ID: 1179355947

View in Genome Browser
Species Human (GRCh38)
Location 21:40659730-40659752
Sequence CCCATTAGGCTGTACCTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 58}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179355947 Original CRISPR CCCATTAGGCTGTACCTGAT GGG Intronic
900462586 1:2808728-2808750 CCCATTAGGCTGTGCTTTCTGGG + Intergenic
908162178 1:61421236-61421258 CCCATTAGGCTGTAACATGTTGG + Intronic
919142817 1:193594489-193594511 GCCATTAAACTGTACCTAATAGG + Intergenic
919384667 1:196905529-196905551 CTAACTAGTCTGTACCTGATGGG - Intronic
1079168828 11:18072582-18072604 CCCATTATGCCATACCTGCTTGG + Intronic
1079556167 11:21760858-21760880 CCCATTAGGCAGTGCCCCATGGG + Intergenic
1080690233 11:34550156-34550178 TGCATTATGCTGTACCTGAGTGG + Intergenic
1081649567 11:44814774-44814796 CCCAGTAGGCAGTACCTTGTAGG - Intronic
1083708242 11:64531240-64531262 CCCCATAGGCTGTAGCTGCTTGG + Intergenic
1084349179 11:68582082-68582104 CTCATGAGGCTGTACCTAACTGG - Intronic
1088294666 11:108278811-108278833 CCCATTAGGTTATGCCTAATGGG - Intronic
1088294667 11:108278811-108278833 CCCATTAGGCATAACCTAATGGG + Intronic
1096620282 12:52860245-52860267 CCCAACTGGCTGAACCTGATTGG - Intergenic
1098292882 12:68974936-68974958 CCCATTTGTCTGTAGCTGCTGGG - Intergenic
1101650860 12:106675918-106675940 CCAATTAGGCAGGACCTGGTGGG + Intronic
1108241791 13:48472183-48472205 CCCATATGGTTGTACCTAATGGG + Intronic
1114499470 14:23157519-23157541 CCCATGAGGCTTTTCATGATGGG + Intronic
1117567974 14:57015851-57015873 CCATTTAAGCTGTACCTGAATGG + Intergenic
1126259147 15:46667460-46667482 CTTATTAGGCTGTACCAGAAAGG - Intergenic
1128200792 15:65805372-65805394 CCCATTAGGCTGGCCTTGAGTGG - Intronic
1132425536 15:101713104-101713126 GCCAATAGGCTGTACCTGTGTGG - Intronic
1139218232 16:65150803-65150825 GCCTTCAGGCTCTACCTGATGGG + Intergenic
1142109053 16:88321581-88321603 CTCATAAGGCCTTACCTGATTGG + Intergenic
1151567924 17:74910195-74910217 CCCAATAGCCTCTCCCTGATGGG + Intergenic
1154039810 18:10843823-10843845 CCCATTGGTCTGGACCTAATGGG - Intronic
929469638 2:42178755-42178777 CCCAGGAAGCTGTCCCTGATTGG + Intronic
941597514 2:167496246-167496268 CCCATGAGGCTGGATGTGATTGG + Intergenic
947038164 2:225884008-225884030 AGCAATAGGCTTTACCTGATAGG + Intergenic
1168963870 20:1887182-1887204 CCCTTTGGACTGTATCTGATGGG - Intergenic
1170221240 20:13944241-13944263 CCCATGGGGCTTTACATGATTGG - Intronic
1174489280 20:50880779-50880801 CCCATGGGGTTGTATCTGATTGG + Intronic
1175808438 20:61844695-61844717 CCCGTGATGCTGTACCGGATGGG - Exonic
1179355947 21:40659730-40659752 CCCATTAGGCTGTACCTGATGGG + Intronic
1181097409 22:20515055-20515077 CCCATAGGGCTGCTCCTGATGGG + Intronic
951544328 3:23810204-23810226 CCCATTGGGCTTTATATGATAGG + Intronic
962356526 3:134698963-134698985 CCAATGAGGCTGTACTTCATTGG + Intronic
964085449 3:152812081-152812103 CCCATTAGGCTGAATCTTAGAGG + Intergenic
977169545 4:93743753-93743775 CCCATTAGGCCCCACCTAATGGG + Intronic
984165729 4:176300734-176300756 CTCATTAAGCTGTATCTGATTGG + Intergenic
988973502 5:36492793-36492815 CCCATTAGGATGTAGATGATTGG - Intergenic
995199632 5:109411392-109411414 CCCTTTAGGGTGTTCCAGATTGG + Intergenic
999066672 5:148694162-148694184 CCCTTTAGGCTGAACATGTTAGG + Intergenic
999665039 5:153904166-153904188 TCCATAAGGCTGTCCCTGAGTGG + Intergenic
1000336704 5:160246701-160246723 CCCATTTGGTTGTAACTGAGGGG - Intergenic
1001476934 5:172057272-172057294 GCCATGAGGCTGTATGTGATGGG - Intronic
1004171681 6:13300130-13300152 CCCACTAGGCTCTACATGATTGG + Intronic
1004467044 6:15895626-15895648 CCCATTAGGCTGTAACTTATCGG + Intergenic
1007307027 6:40914932-40914954 CCATTTAGGCTGCACCTGATGGG + Intergenic
1017862505 6:158412237-158412259 TCCCTGAGGCTGTTCCTGATTGG - Intronic
1019427952 7:986236-986258 CCCACGAGGCTGTATCTGAGGGG - Intronic
1021510850 7:21430289-21430311 TCCATTAGGCTGAAGCTGACTGG - Exonic
1030315389 7:108109156-108109178 CCTATTAGTCTGTACCTTAAAGG + Exonic
1032696104 7:134337721-134337743 CCCATTTGTCTGTACCTGGCTGG - Intergenic
1033230757 7:139595579-139595601 ACAATTAGGCTGTACCTAATTGG + Intronic
1034855515 7:154542710-154542732 TCCATTAGGCTGTACATATTTGG - Intronic
1050907777 9:11027176-11027198 TCCATTAGGTGGTACCTGACTGG + Intergenic
1051669651 9:19496559-19496581 ACCAACAGGCTGTACCTGAAGGG - Intergenic
1052826151 9:33176734-33176756 CCCAGCAGGTAGTACCTGATGGG - Intergenic
1055722979 9:79196604-79196626 CCCATGGGGCTGTACTTAATGGG - Intergenic
1056900789 9:90597458-90597480 CCCATGACGCGGCACCTGATGGG - Intergenic
1057238560 9:93388018-93388040 CCCAAGCGGCTGTACCTGCTAGG + Intergenic
1188844650 X:35058351-35058373 CTCATTAGGCCATACCTGTTTGG - Intergenic
1191258838 X:58291727-58291749 CCCTTTAGGCTGTTCCCCATGGG - Intergenic
1198015075 X:132602261-132602283 CCCATCAGGGTTTAACTGATCGG + Intergenic
1199330268 X:146550815-146550837 TCCACTAGGCAGTACCTGAGTGG + Intergenic