ID: 1179357890

View in Genome Browser
Species Human (GRCh38)
Location 21:40678468-40678490
Sequence TCGGAGCCAGTGATAGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 141}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179357890 Original CRISPR TCGGAGCCAGTGATAGAGAT GGG Intronic
906949292 1:50321483-50321505 TCTGAGCTAGTGATAGTGCTGGG + Intergenic
907775128 1:57506753-57506775 TTGGAGCCATTGATAGAAACTGG - Intronic
907947701 1:59150895-59150917 TCAGATCCAGAGATAGACATGGG - Intergenic
911118635 1:94272551-94272573 TCCAAGCCAGTGATTGAAATGGG + Intronic
911537706 1:99120272-99120294 TCGTAGCGACTGATAGAGCTAGG - Intergenic
911743969 1:101418941-101418963 TAGAAGCCAGGGATAGAGATTGG + Intergenic
915316742 1:155033063-155033085 TGGGAGACAGTGGTAGAGGTGGG + Intronic
916880792 1:169017971-169017993 TCGGGGTCAGTGAGAGAGAGAGG + Intergenic
917698982 1:177561034-177561056 ACGAAGCCAGGAATAGAGATGGG + Intergenic
917981968 1:180275226-180275248 TCAGAGTCAATGATATAGATGGG - Exonic
919934461 1:202242383-202242405 TCGTAGCTAGTGATAGAGCTAGG - Intronic
920248776 1:204608249-204608271 TGGGAGCCAGAGTGAGAGATGGG + Intergenic
921134117 1:212244959-212244981 TCAGAGTGAGTGAGAGAGATGGG + Intergenic
922717197 1:227883910-227883932 TCGGGGCCAGAGCTAGGGATGGG - Intergenic
923021577 1:230168134-230168156 TCGGAGCAAGTGTTAGAAAATGG + Intronic
923736643 1:236615518-236615540 TTGGAGCAAGTGATGGAGTTTGG + Intergenic
1064371233 10:14753299-14753321 TAGGAGCCAGTGGCAGAGCTTGG - Intronic
1066828207 10:39635842-39635864 TCGAAGACAGTGATAGAAAAGGG + Intergenic
1066847486 10:40042884-40042906 TCGAAGACAGTGATAGAAAAGGG + Intergenic
1066851038 10:40113500-40113522 TCGAAGACAGTGATAGAAAAGGG + Intergenic
1066872959 10:40548898-40548920 TCGAAGACAGTGATAGAAAAGGG + Intergenic
1066874305 10:40575716-40575738 TCGAAGACAGTGATAGAAAAGGG + Intergenic
1066874733 10:40583849-40583871 TCGAAGACAGTGATAGAAAAGGG + Intergenic
1066904894 10:41179261-41179283 TCGAAGACAGTGATAGAAAAGGG + Intergenic
1066911641 10:41311394-41311416 TCGAAGACAGTGATAGAAAAGGG + Intergenic
1066912130 10:41320901-41320923 TCGAAGACAGTGATAGAAAAGGG + Intergenic
1068044680 10:51871386-51871408 TCAGAACCAGTCCTAGAGATGGG - Intronic
1069679498 10:70273919-70273941 TCAGAGAAAGTGTTAGAGATGGG + Intronic
1069788321 10:71003967-71003989 TCGGAGTGAGAGAGAGAGATGGG - Intergenic
1072531264 10:96321681-96321703 TTGCAGCCAGTGCTAGAGAGAGG - Intronic
1073519305 10:104111675-104111697 TTGAAGCCAGGGATGGAGATAGG - Intergenic
1075316448 10:121457461-121457483 CCGGGGCCAGTGATAGAGTTTGG - Intergenic
1078271400 11:9798361-9798383 AAGGAGCCAGTGATGGAGAGGGG + Intronic
1079093442 11:17496099-17496121 TAGGAGACAGTGAGAGAGAAAGG + Intronic
1080050881 11:27857772-27857794 CAGGAGCCAGAGATAGAGAATGG - Intergenic
1084174081 11:67414730-67414752 GCGGAGCGAGCGAGAGAGATAGG + Intronic
1085867994 11:80317452-80317474 TTGGGGCCAGTGAGACAGATTGG - Intergenic
1089551156 11:119279326-119279348 TTGGAGTCAGGGGTAGAGATAGG - Intronic
1096079998 12:48826897-48826919 GCTGCGGCAGTGATAGAGATGGG + Intronic
1100700335 12:97140496-97140518 TCAGAGGAAGTGTTAGAGATGGG - Intergenic
1103031879 12:117621870-117621892 TAGGAGACAGTGGTAGAGGTTGG - Intronic
1105801219 13:23904204-23904226 TAGGAGGGAGTGAAAGAGATGGG - Intergenic
1105847664 13:24307724-24307746 TAGGACACAGTGAAAGAGATGGG + Intronic
1105944824 13:25180240-25180262 TGGGAGCAGGCGATAGAGATTGG - Intergenic
1108291485 13:48966218-48966240 TTGTAGCCAGGGAGAGAGATTGG + Intergenic
1120715965 14:87840955-87840977 TCTGGGCCAGTGATATAGTTTGG - Intronic
1125164771 15:36690005-36690027 GCAGAGCCAGTTGTAGAGATAGG + Intronic
1125687503 15:41572337-41572359 GCAGAGCCAGAGCTAGAGATGGG + Intronic
1125934009 15:43619001-43619023 TAGGAGCCAGTGATGCAGAAAGG + Intergenic
1125947106 15:43718463-43718485 TAGGAGCCAGTGATGCAGAAAGG + Intergenic
1128736687 15:70057619-70057641 TAGGAGCTGGTGATGGAGATGGG + Exonic
1129057339 15:72830076-72830098 CAGGAGCCAGGAATAGAGATGGG - Intergenic
1129718796 15:77866627-77866649 TGGGGGGCAGTGAGAGAGATGGG - Intergenic
1131022957 15:89115106-89115128 TGGTAGCCAGTGCTAGAGACAGG - Intronic
1137238549 16:46635291-46635313 TGGTAGCCAGAGATAGAGAGAGG + Intergenic
1140776926 16:78257442-78257464 TCCGAGCCAGGGATGGAGCTGGG + Intronic
1141320492 16:83004220-83004242 TAGGAGTCAGGGATAAAGATAGG + Intronic
1141727822 16:85801063-85801085 TCAGAGACAGTGATAAAGAATGG + Intronic
1147613055 17:41812743-41812765 TCGCAGCCAGGGATGGAGATGGG + Intronic
1147620389 17:41862835-41862857 TGGGAGCTAGAGATACAGATTGG - Intronic
1149851604 17:60039593-60039615 TCGGAGCCTGGCATAGAGAGAGG - Intergenic
1153262729 18:3240282-3240304 TCAGAGCCAGTGATATGGTTTGG + Intergenic
1153316614 18:3728922-3728944 TGGATGCCAGAGATAGAGATGGG + Intronic
1155412040 18:25557113-25557135 TAAGAGCCAGTGATTGAGAAGGG - Intergenic
1156065817 18:33141270-33141292 TTGGGGCAGGTGATAGAGATGGG + Intronic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1163186157 19:15640977-15640999 TCCTAGCCTGTGATGGAGATGGG + Intronic
1165818797 19:38661076-38661098 GCGGAGCCCGTGGAAGAGATGGG + Intronic
1167278791 19:48554349-48554371 TCTGAGCCAGTGATGGGGAGGGG - Intronic
1167633248 19:50638889-50638911 TCGGAGCCAGGCATCAAGATGGG + Intronic
929586406 2:43117641-43117663 TTGAAGCCAGGAATAGAGATGGG - Intergenic
932592940 2:73078079-73078101 TAGGAGCCTGTGCTAGGGATGGG + Intronic
933873953 2:86599621-86599643 TGAAAGCCAGTGTTAGAGATTGG + Intronic
934108770 2:88722496-88722518 TCGGAGACAGTGAAGAAGATAGG + Intronic
935513031 2:103999998-104000020 TCAGAGACAGTGAGAGAGAGCGG + Intergenic
938128049 2:128688707-128688729 TCGCAGCCAGTGAAAGGTATAGG - Intergenic
939158411 2:138554606-138554628 AAGTAGCCAGAGATAGAGATTGG + Intronic
940144700 2:150533736-150533758 TGTGAGCCATTGATAGAGAAAGG - Intronic
941293417 2:163704519-163704541 TCATAGCCATTGACAGAGATGGG - Intronic
944346096 2:198667446-198667468 TCTGAGCCACTGCTACAGATGGG - Intergenic
946078877 2:217099454-217099476 ACACAGACAGTGATAGAGATAGG - Intergenic
947824137 2:233092822-233092844 TGGGAGCCACTGACAGTGATGGG - Intronic
1172573528 20:35988670-35988692 TTGCAGCCAGAGACAGAGATTGG + Intronic
1175051662 20:56161172-56161194 GAGGAGCCAGTCCTAGAGATAGG - Intergenic
1178340449 21:31781723-31781745 TGGGTGCCATTGACAGAGATGGG - Intergenic
1178826484 21:36021250-36021272 TCAAAGCCAGTGATGGAGAGAGG + Intergenic
1179357890 21:40678468-40678490 TCGGAGCCAGTGATAGAGATGGG + Intronic
1180613259 22:17111052-17111074 AGGGAGGCAGTGAGAGAGATCGG + Exonic
1180634659 22:17254695-17254717 TAAGACCCTGTGATAGAGATGGG - Intergenic
1180966427 22:19790292-19790314 TGGGAGGCACTGAGAGAGATGGG + Intronic
1182869724 22:33635386-33635408 TCAGAGCCAGTGAATGAGACAGG - Intronic
1183077285 22:35435180-35435202 TGGGAGGCAGGGAGAGAGATGGG + Intergenic
1184719330 22:46300731-46300753 TCGGAGCCAGTCACAGAGCCTGG + Intronic
952116695 3:30190342-30190364 TAGGAGCCAGGGATATAAATTGG + Intergenic
956250257 3:67228081-67228103 TCAGAGCCAGTGAAAGAGACAGG + Intergenic
962674873 3:137748289-137748311 TGGGAGCATGTTATAGAGATGGG - Intergenic
964591237 3:158364287-158364309 TCGGAGCCATAGATAGTGAGTGG - Intronic
965152889 3:165005012-165005034 TAGGAGACAGAGATAGTGATGGG - Intronic
966042429 3:175508077-175508099 CAGGAGCAAGTGATAGAGAGTGG + Intronic
966470472 3:180283296-180283318 TAGAAGCCAGAGATAGAGATGGG - Intergenic
971263738 4:25079788-25079810 TCTGAACCAGAGGTAGAGATGGG + Intergenic
973226421 4:47790149-47790171 TCAGGGCAAGTGGTAGAGATGGG - Intronic
973758640 4:54098321-54098343 TTGGAGCCACTGATGGAGAATGG - Intronic
974302749 4:60090017-60090039 GCGGAGCCAGAGAGAGTGATAGG + Intergenic
975980954 4:80158602-80158624 TGGAAGCCAGGGATAGAGATGGG - Intergenic
981520617 4:145658052-145658074 TAGGAGCAAGTGATAGAGTGAGG - Exonic
981582618 4:146265337-146265359 CCTGAGCCAGTGATAGCAATTGG - Intronic
986144558 5:5065204-5065226 TCGGAGCAAATTATAGATATGGG + Intergenic
994478138 5:100297247-100297269 TTGGAGCCAGAAATAAAGATGGG - Intergenic
995396088 5:111688698-111688720 TGGGAACCACTGATAGAGAGAGG - Intronic
996192781 5:120565598-120565620 TTGCAACCAGTGTTAGAGATAGG - Intronic
1000583575 5:163065448-163065470 TGGGAGGCAGTGGTATAGATAGG - Intergenic
1003030973 6:2600309-2600331 TCAGAGCCAGTGGTAGTCATTGG + Intergenic
1003090563 6:3098932-3098954 TCTGAGCCAGTGACTGAGAAAGG - Intronic
1005992529 6:30912306-30912328 TCTGAGCCAGGGATAGAAAGAGG - Exonic
1006231318 6:32589505-32589527 TGGGATCCAATGATAAAGATGGG + Intronic
1006620146 6:35358159-35358181 TGGGGGCCAGAGAGAGAGATTGG + Intronic
1006928123 6:37670256-37670278 TAGGAGCAAGAGATAGAGAAAGG + Intronic
1007376158 6:41458197-41458219 TGGGAGCCAGAGAAAGGGATTGG + Intergenic
1009949077 6:70374891-70374913 TTGGAGGAAGAGATAGAGATAGG + Intergenic
1012924974 6:105258502-105258524 CAGGAGCAAGGGATAGAGATTGG - Intergenic
1014763341 6:125382523-125382545 TTAGAGCCAGTCAAAGAGATTGG + Intergenic
1018373198 6:163187078-163187100 TGGGAGCCACTGATAGGGAAGGG - Intronic
1018485477 6:164237435-164237457 TGGAAGCCAGGGATAGAGATGGG + Intergenic
1020962650 7:14825444-14825466 TGGGAGACAGTGACAGATATCGG + Intronic
1021538327 7:21729302-21729324 AAGAAGCCAGGGATAGAGATGGG - Intronic
1028388313 7:90285303-90285325 TCAGGGCCAGTTATGGAGATAGG + Intronic
1029144837 7:98438551-98438573 TGGGAGCAAGTGAGAGAGAAGGG - Intergenic
1030083560 7:105798277-105798299 TCAGAGCCAGTGTTTGGGATGGG + Intronic
1030370878 7:108697833-108697855 TCTGAGCCAGTGGTGGAGCTAGG + Intergenic
1032297087 7:130649099-130649121 TAGAAGCCAGAAATAGAGATGGG - Intronic
1032468018 7:132158981-132159003 TCTGGGTCAGTGATAGAGAATGG - Intronic
1033153653 7:138937816-138937838 TCTGGGCCAATGATAGAGATTGG + Intronic
1037730874 8:21523172-21523194 TGGGTGCAAGTGATTGAGATGGG - Intergenic
1038731064 8:30128146-30128168 TCGGAGCCAGAGATGTAGACTGG - Intronic
1046603318 8:116342949-116342971 TCAGAGCCAGTTGTAAAGATTGG - Intergenic
1047567133 8:126057588-126057610 ACAGAGCTAGTGATGGAGATAGG + Intergenic
1048724698 8:137369842-137369864 TCTGACACAGTGAAAGAGATAGG - Intergenic
1050219694 9:3373197-3373219 TCCGAGACAGTGAGAGAGAATGG + Intronic
1051586123 9:18728772-18728794 TGGAAGCCAGTGTTAGAGAGTGG + Intronic
1052427566 9:28325103-28325125 TCTTAGTCAGTGACAGAGATGGG - Intronic
1053287345 9:36858645-36858667 TGGGAGCCAGTAATAGAGGCTGG - Intronic
1060426835 9:123513268-123513290 TCAGAGCCAGAGACTGAGATTGG + Intronic
1187256181 X:17644623-17644645 CCTGAGCCAGTGGTGGAGATAGG + Intronic
1190327112 X:49213300-49213322 GAGAAGCCAGTGATGGAGATAGG + Intronic
1192496861 X:71622058-71622080 AGGGAGCCAGTGATAGAGGGTGG + Intergenic
1194023678 X:88725020-88725042 TAGGAGGTAGAGATAGAGATAGG + Intergenic
1198006300 X:132497922-132497944 CCTGAGACACTGATAGAGATAGG + Intergenic
1198922926 X:141750708-141750730 TGGGAGTCAGTGATATAGAGTGG + Intergenic
1199082460 X:143592004-143592026 TCACAGCCAGTGACAGAGAAAGG - Intergenic
1199502830 X:148527845-148527867 TCTGAGCCAGTACTAGAGTTAGG - Intronic