ID: 1179346582

View in Genome Browser
Species Human (GRCh38)
Location 21:40563985-40564007
Sequence AGCAAGGCCAGCCATGCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 224}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179346582 Original CRISPR AGCAAGGCCAGCCATGCAAA AGG Intronic
900035342 1:403099-403121 AGCAGTGCCTGACATGCAAAAGG + Intergenic
900056963 1:638848-638870 AGCAGTGCCTGACATGCAAAAGG + Intergenic
902456368 1:16536469-16536491 ACCAGGGCCAGCCAGGCAGACGG + Intergenic
902495795 1:16871442-16871464 ACCAGGGCCAGCCAGGCAGAGGG - Intronic
904290304 1:29481044-29481066 AGGAAGGACAGCCTTGGAAAGGG + Intergenic
905659616 1:39711459-39711481 AGGAGGGCTTGCCATGCAAAAGG - Intronic
908312645 1:62900839-62900861 AGCAATGCCTGCCATGCTGAAGG + Intergenic
910019274 1:82567043-82567065 ACCCAGGCCAAACATGCAAATGG + Intergenic
911330447 1:96520198-96520220 AGGAAGGCAAGGAATGCAAAGGG - Intergenic
913307181 1:117442023-117442045 AGGAAAGCTAACCATGCAAAAGG - Intronic
913585719 1:120273485-120273507 AGAAAGGGCAGCCAGGCAGAAGG + Intergenic
913622464 1:120624881-120624903 AGAAAGGGCAGCCAGGCAGAAGG - Intergenic
913996390 1:143654446-143654468 ACCAGGGCCAGCCAGGCAGAAGG + Intergenic
914505871 1:148288363-148288385 ACCAGGGCCAGCCAGGCAGAAGG - Intergenic
914506690 1:148295805-148295827 ACCAGGGCCAGCCAGGCAGAAGG + Intergenic
914871608 1:151479692-151479714 ATGAAGGCCTGCCATGCAAAAGG + Intergenic
916153580 1:161821554-161821576 AGAAAGGCATGCCAGGCAAAGGG + Intronic
917928810 1:179809909-179809931 AGCATGGCCCGCCATGCACCTGG + Intronic
918441467 1:184571580-184571602 AGCCAGGCAAGTCATGGAAAGGG - Intronic
921532559 1:216302988-216303010 TGCAAGGCCTCTCATGCAAATGG - Intronic
921588385 1:216975324-216975346 ATCAAGGACAGACATGGAAAGGG + Intronic
921707195 1:218336485-218336507 TGCAAGGCCACCCACGCATAGGG - Exonic
923682175 1:236127201-236127223 AGCAAGGGCAGCAAGGCCAAGGG - Intergenic
924375827 1:243407441-243407463 AGAAAGTACAGACATGCAAAGGG + Intronic
1063101077 10:2950764-2950786 ACCAAGGTCAGCCATGCCAGGGG + Intergenic
1064408451 10:15085044-15085066 AGCAAGCCCAGCTCTGCAACAGG - Intronic
1064494768 10:15897520-15897542 AGTAGGGACAGTCATGCAAAGGG + Intergenic
1065203690 10:23338304-23338326 AGCCAGGCCAGCCTTGGTAAGGG - Intronic
1067833283 10:49622310-49622332 AGACAGGCCAGCCAGGCTAAAGG - Intronic
1069870214 10:71528476-71528498 TGCAAGGCCAGCCGTGCAGAAGG - Intronic
1070016810 10:72541701-72541723 TGCAAGGCCAGCCAAGTAGAAGG - Intronic
1073581025 10:104665637-104665659 AGCAAGCCCAACCTTGGAAAAGG - Intronic
1074280970 10:112051181-112051203 AGAAGGGCCAGCCAAGCACATGG - Intergenic
1077146642 11:1049493-1049515 AGCCGGCCCAGACATGCAAAGGG - Intergenic
1077469802 11:2751889-2751911 AGGAAGGTCAGCCATGCTATGGG - Intronic
1079902203 11:26200647-26200669 AACCAGGGCAGCCATGCAAGAGG + Intergenic
1083225582 11:61282485-61282507 AGCAAAGGCAGCCAAGAAAATGG + Intronic
1083298285 11:61726953-61726975 TGCAAGGCAGGCCATGCAGAGGG + Intronic
1084915838 11:72428410-72428432 TGCAAGGCCTGCCATGCCCAGGG - Intronic
1085183880 11:74559147-74559169 AGCAAGGCCCGAAATGGAAAAGG - Intronic
1089959859 11:122606689-122606711 TGCAGGGCCAGCCAAGCCAAAGG - Intergenic
1090586493 11:128218886-128218908 AGCAAGGCCAGAAATCTAAAAGG + Intergenic
1092568271 12:9692883-9692905 AACAAGGCCAACCATGGAAATGG + Exonic
1092655196 12:10676754-10676776 AGCAATGCCTGGCATGTAAATGG + Intergenic
1095962687 12:47845229-47845251 AGCAAGGCCAGGCAGGGACAGGG - Intronic
1096544193 12:52326259-52326281 AGCAAAGCCAGTTATGAAAAAGG + Intergenic
1100705668 12:97197650-97197672 CACAAGACCAGCCAAGCAAAAGG - Intergenic
1101014561 12:100486265-100486287 AACATTGCCAGCTATGCAAAGGG + Intronic
1102130824 12:110527483-110527505 TGCAAGGCAAGCCTTGCAGAGGG + Intronic
1110208485 13:72946226-72946248 AGCAAGAACTGCCAAGCAAAGGG + Intronic
1110627203 13:77664780-77664802 ACTAAGGTCAGCCATGCAAGTGG - Intergenic
1111064753 13:83075199-83075221 AGAAAGACCTGCCATACAAAGGG + Intergenic
1112003786 13:95236774-95236796 AGCATGGCCAATCATTCAAAAGG + Intronic
1112578676 13:100659835-100659857 AGCAACGACAGCCGGGCAAATGG - Intronic
1116427758 14:44810930-44810952 AGCATGTCCAGCCATTAAAATGG - Intergenic
1116734648 14:48673143-48673165 AGAAAGATCAGCCATGTAAATGG + Intergenic
1116901518 14:50366434-50366456 ATCAAGGCCAGCCAGTCAGAAGG + Intronic
1122716682 14:103700380-103700402 GGCCAGGCCAGCCATGCCAATGG - Intronic
1123994477 15:25709025-25709047 AGCACGGTCAGGCATGTAAAAGG - Intronic
1126795674 15:52258921-52258943 AGCAAGGGCAGCCATGTGCAAGG - Intronic
1127045075 15:55017132-55017154 AGCAAAGCCAGGCTTGCACAGGG + Intergenic
1127310979 15:57752213-57752235 AGCAAGGTCAGCACTGCTAAAGG + Intronic
1128799633 15:70489384-70489406 ACCAAGGCCAGAGATTCAAAGGG - Intergenic
1131739546 15:95372916-95372938 AGCAAGGCAATCAATGCCAATGG - Intergenic
1132074115 15:98805419-98805441 AGCAAGACCAGACTTCCAAATGG + Intronic
1135107227 16:19660654-19660676 ACCAATGCCAACCATACAAAAGG + Intronic
1135112234 16:19699294-19699316 AGTAAGGTCACCCCTGCAAAGGG - Intronic
1135824412 16:25713885-25713907 AGCAAGGCCATCCAAGCAACAGG - Intronic
1136248689 16:28989733-28989755 AGGAGGGGCAGCCACGCAAAGGG - Intronic
1137005086 16:35268690-35268712 AACCAGGGCAGCCATGCCAATGG + Intergenic
1139422026 16:66854846-66854868 GGCAGGGCCAGGCCTGCAAATGG + Intronic
1140268401 16:73440722-73440744 ATCATGGCCAGCCTTTCAAATGG + Intergenic
1140866263 16:79065288-79065310 CACAAGTCCAGCCAAGCAAAAGG + Intronic
1141412921 16:83847813-83847835 CGCAAGCCCAGACATGCAGATGG - Intergenic
1141767997 16:86071332-86071354 AGCAATGGCAGCCAGGCAAGTGG + Intergenic
1142178993 16:88658129-88658151 AGCAAGGTCAGCCCTGCTGAGGG + Intronic
1144696037 17:17304354-17304376 AGCAAGGCCAGCTCTGCAAGGGG - Intronic
1144867512 17:18346186-18346208 TGCAATGCCAGCCAAGCAGAAGG + Intronic
1145291171 17:21547093-21547115 AGAAGGGCCAACCATGCAGATGG - Intronic
1148972933 17:51500109-51500131 TGCAAGGGCAGCCAGGCCAAGGG - Intergenic
1151667420 17:75553271-75553293 AACAGGGCCTGCCCTGCAAATGG - Intronic
1151685658 17:75644969-75644991 AGGAAGGCCGGCCAAGGAAAAGG - Intronic
1152225734 17:79091765-79091787 GGCCAGGCCAGCCTTGCAAGGGG - Intronic
1153988704 18:10376242-10376264 AGCTAGCCAAGCCCTGCAAAGGG - Intergenic
1155565905 18:27133787-27133809 AGAAAAGTCAGCCATGGAAATGG + Intronic
1156005682 18:32438369-32438391 AGCCAGGCAAGCCAGGCAGATGG - Intronic
1156440410 18:37181334-37181356 AAAAAGCCCAGCCATTCAAAAGG + Intronic
1156546731 18:37970889-37970911 AGAATGCCAAGCCATGCAAAGGG + Intergenic
1156795439 18:41039893-41039915 AGGAAGCCCACCCATGAAAATGG - Intergenic
1157097345 18:44697909-44697931 TGCAATGCCGGCCATGCAATTGG - Intronic
1157524183 18:48366600-48366622 AGAAAGGCCAGCAACCCAAAAGG + Intronic
1157823415 18:50790444-50790466 TGCCAGGCCAACCATGCAAGTGG + Intergenic
1158269560 18:55697963-55697985 GGCAAGGCTATTCATGCAAAGGG + Intergenic
1158750998 18:60260781-60260803 AGCATGGCCATCCATCCCAATGG - Intergenic
1161975343 19:7605378-7605400 AGCAGGGCCAGCAGTGCAGAGGG - Exonic
1162163655 19:8738268-8738290 ACCAAGACTAGCCATTCAAATGG - Intergenic
1164704891 19:30312929-30312951 AGCAGGCCCTGCCCTGCAAAGGG - Intronic
1165497508 19:36162112-36162134 AGCCAGGTCAGCCATGGCAAGGG + Intergenic
1165706872 19:37982622-37982644 ATCAAAGCCCGCCATGTAAATGG + Intronic
1166012544 19:39953339-39953361 AGAAAGGTCAGCACTGCAAAAGG + Intergenic
1202707262 1_KI270713v1_random:32825-32847 ACCAGGGCCAGCCAGGCAGAGGG + Intergenic
924983668 2:247562-247584 ACCAAGGCCAGCTATCCCAATGG + Exonic
925791582 2:7493738-7493760 AGCATTGCCAGGAATGCAAAAGG + Intergenic
925952008 2:8923552-8923574 TGCAGGGCCAGCCAAGCAGAGGG - Intronic
927395897 2:22650883-22650905 TGCAAGGCAAGACATGCTAAAGG - Intergenic
927502158 2:23590145-23590167 AGGAAGCCCAGCCATGCAGTTGG - Intronic
927711958 2:25331788-25331810 AGCCAGGCCAGGCTTGCAGAAGG - Intronic
930002338 2:46869752-46869774 GGGGAGGCCAGCCAGGCAAAGGG - Intergenic
930030689 2:47056493-47056515 GGCAAGGCCCTCCCTGCAAAGGG + Intronic
931450822 2:62366381-62366403 AGCCAGGCCAGGCATGCAGGGGG - Intergenic
933297307 2:80505014-80505036 ACCAAGGCAAGCCATGAGAAAGG - Intronic
935174494 2:100638009-100638031 AGCATGGACAGCCATGCCAAAGG + Intergenic
936145074 2:109975486-109975508 AGTAAGGCTATCCATGCACAAGG + Intergenic
936181762 2:110273448-110273470 AGTAAGGCTATCCATGCACAAGG + Intergenic
936199610 2:110395981-110396003 AGTAAGGCTATCCATGCACAAGG - Intergenic
936230804 2:110698231-110698253 AGTAAGGCTATCCATGCACAAGG - Intergenic
937010507 2:118558732-118558754 AGCTAGCCCAGCTTTGCAAATGG + Intergenic
937081757 2:119145264-119145286 AGGGTGGCCAGCCAAGCAAAGGG + Intergenic
940886690 2:158995880-158995902 AGCCAGGCCAGAGATGCACAGGG - Intronic
941040578 2:160617953-160617975 AGCAAGACCATTCATGAAAAAGG + Intergenic
941221108 2:162782776-162782798 ACCAAGGCCATCCATGGAACAGG + Intronic
943126650 2:183802637-183802659 AGCAAGGCTATCCTTGAAAATGG - Intergenic
944921243 2:204414845-204414867 AGCAAAGCCATCCATGCCTAGGG - Intergenic
945923082 2:215776275-215776297 ATGAAGTCCAGCCATTCAAAGGG + Intergenic
946884315 2:224207963-224207985 AACAAGGCCTGGCATACAAAAGG - Intergenic
948687971 2:239682727-239682749 AGCAAGAGCAGACATGTAAACGG - Intergenic
1168759896 20:343008-343030 AGCACTGCCAGCCACCCAAAGGG + Intergenic
1169072180 20:2739334-2739356 GGCAGGGCCCTCCATGCAAAGGG - Intronic
1172897501 20:38310742-38310764 AGCAAGGCCTGGCATGCAGGTGG - Intronic
1173300619 20:41799207-41799229 AGCAAGGTAAGCCTTTCAAATGG + Intergenic
1173361891 20:42352128-42352150 ATCAAGGCCAGCACAGCAAAGGG - Exonic
1173787718 20:45806808-45806830 AGAAAGGCCACCCAGGCAATGGG - Intronic
1174078176 20:47952663-47952685 AGAAGGGGCAGCCATGCACAGGG - Intergenic
1177056173 21:16304699-16304721 ATCAAGTACAGCCCTGCAAACGG + Intergenic
1179346582 21:40563985-40564007 AGCAAGGCCAGCCATGCAAAAGG + Intronic
1179503526 21:41824662-41824684 AGCTGGGCCAGCTATGCACAGGG - Intronic
1181722895 22:24789606-24789628 ACCAAGGTCAGCCATGTAGATGG - Intergenic
1182698099 22:32209830-32209852 GGCAAGGCCAGGCATCCAAGGGG + Intergenic
1183302015 22:37063177-37063199 CGCTGGGCCAGCAATGCAAATGG - Exonic
1183573663 22:38673078-38673100 AGCAAGGCCGGCCCTACACACGG - Intronic
1184105833 22:42367118-42367140 AGCAAGGTCAGGCATCCAGATGG - Intergenic
949641770 3:6043961-6043983 AGCAAGGGCAGGGATGAAAATGG + Intergenic
953238330 3:41125855-41125877 AGAAAGGCAACCCATGCAAAGGG + Intergenic
953584837 3:44190170-44190192 AGCATGGGCAGCAATCCAAAGGG - Intergenic
954572150 3:51650085-51650107 AGGAAGACCTGCCAAGCAAATGG + Intronic
954572812 3:51656251-51656273 AGTAAGGCCAGAAATACAAAAGG - Intronic
954801037 3:53186942-53186964 AGCCAGGGCAGCCTTGCAAATGG + Intronic
956510091 3:69984064-69984086 AGTAATGCCAGCCATGAAAGTGG - Intergenic
959738917 3:109693532-109693554 AGAAAGATCTGCCATGCAAATGG - Intergenic
960445668 3:117746025-117746047 AGCAAGGCAAGCCAGTCAATGGG + Intergenic
962951610 3:140224953-140224975 AGGAAGGGCAGCCATAGAAAAGG + Intronic
966077624 3:175957028-175957050 GGCATGGCAAGCCATGCAATGGG - Intergenic
967064196 3:185900347-185900369 AGCAGGGCCAGGCTTACAAATGG - Intergenic
967515548 3:190364565-190364587 AGCAAGGCCAGTCATACCATCGG - Intronic
968802269 4:2751036-2751058 GGGCAGGCCAGCCCTGCAAAGGG + Intronic
969526723 4:7707613-7707635 AGCAAGGGCAACCCTGCAGATGG - Intronic
970208852 4:13685794-13685816 AACAAGGCATTCCATGCAAATGG - Intergenic
972277161 4:37568146-37568168 GGCAAGGCCAGCCTTGGTAAAGG + Intronic
973076823 4:45939424-45939446 AGTAAAGCCAGCCTTCCAAATGG + Intergenic
975629849 4:76388627-76388649 AGCATGTCCAGACATGCACAGGG + Intronic
976828363 4:89284989-89285011 AGCAGTGTCAGACATGCAAAAGG - Intronic
981808151 4:148740889-148740911 GGCTAGGCCAGCCAGGCACAGGG + Intergenic
982719434 4:158844397-158844419 ACAAAAGCCAGCCATGGAAAAGG - Intronic
986025158 5:3843773-3843795 AGCCTCGCCAGCCATGGAAAGGG - Intergenic
986482767 5:8205239-8205261 ACCAGGGGCAGCCATGAAAAAGG + Intergenic
986802664 5:11278237-11278259 GGCAAGGCCAGACATGCAAGAGG - Intronic
990643581 5:57816931-57816953 ACCAAGACCAGCCATGTGAATGG - Intergenic
991657458 5:68918403-68918425 CACAAGGCCAGCCAAGCAGAAGG + Intergenic
992993524 5:82309882-82309904 AGAAAGGCAAGCCACGCAACAGG - Intronic
993254452 5:85571545-85571567 AGCCAGGCCAGTCTTGCAAATGG + Intergenic
994236817 5:97372204-97372226 AGAAAGATCTGCCATGCAAATGG + Intergenic
998140788 5:139698213-139698235 AGCAAAGCCAGGCAGGCAGAAGG - Intergenic
999193634 5:149767151-149767173 AGCAAAGCCAGCAAGGGAAATGG - Intronic
999654223 5:153796891-153796913 AGCAAGGCCTGGAAGGCAAAAGG + Intronic
1000311332 5:160047781-160047803 AGAGAGGCCAGCCATGTGAAAGG - Intronic
1000753457 5:165126196-165126218 ACAAAGGCTAGCGATGCAAAAGG + Intergenic
1002571725 5:180143389-180143411 AGGAAGGCCAGCCCTGAAGATGG + Intronic
1002738477 5:181415772-181415794 AGCAGTGCCTGACATGCAAAAGG - Intergenic
1003974772 6:11331886-11331908 AGCAAGCCCAGACATACAGAGGG + Intronic
1006780349 6:36628157-36628179 GCCAAGGCCAGCTATGCCAAGGG + Intergenic
1011853590 6:91661118-91661140 GGCATGGCCAGCAAGGCAAATGG - Intergenic
1011928083 6:92672965-92672987 TTCAAGGCCAGCCAACCAAAGGG - Intergenic
1015004355 6:128260518-128260540 AGAGAGGCCAGCCATCCAGAAGG + Intronic
1015242027 6:131035227-131035249 AGCAAAGCCAGCAATGACAATGG + Intronic
1016256975 6:142119040-142119062 GCCAAGGGCAGCCCTGCAAATGG + Intergenic
1016393562 6:143598871-143598893 ATCAATGCCAGCCATTTAAATGG - Intronic
1017798360 6:157868880-157868902 ACCAAGGACAGGCATGCACAGGG - Intronic
1019168516 6:170115431-170115453 GGCAGTGCCAGCCCTGCAAATGG - Intergenic
1019243580 6:170691325-170691347 AGCAGTGCCTGACATGCAAAAGG - Intergenic
1020609989 7:10383784-10383806 AGCAACACCACCCCTGCAAAAGG + Intergenic
1021141858 7:17035509-17035531 ATCAAGGCAAGACATGTAAATGG + Intergenic
1021998003 7:26200116-26200138 AGGAAGGCGAGCCATGAAAATGG + Intronic
1022808188 7:33843944-33843966 AGCAAGGACAGGCAGGCACATGG - Intergenic
1023587465 7:41745477-41745499 TGCAAGTCCAGCTAAGCAAAAGG + Intergenic
1024261510 7:47577266-47577288 AACAAAGCCAGGCCTGCAAAGGG + Intronic
1027185454 7:75968272-75968294 AGCAAGGTCAGCCATTCCCAGGG + Intronic
1027440629 7:78215693-78215715 AGCAACCCCAGCCATGGGAATGG + Intronic
1028240407 7:88413395-88413417 AGCAAGGCCATCCATGGTGAAGG + Intergenic
1031345138 7:120656178-120656200 CGCCAGGCCAGCCATGAAAAGGG - Intronic
1034112799 7:148554870-148554892 AGAAAGGTCTACCATGCAAATGG - Intergenic
1034992657 7:155557966-155557988 GGCAAGGCCAGCGAGGCACATGG + Intergenic
1035270045 7:157714380-157714402 CGCAAGCCCAGCCCTGCACAGGG - Intronic
1035504542 8:116833-116855 AGCAGTGCCTGACATGCAAAAGG + Intergenic
1036734445 8:11298569-11298591 AGGAAGATCAGGCATGCAAAAGG - Intronic
1037757922 8:21723426-21723448 AGGAAGGCCAGCAAGGCCAATGG + Intronic
1038280091 8:26156299-26156321 AGCAAAGCCAGCCAAGTAGAAGG + Intergenic
1038646330 8:29365415-29365437 AGAAGAGCCAGCCAGGCAAAGGG + Intergenic
1039305336 8:36255709-36255731 TGAAAGGCCAGCCAAGCAGAAGG - Intergenic
1039508191 8:38067617-38067639 ACCAAGCGCAGCCATGCACATGG + Intergenic
1040880452 8:52199269-52199291 AGCAAGACAAGGCATTCAAAGGG + Intronic
1041782313 8:61590441-61590463 GGCCAGGGAAGCCATGCAAAGGG + Intronic
1041952081 8:63515088-63515110 TGCAAGGCCAGCCAAGCAGAAGG + Intergenic
1042089422 8:65142617-65142639 AGCAAGGCCATCCAGGCCATTGG + Intergenic
1042089553 8:65143981-65144003 AGCAAGAACAACCATGAAAAAGG - Intergenic
1042826661 8:72986483-72986505 AGAAAGACCAGCCATGTGAATGG + Intergenic
1042924713 8:73955179-73955201 CAAAAGGCCAGGCATGCAAAAGG + Intronic
1048768931 8:137874313-137874335 CTCAAAGACAGCCATGCAAAGGG - Intergenic
1051431480 9:16984749-16984771 AGGAAGGGCAGGGATGCAAAGGG + Intergenic
1053568253 9:39276069-39276091 AGGAAGGTCTGCCAAGCAAAGGG + Intronic
1053834227 9:42116823-42116845 AGGAAGGTCTGCCAAGCAAAGGG + Intronic
1054128890 9:61342941-61342963 AGGAAGGTCTGCCAAGCAAAGGG - Intergenic
1054596322 9:67070586-67070608 AGGAAGGTCTGCCAAGCAAAGGG - Intergenic
1054997020 9:71403424-71403446 AGCAAAGCAAGAAATGCAAAAGG + Intronic
1062500726 9:136850913-136850935 GGCAGGGCCAGCCCTGCAAGAGG - Exonic
1203603769 Un_KI270748v1:40548-40570 AGCAGTGCCTGACATGCAAAAGG - Intergenic
1188184430 X:27096365-27096387 AGCAAGGCCAAAAATGGAAATGG - Intergenic
1188496689 X:30789753-30789775 GGCAAGGCAAGGCAAGCAAAAGG - Intergenic
1188497134 X:30792782-30792804 GGCAAGGCAAGGCAAGCAAAAGG - Intergenic
1188497286 X:30793855-30793877 GGCAAGGCAAGGCAAGCAAAAGG - Intergenic
1188588607 X:31806694-31806716 AGCAAGGCCATGGATGCAAGTGG - Intronic
1189327625 X:40122443-40122465 AACAAGGACAACCATGCAGAAGG - Intronic
1193018037 X:76757857-76757879 AGGAAGGCCTACCAAGCAAATGG + Intergenic
1194208669 X:91041605-91041627 AGAAAGATCAGTCATGCAAATGG + Intergenic
1195082557 X:101385327-101385349 AGAAAAGCAAGCCATGCACATGG + Intronic
1197837567 X:130711855-130711877 AGCCAGGCCAGCCCTCCAGATGG + Intronic
1198277490 X:135110181-135110203 AGTAAGATCAACCATGCAAATGG - Intergenic
1198442732 X:136679753-136679775 AGCAAAGACAGCCATAGAAAGGG + Intronic
1199519321 X:148717685-148717707 AGCGGGGGCAGCCATTCAAAGGG + Intronic
1200772218 Y:7136890-7136912 AGGAAGACCTGCCAAGCAAATGG + Intergenic