
1199385472 X:147217767-147217789 CCTCTGCACTGCCCTAGTGAAGG - Intergenic
1200525502 Y:4270557-4270579 ACTATTCAGTGCCCCAGTGGTGG + Intergenic