ID: 1179357847

View in Genome Browser
Species Human (GRCh38)
Location 21:40677846-40677868
Sequence ATCAAGGAGGTGGGTAGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 202}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179357847 Original CRISPR ATCAAGGAGGTGGGTAGATT TGG (reversed) Intronic
901410041 1:9076574-9076596 ATCAAGGTGGTGTCTATATTTGG + Intronic
901490751 1:9595170-9595192 ACCAATGAGGTGGGTAGAGGGGG + Intronic
902620588 1:17648521-17648543 AGGAAGGAGGTGGGTAGAGCTGG - Intronic
905476701 1:38233788-38233810 ATCAGAGAGGTGGGCAGAGTGGG - Intergenic
905978848 1:42204283-42204305 ATCAAGGAGGTGGGTGGGGAGGG + Intronic
907084268 1:51655189-51655211 ATCAAGGAGTTGGCTGGACTGGG + Intronic
909140593 1:71859619-71859641 AGCAAGCAGTAGGGTAGATTCGG + Intronic
909696832 1:78476888-78476910 ATGAAGCAGCTGGATAGATTAGG + Intronic
909987700 1:82183141-82183163 ATCAAGTAGCAGGCTAGATTTGG + Intergenic
910662696 1:89690366-89690388 CTCAAGGAGAAGGTTAGATTTGG + Intronic
911041778 1:93596985-93597007 ATCATGGTTGTAGGTAGATTTGG - Intronic
912739080 1:112176860-112176882 CTGAAGCAGGTGGCTAGATTTGG + Intergenic
915988716 1:160491641-160491663 ATCAACTAGCTGGGTAGTTTTGG + Intronic
917502027 1:175594303-175594325 AGCAAAGAGGTGGGAAGAGTGGG - Intronic
920193794 1:204212867-204212889 AACAAGGAGGTGGGTATACCTGG - Intronic
920309074 1:205037990-205038012 ATCAATAAGGTGGGTGGAATTGG + Intergenic
921686059 1:218090478-218090500 ATCTGGGAGATGGGTAGATCAGG + Intergenic
921871182 1:220141618-220141640 TTCAAGGAGGTGGGTACACCTGG + Intronic
923623826 1:235598181-235598203 GTCATGGAGGTGGGTAGAGCAGG - Intronic
1063348639 10:5335121-5335143 ATAAAGGTGCTGGGTAAATTGGG + Intergenic
1066586928 10:36945748-36945770 AACATGGAGGTGGGTAGAGATGG - Intergenic
1067816071 10:49477665-49477687 AGCAAGGAGGAGGGTAGAAGAGG - Intronic
1068545265 10:58337370-58337392 ATCAAGGAGGTAGGTAAAGGAGG - Intronic
1071086008 10:81869616-81869638 ATCAAGGAGATGGGTTAAGTGGG - Intergenic
1072736622 10:97883496-97883518 ATGAATGAGGTGGGTGGATGGGG + Intronic
1076295305 10:129379125-129379147 AACAAGGAGCTGGTTGGATTTGG + Intergenic
1077789975 11:5428798-5428820 AACAAGGAGGTGATTAGTTTGGG - Intronic
1079997783 11:27314013-27314035 ATATAGCAGGTGGGTAGATCAGG + Intergenic
1084527493 11:69705860-69705882 ATCAGGGAGGTGGGGAAATGAGG + Intergenic
1085901338 11:80703371-80703393 AACATGGAGGTGGGTAGAGATGG + Intergenic
1086346700 11:85904434-85904456 TTCAAGTAGAAGGGTAGATTGGG - Intronic
1087116721 11:94533394-94533416 AACAAGGTGGTGGCTAGAATTGG - Intergenic
1088427702 11:109723118-109723140 ATCAAGGGCGGGGGTAGAGTGGG - Intergenic
1089126823 11:116182198-116182220 ATCTAGGAGCTGGGTGTATTAGG - Intergenic
1089391943 11:118108255-118108277 ATCAAGAAGGTGGGGAGCTCTGG - Intronic
1091555685 12:1571833-1571855 AACAAGGAGATGGGAAGATCTGG - Intronic
1091985619 12:4908807-4908829 ATTAAGGAGGTGGGTGGTGTAGG + Intergenic
1092966932 12:13653141-13653163 ATCAAAGAGATGGATAGATGAGG + Intronic
1093487987 12:19673494-19673516 GTCAAGGTGGTGGTTACATTTGG - Intronic
1094353994 12:29558123-29558145 ATTATGGAGCTGTGTAGATTTGG - Intronic
1096161858 12:49385574-49385596 ATCAAGTAGGTGGATTGAATTGG + Intronic
1097136640 12:56862619-56862641 ATAGAGGGGGTAGGTAGATTAGG - Intergenic
1097371824 12:58792313-58792335 TTCAAGGATGTGGAGAGATTGGG + Intronic
1098144527 12:67485171-67485193 ATCAAGGAGGTTGGTGGTTTTGG - Intergenic
1098304318 12:69087257-69087279 ATAAAAGAGGTGCGTAGAGTGGG + Intergenic
1099954108 12:89336054-89336076 CTCAAGGAGGTGCTTAGAATTGG - Intergenic
1102952753 12:117041168-117041190 ATCAGGGAGGAGGGCAGAGTGGG + Intronic
1106898142 13:34327463-34327485 ATCAAGAAGGAGAGTAGGTTGGG - Intergenic
1107190742 13:37582225-37582247 ATCAGGGAACTGGGTAGCTTGGG - Intronic
1107882102 13:44841754-44841776 ATCAATGAAGGGGGTAGGTTTGG - Intergenic
1108067618 13:46594526-46594548 CTCAAGGAGGTGGCCTGATTTGG - Intronic
1108200962 13:48042537-48042559 AACAAGGAGGGGGTTAGTTTTGG + Intronic
1110091503 13:71454533-71454555 ATCAAGCAGGTGAATAGATCTGG - Intronic
1110102575 13:71627958-71627980 ATCAGTAAGGTTGGTAGATTGGG - Intronic
1110619976 13:77584539-77584561 CTCAAAGAGGTGGGTAAATATGG - Intronic
1112858847 13:103805866-103805888 ATCAAGGAAGTGGGTGGGGTGGG + Intergenic
1116933304 14:50711995-50712017 ATGCAGGAAGTGGGTAGAGTTGG + Intergenic
1117008023 14:51442285-51442307 AGAAAGGAGGAGGGAAGATTAGG - Intergenic
1118299993 14:64606705-64606727 GTCAAGGAGGTGAGGAGTTTGGG + Intergenic
1119139856 14:72256619-72256641 AACAAGGAGGGGGTTAGTTTTGG + Intronic
1120414143 14:84197879-84197901 ATCAAGGAGGTGGAATGAGTGGG + Intergenic
1120632623 14:86909586-86909608 ATGTTGGAGGTGGTTAGATTTGG - Intronic
1121016786 14:90553744-90553766 TTCAGGGAGGTGGGGAGAGTGGG - Intronic
1121528808 14:94638365-94638387 TTGGAGGAGGTGGGGAGATTCGG - Intergenic
1121939830 14:98059494-98059516 AGAAAGGAGGAAGGTAGATTAGG + Intergenic
1124880343 15:33636389-33636411 ATCAAGGAAGTGGGTATTTTGGG + Exonic
1125308438 15:38350193-38350215 ATCAAGGTTGTTGGTAGGTTTGG + Intronic
1126376458 15:48001731-48001753 AAGAAGGAGGTGGGTAGAAAGGG + Intergenic
1126585955 15:50287612-50287634 ATCAAGGTGTTGGGCAGGTTTGG - Intronic
1126610695 15:50526664-50526686 TACAAGGAGGCAGGTAGATTTGG + Intronic
1133245716 16:4447534-4447556 ATGAAGGAGGTGGGCATTTTGGG + Intronic
1134340630 16:13342035-13342057 AGGGAGGAAGTGGGTAGATTTGG - Intergenic
1135638702 16:24101202-24101224 AGCAAGGAGATGGTTAGTTTTGG + Intronic
1139282739 16:65784440-65784462 ATGCAGGAGGTAGGTGGATTCGG + Intergenic
1139329537 16:66176658-66176680 AGGAAGGAGGTGAGCAGATTGGG + Intergenic
1140245447 16:73244288-73244310 ATCAAAGGGGTGGGCGGATTTGG + Intergenic
1140594838 16:76396406-76396428 ATCAAGGAGGTAGGAAGAATGGG + Intronic
1145852594 17:28115936-28115958 ATCTAGGTGGTGGGTATAATGGG - Intronic
1146960295 17:36969270-36969292 TTCTAGGAGGTGGGTAGGCTTGG + Intronic
1149014194 17:51889229-51889251 ATCAAGCAGGTGGGCAGGTATGG + Intronic
1153331044 18:3875273-3875295 ATTACGGAGTTGGGTAGATTTGG + Intronic
1153369098 18:4294307-4294329 CTCAAGGAGGTGGTGACATTGGG - Intronic
1155625814 18:27833467-27833489 ATTGAGAAGGTGGGTGGATTTGG - Intergenic
1156453301 18:37278878-37278900 AGAAAGGAGGTGGGCAGAGTGGG - Intronic
1157004397 18:43564468-43564490 GCCAAGGATGTGGGTAGGTTAGG + Intergenic
1159212467 18:65343458-65343480 ATCAAGGTGTTGGCAAGATTGGG - Intergenic
1159277642 18:66241932-66241954 ATCATGGAGGTGGGAAGGATTGG - Intergenic
1159490913 18:69133155-69133177 AGCAAGGAGGGGGTTAGTTTTGG + Intergenic
1159603921 18:70455181-70455203 ATCAAGCAAGTGCGAAGATTTGG - Intergenic
1167533261 19:50032157-50032179 ATGAAGGAGGTGGGAAGACGGGG - Intronic
925321068 2:2969005-2969027 AGCAGGGAGGTGGGAAGATATGG + Intergenic
928208998 2:29309772-29309794 ATCAACGAAGTGGGTTTATTGGG + Intronic
928343753 2:30470448-30470470 AACAAGGAGGGGGTTAGTTTTGG + Intronic
929555315 2:42922142-42922164 GTCAAGGAGGGCAGTAGATTAGG - Intergenic
931134950 2:59388069-59388091 ATTGAGGAGGTTGGTTGATTTGG + Intergenic
931761395 2:65420294-65420316 AACACGGAGGTGGGTACAATGGG - Intronic
932744387 2:74320557-74320579 ATCAAGTGGGAGGGTAGAATAGG + Intronic
933805603 2:85996509-85996531 AGGAAGGAGGTGGGTATCTTTGG + Intergenic
934156154 2:89203046-89203068 TTGAAGGAGGTGGGAAGATGTGG - Intergenic
934211163 2:89979717-89979739 TTGAAGGAGGTGGGAAGATGTGG + Intergenic
934493786 2:94780575-94780597 ATTAAGGGGGTGGGGAGAGTTGG - Intergenic
936487846 2:112942145-112942167 AGCAAGCAGGTGAGTAGAGTTGG + Intergenic
936578291 2:113673335-113673357 CTCAAGGAAGTGGCGAGATTTGG - Intergenic
938951371 2:136257803-136257825 ATCTAGGAGGTGGGGAGGTGAGG + Intergenic
939288014 2:140157387-140157409 TCCAAAGAGGTGGGCAGATTTGG - Intergenic
939804864 2:146762497-146762519 ATCAAGGATGTGACAAGATTTGG + Intergenic
940663415 2:156575726-156575748 AGCAAGCAGATGGCTAGATTAGG + Intronic
941669821 2:168281521-168281543 TTCTTGCAGGTGGGTAGATTGGG - Intergenic
941669831 2:168281577-168281599 TTCTTGCAGGTGGGTAGATTGGG + Intergenic
943309509 2:186309228-186309250 TTCAAGGAAGTGGTTAGAATAGG + Intergenic
946387999 2:219397507-219397529 ATCAAGAATGTGGGTGGAATAGG + Intronic
947093315 2:226538047-226538069 ATCATGGAGGTGGGTCTTTTTGG - Intergenic
1169744297 20:8927988-8928010 AATAAGGAGGTGGGTACAGTAGG + Intronic
1169971962 20:11278151-11278173 ATCAATGAGATGGGAAAATTAGG - Intergenic
1173582751 20:44159220-44159242 ATGAAGGAATTGGGTGGATTTGG + Intronic
1175407363 20:58743927-58743949 GGTAGGGAGGTGGGTAGATTGGG + Intergenic
1177254582 21:18644432-18644454 CTCAAAGAAGTGGTTAGATTTGG - Intergenic
1179254415 21:39702767-39702789 ATCAAGCAGGTGGGTGGGATTGG - Intergenic
1179357847 21:40677846-40677868 ATCAAGGAGGTGGGTAGATTTGG - Intronic
1179624800 21:42642873-42642895 ATCAAGGTGGTGGTGAGAATGGG + Intergenic
1179980202 21:44891652-44891674 CTGCAGGAGGTGGGGAGATTTGG - Intronic
1182131816 22:27859536-27859558 ATCTAGGAGGAGGGGAGAATTGG - Intronic
1183615839 22:38944806-38944828 AGCAAGGGGGTGGGAAGATCTGG + Intergenic
1185379585 22:50502291-50502313 ATGAGGGAGCTGGGTACATTGGG + Intergenic
951681974 3:25304379-25304401 GTCATAGAGGTGGGAAGATTTGG - Intronic
951702738 3:25512347-25512369 AGCAAGGTGATGGGTAGATGGGG + Intronic
953414163 3:42705944-42705966 ATCAAGGAGGTTGGGAACTTGGG + Intronic
955781661 3:62491138-62491160 ATGGAGGAGGTGGGTAGGGTAGG - Intronic
956075028 3:65496014-65496036 AGCAAGGGGGTGCGTTGATTTGG + Intronic
959378352 3:105612066-105612088 AGCAAGGAGGGGGTTAGTTTTGG + Intergenic
960943432 3:122949553-122949575 AGCAAGGAGGTGGTTTGCTTTGG - Intronic
961021682 3:123512922-123512944 ATCCAGGATCTGGGTAGATGAGG - Intronic
962944062 3:140151540-140151562 ATCAGGGAGGTGGCTTGATCTGG + Intronic
963545296 3:146649990-146650012 AGCAAGTAGGTCGGTAGACTGGG - Intergenic
964081226 3:152760461-152760483 AACAGGCAGCTGGGTAGATTTGG - Intergenic
964295547 3:155229051-155229073 GTCAAGGAAGAGGGTAGAGTTGG + Intergenic
967002071 3:185345296-185345318 ATTGAGGAGGTGGGAGGATTTGG - Intronic
967713477 3:192736563-192736585 ATCAAGGCTGCTGGTAGATTTGG - Intronic
968041009 3:195589274-195589296 ATGAAGGAGCTGTGTAGATCAGG + Intergenic
971724555 4:30293750-30293772 AGCAAGGAGGTAAGCAGATTTGG - Intergenic
971756246 4:30712213-30712235 TTCAAGGAGGTAGTTAGAATTGG + Intergenic
972544785 4:40070109-40070131 ATCAAGCAGGTGGGTACCTGTGG - Intronic
975681119 4:76877196-76877218 AGCAAGGAGTCGGGTAGATAGGG + Intergenic
976040137 4:80874314-80874336 ATCAAGGAGCTAGGTAGTTGCGG - Intronic
978755143 4:112293712-112293734 ATCCTGGTGGTGGGTGGATTAGG - Intronic
980619769 4:135285541-135285563 AGCAAGGAGATGAGTACATTTGG - Intergenic
981375132 4:144006376-144006398 ACCAAGGAGGTGGGGTGACTTGG + Intronic
982403543 4:154995549-154995571 ATCAAGGAGGTGAGTACAGCTGG - Intergenic
987031513 5:13980589-13980611 AGCTAGGAGGTGGTCAGATTTGG - Intergenic
988727968 5:33942516-33942538 ATCTAGGAGGTGGGAGGACTAGG - Intergenic
989342525 5:40392196-40392218 CTCAAAGCGATGGGTAGATTAGG + Intergenic
989463776 5:41730663-41730685 ATAAACATGGTGGGTAGATTAGG - Exonic
992771155 5:80049720-80049742 CTTAAGGTGGTGGGAAGATTAGG + Intronic
994304015 5:98180512-98180534 AGCTAGGAGGTGGGTAGCCTGGG + Intergenic
994518793 5:100802762-100802784 CTCAAGGAGGTTTGTGGATTAGG - Intergenic
994787114 5:104179662-104179684 ATGGAGGAAGTGGGTTGATTTGG - Intergenic
996204542 5:120716205-120716227 GTCAAGGAGGGTGGCAGATTTGG - Intergenic
996772798 5:127102628-127102650 TTCAATGCGCTGGGTAGATTGGG - Intergenic
1002402913 5:179001936-179001958 ATCAATGAAGTGGGAAAATTAGG + Intergenic
1003693084 6:8374127-8374149 AGCAAGGAGGGGGTTAGTTTTGG + Intergenic
1004279897 6:14271666-14271688 TTCTAGGAGGTGCATAGATTTGG - Intergenic
1005978497 6:30818059-30818081 TACAAGGAGGTGGGTAGAAAAGG - Intergenic
1007603346 6:43097669-43097691 ATCATGGAGGTGGGGATGTTTGG - Intronic
1008002070 6:46370999-46371021 ATAAATTATGTGGGTAGATTTGG + Intronic
1008734066 6:54520517-54520539 ATAAAGGAGGAAAGTAGATTGGG + Intergenic
1009861846 6:69344811-69344833 AACAATGAGGTTGGAAGATTAGG + Intronic
1011108977 6:83815018-83815040 GTCAAGGAGATGGGAAGATTTGG + Intergenic
1011438844 6:87366899-87366921 AACTAGGAGGAGGGTAGTTTTGG + Intronic
1014714901 6:124852104-124852126 ATCTAGGAGGTAGGTAGAAATGG + Intergenic
1015407833 6:132857296-132857318 GGCAAGGAGGTGGGGAGAGTGGG + Intergenic
1015649215 6:135436008-135436030 TTTAAGGAGGTGGGTAAGTTTGG + Intronic
1016680628 6:146825048-146825070 AACAAGGAGGCGGGTAGTTTTGG + Intergenic
1016714978 6:147215168-147215190 ATCAAGCAGTTGGCTGGATTTGG + Intronic
1017140288 6:151183932-151183954 ATAAAGGAGGTGGTTAGGTTTGG - Intergenic
1021640006 7:22727626-22727648 AGAAAGGAGGTGGGTAGGCTTGG + Exonic
1024871893 7:53973160-53973182 ATGAAGGATGGGGGTATATTTGG - Intergenic
1025734545 7:64135492-64135514 AGCAAGGAGGGGGTTAGTTTCGG - Intronic
1025772756 7:64528404-64528426 AGCTAGGAGGTGGGTAGCCTGGG + Intronic
1026155860 7:67825098-67825120 GTCAAGGATGTGGGGAGCTTAGG - Intergenic
1031035185 7:116781030-116781052 ATAAAGGAGGAGGTTAGATAAGG - Intronic
1032699017 7:134362525-134362547 ATCTAGGAGGTCTGTAGACTTGG - Intergenic
1033283585 7:140022474-140022496 ATCTGGGAGCTGGGGAGATTTGG - Intergenic
1033397682 7:140991464-140991486 ATGAAGGAGGGGGAGAGATTAGG + Intergenic
1033719006 7:144036994-144037016 GTCAAGGGGGTGGTTAGACTTGG + Intergenic
1035036290 7:155897401-155897423 TTCAAGTAGGTGGGAAGTTTGGG + Intergenic
1036763297 8:11528000-11528022 AGCAAGGAGGGGGTTAGTTTTGG + Intronic
1037875788 8:22547460-22547482 TTCAAGGAGGTGGGAAGACAAGG + Intronic
1038959004 8:32498176-32498198 ATCAAAGAAGTGGTTAGACTAGG + Intronic
1039113627 8:34067796-34067818 AACAAGGAGGTTGTTAGTTTTGG - Intergenic
1041606980 8:59793129-59793151 AGGAAGGAGGTGGGAAGAGTGGG + Intergenic
1042452527 8:68965376-68965398 AACAAGGAGGTGAGTAGAAGCGG - Intergenic
1042749910 8:72147315-72147337 ATCAAGGTCATGGGTAGAGTTGG + Intergenic
1045663253 8:104459983-104460005 CTCAACGAGGGGGCTAGATTTGG - Intronic
1047583210 8:126239749-126239771 GCTAAGGAGGTGGTTAGATTTGG + Intergenic
1051874452 9:21776634-21776656 AGCAAGGAGGTTGGTAGATTTGG + Intergenic
1052467046 9:28841652-28841674 ATCTAGGAGGTGGGTGGGTTGGG + Intergenic
1054905420 9:70410682-70410704 ATCAAGAAGGTGGGCAGAGATGG - Intronic
1057414237 9:94847092-94847114 TGCAGGGAGGTTGGTAGATTTGG + Intronic
1058397967 9:104577846-104577868 ATCAAGGAGGTGGAGAAATAGGG + Intergenic
1058630229 9:106979005-106979027 ATCAAGGAGATGGCCAAATTGGG - Intronic
1059078237 9:111218147-111218169 ATCAATGAGGTGGTAAGATAGGG - Intergenic
1060495911 9:124118500-124118522 AGCAGGGAAGAGGGTAGATTTGG - Intergenic
1061257170 9:129459821-129459843 ATCAGGGAGGTGGGAAGGCTGGG + Intergenic
1186701288 X:12092914-12092936 GTCAATGAGGTGGTTAGAATAGG + Intergenic
1191903217 X:66060099-66060121 ATCAAAGAGGTGGATGAATTAGG - Intergenic
1195307798 X:103602940-103602962 ATCAGGGAGGTGGTCAGATGTGG - Intergenic
1196138477 X:112234951-112234973 ATCAAGTGGGAGGGTAGATTTGG + Intergenic
1196704840 X:118708132-118708154 AGCAGGGAGGTTGGTAGATTTGG - Intergenic
1196966741 X:121064730-121064752 ATCAGGGAGGCTGGTAGAGTGGG - Intergenic
1197812596 X:130460673-130460695 TTCAATGAGGTGAGTATATTAGG - Intergenic
1198623004 X:138534478-138534500 CTCAAGGAGGTGGATTGATTTGG - Intergenic
1199484833 X:148336579-148336601 ATAAAGGAGTTGGGTTTATTAGG + Intergenic
1199527904 X:148812601-148812623 ATCAGGGAGGTGGGAAAGTTGGG - Intronic
1200066367 X:153505974-153505996 ACCAGGGAGCTGGGTAGGTTGGG - Exonic
1201315764 Y:12643947-12643969 AGCTAGGAGGTGGGTAGCCTGGG + Intergenic