ID: 1179353279

View in Genome Browser
Species Human (GRCh38)
Location 21:40633690-40633712
Sequence TGCTCAGATGGGCCTCCGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 78}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179353279 Original CRISPR TGCTCAGATGGGCCTCCGTC AGG Intronic
900115873 1:1027724-1027746 TGCCCAGATGGGACTCTGTCTGG + Intronic
901525809 1:9823188-9823210 TGCTCAGATGTGCATCAGGCGGG - Intronic
902274321 1:15328342-15328364 TGCTCAGCTGGGTCTCTTTCTGG - Exonic
903772798 1:25774530-25774552 TGCTCAGATGGGGCTCCTGCAGG + Intronic
906926025 1:50117746-50117768 TGGGCAGATGGGCCTCTTTCTGG - Intronic
909391535 1:75126625-75126647 TCCTCAGAAGGGCCTCCGACAGG - Intergenic
911056980 1:93717270-93717292 GGCTCAGCTGGGCCTCCTTCTGG - Intronic
912558316 1:110531989-110532011 TGCTAAGAAGGGCCTCCCTGGGG - Intergenic
913252511 1:116923746-116923768 TGCTCAGATGTGGCTCAGTGTGG - Intronic
920567353 1:206985439-206985461 TGCTCCGATGGGCATCCACCAGG + Intergenic
922824018 1:228504580-228504602 TCCTCACATGGTCCTCCCTCTGG - Intergenic
924578980 1:245306857-245306879 TGCTCATATTGGCATCCTTCAGG + Intronic
1065023038 10:21516703-21516725 TGCCCAGATGGGGCTGCGGCCGG + Exonic
1065117797 10:22499094-22499116 TGGCCAGAGGGGCCTCTGTCTGG + Intergenic
1076818064 10:132924330-132924352 TGCTCAGAGGGCCCAGCGTCAGG - Intronic
1089647889 11:119892167-119892189 GGCTCTGATGTGCCTCCCTCTGG + Intergenic
1092258173 12:6938283-6938305 TGCTCAGATGGGACTACCTGTGG + Intronic
1098606986 12:72403121-72403143 TGCACACATGGGCCTCTCTCAGG + Intronic
1102567318 12:113805194-113805216 TGCTCAGATTGGCCGCCGTGTGG - Intergenic
1108424196 13:50282070-50282092 TGCTTAGATGGTCTTCCTTCTGG + Intronic
1110434954 13:75469025-75469047 TCCTCAGATTGGCCTCCATTAGG - Intronic
1118817184 14:69321881-69321903 AGCTAGGCTGGGCCTCCGTCTGG + Intronic
1120292211 14:82589960-82589982 TGCTCAGGTGGGCCTGGGTACGG + Intergenic
1127656753 15:61062609-61062631 TTCTCAGATGGGCGGCCTTCAGG + Intronic
1129355953 15:74991883-74991905 TGCTCAGAAGGCACTCCGGCAGG + Intronic
1132351191 15:101140743-101140765 TGCCCAGAGGGGTCTCCTTCCGG + Intergenic
1135590034 16:23698515-23698537 TGCTTGGCTGGGCCTCCCTCAGG - Intronic
1138353334 16:56358333-56358355 GGCTCAGAAGGGCCTCTCTCGGG + Intergenic
1138437998 16:57016965-57016987 TTCTCAGATGTGTCTCCGGCAGG + Intronic
1139777209 16:69324018-69324040 AGCTCAGATGGGCCTCCTCCTGG - Intronic
1142224204 16:88869735-88869757 AGCTCAGAGGGGCATGCGTCAGG - Intergenic
1142890647 17:2940481-2940503 TCCTCAGCTGGGCTTCCGCCTGG + Intronic
1142999327 17:3781837-3781859 TGCACATTTGGGCCTCTGTCAGG + Intronic
1143865059 17:9917467-9917489 CCCTCAGATGGGCCTCCCCCTGG - Intronic
1148440865 17:47711034-47711056 TTCTCAGACGGGGCTCTGTCTGG + Exonic
1149867032 17:60156801-60156823 AGCACAGATGGGCCTGGGTCTGG - Intronic
1151509913 17:74552009-74552031 TCCTCAGATGGGCCTGGGTCAGG + Intergenic
1151655960 17:75496127-75496149 GGATCAGATGGGCCTGCGTGGGG + Intronic
1156035359 18:32760589-32760611 AGCTCAGCTGGGCCACCGTATGG - Intronic
1157584977 18:48795204-48795226 TGCTCTGATGAGCCTCTCTCTGG - Intronic
1161327831 19:3671968-3671990 TGCTCAGAGGGGCCACCTCCCGG - Intronic
1165711487 19:38014189-38014211 TGCTCACCTGGGCCTCTGTCAGG + Intronic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
931374634 2:61696157-61696179 CCCTCAGATGGGCCTCACTCCGG - Intergenic
933632155 2:84671166-84671188 TGTTCAGATGGGCCTCTCTGTGG + Intronic
936172067 2:110185447-110185469 TCCTCAGGTGGGCCTCTGACTGG + Intronic
937475316 2:122209823-122209845 TGTTCAGATGGACCTCCTTTTGG + Intergenic
947873079 2:233450445-233450467 TGCTCAGAAGGGGCTGTGTCTGG + Intronic
1170509893 20:17065738-17065760 TGGTCAGATGGGCCTCGACCTGG + Intergenic
1174420133 20:50394071-50394093 TCCTCAGATGGCCCTGCCTCAGG - Intergenic
1179353279 21:40633690-40633712 TGCTCAGATGGGCCTCCGTCAGG + Intronic
1179541563 21:42086196-42086218 TGCTCAGAGGGGCCTCAGCTTGG + Intronic
1181314443 22:21962453-21962475 TGATGAGCTCGGCCTCCGTCAGG + Exonic
1182394359 22:30024803-30024825 GGCTCTGATGGGCATCCATCTGG + Intronic
1182706080 22:32281309-32281331 TGCTCAGATGCGGCCCCGTTGGG - Intergenic
1185042368 22:48511712-48511734 TGGAGAGATGGGCCTGCGTCAGG - Intronic
949650689 3:6155619-6155641 TGATCAGATGGCCCTCTGACAGG + Intergenic
949878693 3:8644814-8644836 TGCTCTGATGGACCACCCTCAGG + Intronic
950225190 3:11227613-11227635 AGCTCAGACAGGCCTCCTTCTGG - Intronic
956728265 3:72174557-72174579 TGATCAGATGGGTCACTGTCTGG - Intergenic
956790239 3:72674527-72674549 TGCTCAGAAGGGCCTGCATTTGG - Intergenic
962235282 3:133701674-133701696 TGCTCAGAGAGGCCTCCCTGGGG + Intergenic
969257469 4:6011910-6011932 TGCTCAGCTGGTCCACCTTCCGG + Intergenic
975492416 4:75003223-75003245 TGCTCAGCTCGGCTTCCTTCTGG + Intronic
978887078 4:113776841-113776863 TGCGCAGATGGGCATCATTCAGG - Intergenic
985379466 4:189377126-189377148 TGCTCAGTTGAGCCTCCTCCAGG - Intergenic
1006117363 6:31782313-31782335 TGCGCTGATGGGCCTCAGGCAGG + Exonic
1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG + Intronic
1014083803 6:117318189-117318211 TCATCAGATGTGCCTCCTTCAGG + Exonic
1020278193 7:6637195-6637217 TGCCCAGCTGGGCCTCGGGCCGG - Intergenic
1025205843 7:56992972-56992994 TGCTCAGATCTGCCTCCCCCAGG - Intergenic
1025666097 7:63583966-63583988 TGCTCAGATCTGCCTCCCCCAGG + Intergenic
1026145820 7:67745600-67745622 TGCTCAGAAGGTCCTTCATCAGG + Intergenic
1028815860 7:95143649-95143671 TTCTCACATGGGCCTCTGCCAGG - Intronic
1036155370 8:6337354-6337376 TGCCCAGGTGTGCCTCGGTCTGG - Intergenic
1036756054 8:11471795-11471817 TGCTCAGATGGGCCACGTTCAGG + Intronic
1040523032 8:48193967-48193989 TGCTCTGATGGGCCTCAGCCAGG + Intergenic
1041343879 8:56875265-56875287 TGCTCACATTGGCCTCTCTCGGG - Intergenic
1048920830 8:139228632-139228654 TGCTCAGAGGGGCCTATGCCTGG - Intergenic
1057130005 9:92648533-92648555 CTATCAGATGGGCCTCTGTCGGG - Intronic
1057164811 9:92917125-92917147 TGCTCACATAGGCTTCCGCCTGG + Intergenic
1059019026 9:110553311-110553333 TGCTTAGATGTGCCTACGTGAGG + Intronic
1060875811 9:127082933-127082955 TGCCCAGATGGGCCTCTTCCTGG - Intronic
1061283291 9:129609460-129609482 TGCTCAGATGGGTCTGAGTTGGG + Intronic
1061494461 9:130963761-130963783 TGCACAGATGGGCCTAGGCCGGG + Intergenic
1186437102 X:9552089-9552111 TCCTCAGATGGGCCACCCTTTGG + Intronic
1197275185 X:124469968-124469990 TGCTCAGATGGGCATACATTAGG + Intronic
1198863545 X:141096293-141096315 CCCTCAGGTGGGCCTCCCTCAGG + Intergenic
1198899144 X:141491094-141491116 CCCTCAGGTGGGCCTCCCTCAGG - Intergenic