ID: 1179358277

View in Genome Browser
Species Human (GRCh38)
Location 21:40682292-40682314
Sequence TGACCAATACAGAAAGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179358274_1179358277 -5 Left 1179358274 21:40682274-40682296 CCCTGGAAGATGATGAAATGACC 0: 1
1: 0
2: 1
3: 23
4: 200
Right 1179358277 21:40682292-40682314 TGACCAATACAGAAAGTGGATGG 0: 1
1: 0
2: 1
3: 24
4: 199
1179358275_1179358277 -6 Left 1179358275 21:40682275-40682297 CCTGGAAGATGATGAAATGACCA 0: 1
1: 0
2: 0
3: 23
4: 216
Right 1179358277 21:40682292-40682314 TGACCAATACAGAAAGTGGATGG 0: 1
1: 0
2: 1
3: 24
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179358277 Original CRISPR TGACCAATACAGAAAGTGGA TGG Intronic
901792500 1:11661729-11661751 TGACCAATCTGGGAAGTGGAGGG + Exonic
904230340 1:29065177-29065199 TGACCAATTGTGAAAATGGAGGG + Intronic
905376757 1:37526783-37526805 TTAACAATACAAAAAGTGGCTGG + Intergenic
906594281 1:47060618-47060640 TGTCTAATACTGACAGTGGAGGG - Intergenic
907744901 1:57203427-57203449 TGCCCAAGACAGAAAGTAGGGGG + Intronic
908526680 1:64994498-64994520 TTACCATGACAGAAAGTGGAAGG + Intergenic
909990640 1:82219364-82219386 TGACCATTACAAAAAGGCGAAGG + Intergenic
911584477 1:99674789-99674811 TGAACAATCCAGAAAGTGGGAGG + Intronic
911775660 1:101808634-101808656 TGATTAATACAGACATTGGAGGG + Intronic
912885504 1:113468084-113468106 ACACAAAGACAGAAAGTGGAAGG - Intronic
913535423 1:119767469-119767491 TGAGAAATACAGTAAGTGGAGGG + Intronic
916061246 1:161099850-161099872 TGAAGACTACAGAAAGAGGATGG + Intronic
918381982 1:183965230-183965252 TGATGAATTCAGGAAGTGGAAGG + Intronic
921257095 1:213352217-213352239 TGAGCAAAACAGAATGTGCATGG + Intergenic
1062881609 10:983049-983071 TGACCAATACATAAAGAGAAAGG - Intergenic
1064593464 10:16919046-16919068 AAACCAATACAGAATATGGAAGG - Intronic
1066230106 10:33423987-33424009 TGACCAACACAGAAGATGCATGG - Intergenic
1066499451 10:35975726-35975748 TGAACAATACTGAGAGTGAAAGG - Intergenic
1066666647 10:37789778-37789800 TGACTAACACAGATAGGGGAAGG + Intronic
1067010411 10:42706895-42706917 AAACCAATACAGAATATGGAAGG - Intergenic
1067030989 10:42878795-42878817 TAACCAATGCAGAAAGCAGATGG - Intergenic
1067766719 10:49092577-49092599 TGAACAATATGGAAAGGGGAAGG + Intronic
1068527468 10:58146882-58146904 TGTCAAATATAGAAAGAGGATGG + Intergenic
1068829075 10:61472390-61472412 TGAGCAAGACAGAAAGTGAGAGG - Intergenic
1070975237 10:80601098-80601120 TGAGGAACACAAAAAGTGGAAGG + Intronic
1071036791 10:81257680-81257702 AGACCAATACGGAAAGTGGCTGG - Intergenic
1071370226 10:84943759-84943781 TGACTCATACAGTAAGTGGCTGG + Intergenic
1075361898 10:121845681-121845703 TGACCAATTCAGTAAATGGATGG + Intronic
1080442244 11:32305411-32305433 TGATCAATACAGACAGTTGTTGG - Intergenic
1080545395 11:33312212-33312234 TGTCTAATAAAGAAAATGGAAGG - Intronic
1085446097 11:76602203-76602225 TGACCATCACAGAAGGTGTATGG + Intergenic
1085446100 11:76602270-76602292 TGACCATCACAGAAGGTGCATGG + Intergenic
1085912801 11:80848460-80848482 TGACAGACACAGAAAGAGGAAGG - Intergenic
1087005382 11:93465797-93465819 TGACCAAAACAGATTGTGAATGG - Intergenic
1087310516 11:96536451-96536473 TGACCAATACAGAAAGCAAATGG + Intergenic
1088080448 11:105905755-105905777 TGACCAAAAGAGAAAGAAGATGG + Intronic
1092101965 12:5890841-5890863 TGACCAATCCTGTAAGTGAATGG - Intronic
1093317393 12:17667857-17667879 TGACCAAGCGAGAAAGTGGGAGG + Intergenic
1094070418 12:26406871-26406893 TGTCAAATACAAAAAGTGTATGG + Intronic
1099946817 12:89254499-89254521 GGACCGAACCAGAAAGTGGAAGG + Intergenic
1101059467 12:100955806-100955828 TCACCAAGTCAGAAAGTAGAAGG + Intronic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1106684376 13:32042580-32042602 TGACCAGTCCAGAGATTGGATGG - Intronic
1108238633 13:48436912-48436934 TTAACAATAGAGGAAGTGGAAGG - Intronic
1108966789 13:56317144-56317166 TGAACAATGCAGAAACTAGAAGG - Intergenic
1109927507 13:69164127-69164149 TGAAAAATACACAAAATGGAGGG - Intergenic
1110544015 13:76736604-76736626 TGCCCAAAGCACAAAGTGGAAGG - Intergenic
1110940681 13:81344367-81344389 TAACCAAACCACAAAGTGGAAGG + Intergenic
1111174989 13:84582637-84582659 TGAGAACCACAGAAAGTGGAGGG - Intergenic
1114646451 14:24259064-24259086 TGACCACCACAGGTAGTGGAGGG - Exonic
1117299291 14:54407911-54407933 AGACCAATGCAGAAAGAAGACGG - Intronic
1120026034 14:79585306-79585328 TGCCCAATATAGTAACTGGAAGG + Intronic
1120559049 14:85968787-85968809 TCACCACTACAGACTGTGGAGGG - Intergenic
1120615965 14:86705268-86705290 GGACTAATACAGACAGTGAATGG + Intergenic
1121551377 14:94804779-94804801 TTACCAAAATAGAAAATGGAAGG + Intergenic
1124069606 15:26379007-26379029 TGACCACTAAAGAAAATGAAGGG - Intergenic
1126809359 15:52385380-52385402 TCAGCTATACAGAAAGTAGAGGG + Intronic
1127569562 15:60228650-60228672 AGACCCAAACAGAAAATGGAAGG - Intergenic
1128433381 15:67621885-67621907 TGAAGAATAAAGAAAGTGGCCGG + Intronic
1128883227 15:71262375-71262397 TGTCCAAGACAGAGAGTGAAAGG - Intronic
1130783408 15:87069408-87069430 TGGACAAAACAGAAAGTGGTGGG + Intergenic
1134331345 16:13253929-13253951 TGAAGAAAACAGGAAGTGGAAGG - Intergenic
1136526231 16:30833069-30833091 TAAAAAATACAGAAAGTGGCCGG + Intergenic
1138822603 16:60280000-60280022 TGACCAAGAATGAAATTGGAAGG + Intergenic
1142918694 17:3165030-3165052 AAACAAATACAGAAAGGGGAAGG + Intergenic
1143420465 17:6787532-6787554 TGACAAAAAAAAAAAGTGGAGGG - Exonic
1143736986 17:8917970-8917992 TGACAAATAAAGAAGGGGGAAGG + Intronic
1146613518 17:34331678-34331700 TCACAAATCCAGAAAGTGAACGG - Intergenic
1147015240 17:37487036-37487058 TGATTAATACAGTAAGTAGAGGG - Intergenic
1147538915 17:41340243-41340265 TTACTAAAACAGAAAGAGGAAGG - Intergenic
1147911961 17:43861315-43861337 TGACAATTAGAGGAAGTGGAAGG + Intronic
1148373339 17:47118323-47118345 TGATGAATACAGAAAATGTAGGG + Intronic
1149619003 17:58027859-58027881 TGAACAATTAAGAAAATGGATGG + Intergenic
1150343211 17:64385392-64385414 TGACTCAGAGAGAAAGTGGAGGG + Intronic
1151638109 17:75367101-75367123 TAACCAATTCAGAAAGTCTATGG + Intronic
1152395794 17:80032198-80032220 TGACCAATCCAGAAAGACCACGG + Intronic
1152795492 17:82304287-82304309 TCACCACTCCAGCAAGTGGAGGG + Intergenic
1153091646 18:1353093-1353115 TGACAGAGACAGAAAGTAGATGG + Intergenic
1153124688 18:1776621-1776643 TGTCCAATTCAGAAAGGTGAAGG + Intergenic
1153887285 18:9478147-9478169 TGACTAATGCAGAAATTGGGGGG + Intronic
1155224802 18:23719888-23719910 AGCCCAATCCAGAAGGTGGATGG + Intronic
1155370566 18:25095989-25096011 TGACCAAGACAGGAAGTTGCTGG - Intronic
1156009744 18:32482961-32482983 AGACCAAATCAGGAAGTGGAAGG + Intergenic
1160266850 18:77345697-77345719 TGACCAATCCAACCAGTGGATGG + Intergenic
1161444744 19:4311818-4311840 TGACCAAGACGGAAAGGAGAGGG - Intronic
1163985258 19:20940691-20940713 TCATAAAAACAGAAAGTGGAAGG - Intronic
1163995027 19:21036969-21036991 TCATAAAAACAGAAAGTGGAAGG - Intronic
1164008321 19:21172948-21172970 TCATAAAAACAGAAAGTGGAAGG - Intronic
1164068289 19:21741208-21741230 TCATAAAAACAGAAAGTGGAAGG + Intronic
1164239382 19:23370344-23370366 TCATAAAAACAGAAAGTGGAAGG + Intronic
1164285602 19:23813392-23813414 TCATAAAAACAGAAAGTGGAAGG - Intronic
1167296225 19:48651765-48651787 AGAGCTATACAGAAAGTGAAAGG + Intergenic
925105187 2:1284861-1284883 TGACTAATACAGTAAGTATATGG - Intronic
925169571 2:1742918-1742940 TGAACAATTCAGGAAGTGGGCGG - Intronic
925235450 2:2273364-2273386 AGACCAATACAGAAAGTGGGTGG + Intronic
925520772 2:4742411-4742433 TGAACAATTCAGTAAATGGATGG + Intergenic
927318184 2:21710464-21710486 AGACTAATACAGAAAGTGTTAGG - Intergenic
927751797 2:25676127-25676149 TGACCAATTCAGAAACTGGGGGG + Intergenic
928263106 2:29785665-29785687 AGACCAAGAAAGAAAGTAGATGG + Intronic
930142087 2:47962599-47962621 TGATGAATACAGAGAGTAGAAGG + Intergenic
930975916 2:57460872-57460894 TGACCATTACAAAATGTGGAAGG - Intergenic
933531030 2:83512461-83512483 AGACAAAGACAGAAAGAGGAGGG + Intergenic
935346232 2:102111057-102111079 TGGCCAATGAAGAGAGTGGAAGG + Intronic
937133347 2:119529931-119529953 TGACCAAAAGAAAAAGTGGAGGG + Intergenic
937735762 2:125286649-125286671 TGACAGATAGAGAAAGTGGGAGG + Intergenic
938896277 2:135754176-135754198 TCTCCAATAAAGAAACTGGATGG - Exonic
939193960 2:138949531-138949553 TTACGAATAGAGAGAGTGGACGG + Intergenic
939395891 2:141629205-141629227 TGACTACTATAGTAAGTGGATGG - Intronic
939868511 2:147502149-147502171 TGAGCAATACAGGAAAGGGAGGG - Intergenic
941092200 2:161190753-161190775 TGATAAAGACAGAAAGTAGAAGG + Intronic
941239487 2:163018002-163018024 AGACCAATGCAGAAGGTGGGTGG - Intergenic
942137764 2:172945009-172945031 AGAAAAATACAGAAAGGGGAAGG + Intronic
942583649 2:177449796-177449818 TCACCAATAAAGAATATGGATGG - Intronic
943956748 2:194201454-194201476 TGACCACTGCAAAAAGTGGATGG - Intergenic
945469430 2:210210626-210210648 TGATCAATAGAGACAGGGGAAGG - Intronic
946336534 2:219041200-219041222 TGACCACTAGAAAAAGTGGCAGG + Intronic
946357490 2:219197300-219197322 TGCCCAAAACAGAAACTGGATGG - Intronic
947189184 2:227484064-227484086 TGACCATAAAAGAAAATGGAGGG - Intronic
947462072 2:230312058-230312080 TCAACAATTCAGATAGTGGAAGG - Intronic
947471153 2:230402270-230402292 TCAACAATTCAGATAGTGGAAGG - Intronic
948159355 2:235811641-235811663 TGAGAAATACAGAAAGTGTGCGG + Intronic
1169759535 20:9076105-9076127 TGGCAAATACACAAAGTTGAGGG + Intronic
1169885952 20:10398150-10398172 TGAAGAATACAGAAATTAGATGG - Intergenic
1170670805 20:18431375-18431397 AGACCAACGCAGAAAGGGGACGG + Intronic
1171159393 20:22907655-22907677 TAACTATTACAGAAAGTGAAAGG + Intergenic
1172871280 20:38136891-38136913 TGACAAAGCCAGACAGTGGAAGG + Intronic
1177092050 21:16781585-16781607 AGATCAACACAGAAGGTGGATGG + Intergenic
1178160532 21:29907683-29907705 TGACAAAAACAGAAAGCTGAAGG + Intronic
1179358277 21:40682292-40682314 TGACCAATACAGAAAGTGGATGG + Intronic
1181679383 22:24482175-24482197 TAATCAGTACAGAAAGTGGCAGG - Intergenic
1182001744 22:26925626-26925648 TGAGCAATAGGGAAAGGGGAAGG - Intergenic
1184104790 22:42361206-42361228 AGACAAATACAGAAATTGGCCGG - Intergenic
950123493 3:10497098-10497120 TGACCACCACAAACAGTGGAAGG - Intronic
951011628 3:17688815-17688837 TGAGAAATATAGAAAGTGGAAGG - Intronic
954716701 3:52530389-52530411 TGTACAATGGAGAAAGTGGAAGG + Intronic
959525675 3:107373601-107373623 TGACCAAGACATAAAGTGTGTGG - Intergenic
959893180 3:111579453-111579475 TGACCAATACAGAAAATTATTGG - Intronic
961118598 3:124353377-124353399 TGCCCAACACAGAAACTTGATGG - Intronic
964766290 3:160181343-160181365 TGAACAATGCAGAAAATGCAAGG + Intergenic
966815092 3:183883982-183884004 TAACCAAGTCAGAAATTGGAAGG + Intronic
967759506 3:193207478-193207500 AGATCAATACAGGAAGTGGTTGG + Intergenic
969632646 4:8347340-8347362 TAACCATCACAGAAAGTGCACGG - Intergenic
970977163 4:22055555-22055577 TGACAAATACAAAACCTGGAAGG + Intergenic
971449148 4:26783981-26784003 TGACCAACAAAGAAACTTGAAGG - Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
972713230 4:41619526-41619548 TGACCAATTCAGAACTTTGATGG + Intronic
973104530 4:46317963-46317985 AGACAAATACCGAAAGTTGATGG + Intronic
973987536 4:56369625-56369647 TTATCAAAATAGAAAGTGGAAGG + Intronic
974853926 4:67436704-67436726 TGGCCAATACAGTAAGTCTAAGG + Intergenic
976590590 4:86845727-86845749 TGAGCAACACAGCAAGAGGAAGG + Intronic
979319376 4:119304390-119304412 AGACCATTACAGAATGTAGAGGG - Exonic
979323287 4:119349539-119349561 TGACCATCACAGAGAGTGGCTGG + Intergenic
979417357 4:120460391-120460413 AGACCAATGCAGAAGGTGGGTGG + Intergenic
980364772 4:131788190-131788212 TGACAAATACAGAAAGGTAAAGG + Intergenic
982096244 4:151926121-151926143 TGAGGAAAAGAGAAAGTGGAGGG + Intergenic
983236196 4:165182227-165182249 TGACCAATACATATATTAGATGG + Intronic
983241116 4:165234177-165234199 TGACCATCACAGAGAGTGGCTGG + Intronic
984867334 4:184293043-184293065 TGACCAAAAGAGAAAGTGAAGGG - Intergenic
985244146 4:187962722-187962744 TGCCCACTACAGAAAATGGTAGG - Intergenic
985781140 5:1872408-1872430 TGACCAACAGAGCAAGAGGAGGG - Intergenic
990337902 5:54793186-54793208 TGACTCATACAGAAAGTCTAAGG + Intergenic
991679848 5:69127998-69128020 TGACAGATACAGAAAATTGAAGG + Exonic
993410580 5:87567910-87567932 AGACCAACGCAGAAAGTGGGTGG - Intergenic
994790008 5:104212616-104212638 TAACCAATACAGAAAATGCAGGG - Intergenic
996824847 5:127670740-127670762 TGAGCAACCCTGAAAGTGGAGGG + Intergenic
1001182280 5:169531571-169531593 TTGCCAATACAGACACTGGAGGG - Intergenic
1003059817 6:2853952-2853974 TGAACAATTAAGAAAATGGATGG - Intergenic
1004080425 6:12386937-12386959 TCACCAGTGCAGAAAGTGCATGG - Intergenic
1004324810 6:14665070-14665092 TGTCCTGTACAGAAGGTGGAAGG - Intergenic
1004950300 6:20662754-20662776 TGACAGACACAGAAGGTGGAAGG - Intronic
1005275334 6:24211074-24211096 TGACAAACACAGTAAGTGCAAGG - Intronic
1005276869 6:24229055-24229077 AAACCAATACAGAAAGAGCAAGG - Intronic
1005408878 6:25521471-25521493 TTATCAATAAAGAATGTGGATGG + Intronic
1005775903 6:29130439-29130461 TGAGATATGCAGAAAGTGGAGGG - Intergenic
1006223549 6:32516944-32516966 TGACAAATTTAGAAAATGGAGGG - Intergenic
1007211588 6:40197069-40197091 TCACCACTGCAGAAAGTGGCAGG - Intergenic
1008091525 6:47298499-47298521 TGAGCAATACAGAAACAGGCAGG - Intronic
1008248284 6:49206166-49206188 TCAGAAATACAGATAGTGGAAGG + Intergenic
1009287715 6:61843134-61843156 TCACAAAGACAGAAAGTAGATGG + Intronic
1009297498 6:61971649-61971671 AGACAAAGAGAGAAAGTGGAAGG - Intronic
1010658085 6:78536101-78536123 TGAATAATACAGTAAGTGCAAGG - Intergenic
1012710895 6:102603236-102603258 TGATCAATACAAAAAATGGAAGG - Intergenic
1017524479 6:155230468-155230490 TGACCAGTGCCGAAAGTGGGGGG - Intronic
1018373007 6:163185989-163186011 GGACCAAAACAGAGAGAGGAGGG - Intronic
1021250505 7:18319716-18319738 TGACAAATACATAAGTTGGATGG - Intronic
1021538752 7:21733440-21733462 TTCCAAATACATAAAGTGGAGGG - Intronic
1022385343 7:29893580-29893602 TGACCTAGACAGAAAGCTGAGGG + Intronic
1022689201 7:32629544-32629566 TCACAAAGACAGAAAGTAGATGG + Intergenic
1022948295 7:35310081-35310103 TGGCTAATGCAGAAAGTGTAGGG + Intergenic
1023071537 7:36439756-36439778 TGACACATGCAGACAGTGGAAGG + Intronic
1025223148 7:57133328-57133350 TGACCATGACAGAAGGTGAAGGG - Intronic
1025633947 7:63304994-63305016 TGACCATGACAGAAGGTGAAGGG - Intergenic
1025648750 7:63443174-63443196 TGACCATGACAGAAGGTGAAGGG + Intergenic
1025719567 7:63997918-63997940 TGACCATGACAGAAGGTGAAGGG + Intergenic
1025742093 7:64206154-64206176 TGACCATGACAGAAGGTGAAGGG + Intronic
1025746550 7:64248090-64248112 TGACCATGACAGAAGGTGAAGGG + Intronic
1030198028 7:106872160-106872182 TAACCAATCTATAAAGTGGAAGG - Intronic
1030652715 7:112132707-112132729 TATCCAATACAGAAAGTAGGAGG + Intronic
1039318171 8:36396157-36396179 TGACTAATACACAAAGTTTAAGG - Intergenic
1039382698 8:37100682-37100704 TAAACAATTCAGAATGTGGAAGG + Intergenic
1041665166 8:60437121-60437143 AAAACAATAAAGAAAGTGGAGGG - Intergenic
1042191620 8:66193043-66193065 TGACCAATACAGGAACTAAAAGG + Intergenic
1043263973 8:78238933-78238955 TGATCAATCCAGAAGGTGAAGGG - Intergenic
1043638509 8:82417930-82417952 TGACCATTAGAGAGAGTGAAAGG + Intergenic
1045185281 8:99830988-99831010 AGACCAACACAGAAGGTGGATGG - Intronic
1045913184 8:107434481-107434503 TGACCTATTCAGAAAGTCCAGGG + Intronic
1050578052 9:7019882-7019904 TGGGCAAAACAGAAAGTGGAGGG + Intronic
1050987188 9:12097900-12097922 AAAGGAATACAGAAAGTGGATGG - Intergenic
1052195255 9:25705056-25705078 TTACAAATAAGGAAAGTGGAAGG + Intergenic
1053509544 9:38676132-38676154 TGACCAGTTCCTAAAGTGGAAGG - Intergenic
1058752993 9:108057703-108057725 TGACAAAAACAGACAGTGGATGG + Intergenic
1059482778 9:114604679-114604701 TCCCCCATTCAGAAAGTGGAAGG - Intergenic
1059502747 9:114769096-114769118 TTACCCAGAGAGAAAGTGGAAGG - Intergenic
1060834323 9:126743597-126743619 TGACCAAGACAGGAGGTGGCTGG - Intergenic
1186262977 X:7800711-7800733 TGACAAATATAGAAACAGGAAGG - Intergenic
1186363069 X:8863055-8863077 TAACTAATACAGGAAGTGAATGG - Intergenic
1186938881 X:14482417-14482439 TGAGCAATGCAGGAAGTGGAGGG + Intergenic
1188090153 X:25953787-25953809 TGACTAATACAGAAAGCAGAAGG - Intergenic
1190712246 X:53079276-53079298 TGACCCATACAGAATGGGGAGGG + Exonic
1191938392 X:66450993-66451015 TGACAAAAACAAAAAGTGGCAGG - Intergenic
1194419376 X:93654015-93654037 TGTCAAATACTGCAAGTGGAAGG - Intergenic
1197069787 X:122282319-122282341 TGTCCAATGCTGAAAGTGGAAGG - Intergenic
1199190329 X:144963030-144963052 TGACCAGTGGAGAAAGTTGATGG - Intergenic
1199699729 X:150366085-150366107 TGACAAATAAGGAAAGTGGGCGG + Intronic
1202096370 Y:21251695-21251717 AGACCAATGCAGAAAGTGAATGG - Intergenic