ID: 1179358625

View in Genome Browser
Species Human (GRCh38)
Location 21:40684510-40684532
Sequence GGGCTGGAGCAGGTGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1732
Summary {0: 1, 1: 0, 2: 21, 3: 202, 4: 1508}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179358625_1179358633 7 Left 1179358625 21:40684510-40684532 CCTTCCTCCACCTGCTCCAGCCC 0: 1
1: 0
2: 21
3: 202
4: 1508
Right 1179358633 21:40684540-40684562 AGGACACAGCACCATAAGCCTGG 0: 1
1: 0
2: 1
3: 9
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179358625 Original CRISPR GGGCTGGAGCAGGTGGAGGA AGG (reversed) Intronic
900000288 1:11059-11081 GGGCTGGGGCGGGGGGAGGGTGG + Intergenic
900103567 1:972930-972952 TGGCTGGTGCGGGTGGAGGGGGG - Exonic
900172448 1:1275591-1275613 GGGCTGGAGGAGGTGGGGGCAGG - Intergenic
900173908 1:1283760-1283782 GGGCTGCAGCCTGTGGAGGGAGG - Intronic
900178059 1:1299362-1299384 GGGCCGGAGCAGGAGGGGGTAGG + Intronic
900270936 1:1788310-1788332 TGGCTGCAGGAGGTGGAGGAGGG - Intronic
900310989 1:2033028-2033050 GGGCAGGAGCAGATGAAGGCGGG + Intergenic
900414423 1:2528521-2528543 GGGCAGGGGCAGGGGGAGGTGGG - Intergenic
900470401 1:2851284-2851306 GGGCTGGGGGAGGGGGAGCAGGG + Intergenic
900495306 1:2973414-2973436 GTGCTGGGGCAGAGGGAGGAGGG + Intergenic
900509171 1:3050305-3050327 GTGCTGGAGCAGCGGGAGGGTGG + Intergenic
900624805 1:3603268-3603290 GGCTCGGAGCAGGTGGAGAAAGG + Intronic
900827606 1:4939196-4939218 GGATTGGAGCAAGTGGAGGAGGG - Intergenic
900858261 1:5203706-5203728 TGGCAGGAGCAGGAGGAAGAGGG + Intergenic
900916271 1:5640972-5640994 TGGCTGAAGCAGGAGGAAGACGG + Intergenic
900935570 1:5764296-5764318 GGGCTTAAGCAGCTGGAGGGTGG - Intergenic
900949753 1:5851832-5851854 TGGCTGCAGCAGGAGGAAGAGGG - Intergenic
900984752 1:6066774-6066796 GGCCTGGCTCAGGTGGAGGAGGG - Intronic
900993092 1:6106877-6106899 GGGGTGGAGCAGTGGAAGGATGG + Intronic
901034361 1:6327385-6327407 CGGCAGGAGCAGGAGGAGGAGGG - Exonic
901057567 1:6455784-6455806 GTGCTGGAGGAGGTGGAGGCCGG + Intronic
901095752 1:6678083-6678105 GGGCGGGAGCAAGCGGAGCAGGG - Intronic
901138999 1:7015890-7015912 TGGCTGGAGCAGGAGGAAGAGGG + Intronic
901140398 1:7025496-7025518 GGGGTGGGGGAGGTAGAGGAGGG + Intronic
901142200 1:7042440-7042462 GCCCTGGAGCAGCTGGAGCAGGG + Intronic
901165232 1:7216134-7216156 TGGCTGGAGCAGGAGGAAGAGGG + Intronic
901207497 1:7505434-7505456 GGGCTGGAGCTGGGGGAGGGTGG - Intronic
901227253 1:7620978-7621000 GGGCCAGAGCAGGTGGAAGCAGG + Intronic
901262802 1:7885915-7885937 GGGCGGGTGGAGGTGGAGGTCGG + Intergenic
901361393 1:8703565-8703587 GGATTGGAGCGGGTGGAGGCTGG - Intronic
901445651 1:9306369-9306391 AGCCTGGAGGAGGTGGAAGATGG + Intronic
901744331 1:11362618-11362640 GTGCTGGAAAACGTGGAGGAGGG + Intergenic
901751756 1:11414314-11414336 CAGCTGGAGCAGGTGGGGGAGGG + Intergenic
902116404 1:14125229-14125251 GGACAGGGGCAGGGGGAGGATGG - Intergenic
902359772 1:15936005-15936027 GGGCAGGAGCAGGGGCAGGAAGG - Exonic
902448749 1:16483966-16483988 GCGCTTGGGCAGGTGGAGGGAGG - Intergenic
902476794 1:16692694-16692716 GTGCTGGAGGAGGTGGAGGCCGG - Intergenic
902596735 1:17514846-17514868 TGGCTGGAGGTGGGGGAGGAGGG + Intergenic
902605825 1:17568892-17568914 GGGCTGGAGGTGTTGGGGGAGGG - Intronic
902610377 1:17593597-17593619 AGGCTGGAAAAGGTGGGGGATGG + Intronic
902630247 1:17700558-17700580 TGGCTGGAGCAGGTGCGGGCGGG + Intergenic
902642435 1:17775356-17775378 GAACTGGAGGAGGAGGAGGAGGG + Intronic
902654826 1:17859961-17859983 AGGGAGGAGCAGGTGGAGGAAGG + Intergenic
902688619 1:18095581-18095603 GGGTTGGAACAGATAGAGGATGG - Intergenic
902691877 1:18115132-18115154 GTGGGGGAGGAGGTGGAGGATGG - Intronic
902692469 1:18118389-18118411 AGGCTGGGGCAGCTGGAGGGTGG + Intronic
902770436 1:18642727-18642749 GGGGTGGAGCAGGGGGAGGGAGG + Intronic
902901057 1:19516442-19516464 TGGCTGGAGTAGGAGGAAGAGGG + Intergenic
903029565 1:20453241-20453263 GGGCTGGAGGAGGGTGAGGGTGG - Intergenic
903135943 1:21309218-21309240 GGGCTGGAGTCAGGGGAGGATGG + Intronic
903162482 1:21499123-21499145 TGGCTTGAGCTGGTGGTGGAGGG - Intergenic
903305256 1:22408631-22408653 GGGCTGGCGCAGCTGTGGGATGG + Intergenic
903320693 1:22541506-22541528 GGGCAGAAGCTGGAGGAGGAGGG - Intergenic
903499592 1:23793944-23793966 GGGAAGGAGGATGTGGAGGAGGG - Intronic
903500730 1:23798931-23798953 GTGCTGGAGCTGCTGGAGGCTGG - Exonic
903655123 1:24944258-24944280 TGGCTGGAGCAGGGTGAGGGAGG - Intronic
903678686 1:25082827-25082849 GGCCAGGAGCAGGTGGGGGTGGG + Intergenic
903692423 1:25183890-25183912 GGGCTGGAGCAGGAGGCCCATGG - Intergenic
904006238 1:27364744-27364766 GGCCTGGGGCTGGTGGAGGCAGG - Intronic
904046629 1:27613083-27613105 GTGTTGGAACAGGTGGAGCAGGG - Exonic
904204356 1:28843437-28843459 GGGCTAGGGCAAGGGGAGGATGG - Intronic
904230124 1:29062672-29062694 GGGTAGGAGAAGGGGGAGGAGGG - Intronic
904401526 1:30259857-30259879 GGGAAGGAGCAGGTAGAGGCTGG - Intergenic
904421608 1:30398054-30398076 AGGCTGCAGCAGGATGAGGAGGG + Intergenic
904610500 1:31723365-31723387 GGGCTTGAGGAGGTGATGGAGGG - Intergenic
904660938 1:32084294-32084316 AGACTGCAGCAGGAGGAGGAAGG - Intronic
904682964 1:32241475-32241497 CGACAGGAGCAGGTGGTGGACGG + Intergenic
904756603 1:32771681-32771703 GGGCTGGCGGAGCTGGAGGAGGG - Exonic
904839617 1:33363995-33364017 GTGGGGGAGCAGGTGGGGGAGGG - Intronic
904842254 1:33379902-33379924 GAGCTGGAGCATGTGCAGCAAGG - Intronic
904914048 1:33956960-33956982 TGGCTGGAGCATGGTGAGGAAGG - Intronic
905174712 1:36128126-36128148 GGGCAGGGGCAGGTGGGGCAGGG - Intergenic
905182931 1:36177922-36177944 GGGCTGGGGCAGGGGGAGGCAGG - Exonic
905183363 1:36179594-36179616 AGGATGGAGGAGGAGGAGGATGG - Intronic
905265625 1:36752767-36752789 GAGCTGGGGCTGATGGAGGAGGG - Intergenic
905285981 1:36880677-36880699 GTACTGGACCAGGTCGAGGATGG + Exonic
905344880 1:37304558-37304580 GGGCTGGAGCAGGTGCAACCTGG + Intergenic
905395561 1:37664216-37664238 TGGCTGGAGCAGGGGGAGCCTGG - Intergenic
905450699 1:38054202-38054224 GGGGGGTAGCAGGTGGAGGGTGG + Intergenic
905472996 1:38207236-38207258 GTCCTGGAGCTGGTGGAGGTGGG + Intergenic
905492137 1:38352983-38353005 TGGCTGGAGCAGGAGGAAGGGGG + Intergenic
905872769 1:41414675-41414697 GGGCTGGAGCAGGACAAGGTGGG + Intergenic
905906792 1:41623774-41623796 GGGCTGGCACAGGAGGAGGAGGG - Intronic
905948373 1:41923476-41923498 AGGCTGGAGGAGGTGGCGGGGGG + Intronic
906140840 1:43532413-43532435 AGGCTGGATTAGGTTGAGGAAGG + Intronic
906143433 1:43546679-43546701 GGTCTGAGGCAGGAGGAGGAGGG - Intronic
906192290 1:43905932-43905954 GGAGAGGAGCAGGAGGAGGAGGG - Intronic
906192433 1:43906438-43906460 GGAGAGGAGCAGGAGGAGGAGGG - Intronic
906288955 1:44607188-44607210 GGGCAAGAGCAAGTGCAGGAAGG - Intronic
906292024 1:44625555-44625577 AGGCTGGAGAAGGTGGGGGGAGG + Intronic
906306598 1:44723925-44723947 GGGCTGAAGGGGGAGGAGGAAGG - Intronic
906577319 1:46902558-46902580 GGGCTGAAGCATATGGGGGAGGG - Intergenic
906613554 1:47219906-47219928 GGGCTGGTGGGGGTGGAGGTGGG - Exonic
906781341 1:48575705-48575727 GGGTGGGAGGAGGTGCAGGAAGG - Intronic
906879019 1:49569240-49569262 GGGCTGGGGCAGGGGTAGGATGG + Intronic
907046499 1:51303164-51303186 GGGCTGCTGCAGCTGGAGGAGGG - Exonic
907265115 1:53254442-53254464 GGGCTGGGGGAGGGGGAAGAGGG - Intronic
907270451 1:53287988-53288010 GGGGTGGGGCAGGGGGAGAAGGG + Intronic
907322705 1:53615492-53615514 GAGCTGGAGCTGGTAGAAGAAGG + Intronic
907339786 1:53726706-53726728 GGGCTGGGGGAGGTTGGGGAGGG - Intronic
907421967 1:54353687-54353709 GGGCTGCAGCATGAGTAGGATGG - Intronic
907431721 1:54416052-54416074 GGGCTGGAGCCCCTGTAGGAGGG - Intergenic
907477470 1:54715272-54715294 GGGCTGAAGCAGAGTGAGGAAGG - Intronic
907919719 1:58901251-58901273 GGTCTGGAGAAGGTGGGGGTTGG + Intergenic
908534646 1:65066744-65066766 GTGCCGGAGGAGGAGGAGGAGGG - Intergenic
908544193 1:65148139-65148161 GGGGGCGAGGAGGTGGAGGAGGG + Intronic
909561784 1:77016015-77016037 GAGGAGGAGGAGGTGGAGGAGGG - Intronic
909986951 1:82172890-82172912 GGGATGGAGCAGGAAGAAGATGG - Intergenic
910101570 1:83583344-83583366 GGGCTGGGGCAGCAGGAGGCTGG + Intergenic
910175005 1:84420137-84420159 GGGCTGCAGAAGCTGGAGAATGG + Intergenic
910292192 1:85610183-85610205 GGGCTGGAGGAAGGGGAGCATGG - Intergenic
910449145 1:87329135-87329157 GGGCTGGCGGAGCTGGAGGGAGG - Exonic
910758115 1:90712227-90712249 GGCCTGGAGCAGGGAGAGGACGG + Exonic
910835809 1:91508850-91508872 ATGATGGAGCAGGTGGAAGAAGG - Intronic
911090961 1:94016484-94016506 CAGCTGGAGCAGGGAGAGGACGG + Intronic
911606546 1:99912051-99912073 GGGCTGGAGAAAGTGAGGGAAGG - Intronic
911664543 1:100538804-100538826 GGGCTGGGGGAGGGGGAGAAAGG - Intronic
912384474 1:109264393-109264415 GGGCTGCAGGTGGTGGGGGAGGG - Intronic
912771058 1:112464722-112464744 CGGCTGGAGCAAGGGTAGGAGGG + Intergenic
913052238 1:115127762-115127784 TGGCTGGAGCTGGTGGGTGATGG + Intergenic
913305338 1:117424692-117424714 AGGCTGAGGCAGATGGAGGATGG - Intronic
914503443 1:148266967-148266989 TGGCTGCATCATGTGGAGGAGGG + Intergenic
914510320 1:148326960-148326982 TGGCTGCATCATGTGGAGGAGGG - Intergenic
914689147 1:150010401-150010423 GGGCGGGAGCAGACGGGGGACGG + Intronic
915117503 1:153609932-153609954 GGGTTTGGGCAGGCGGAGGAGGG - Intronic
915349045 1:155213217-155213239 GGGCTGGAGCAGAGAGAGAAGGG - Exonic
915352232 1:155233844-155233866 GGGCTGGAGCAGAGAGAGAAGGG - Intergenic
915379543 1:155427950-155427972 GGGCTAGAGCAGGAGCAAGAAGG - Intronic
915446474 1:155977509-155977531 GCGCTGGGGGAGGAGGAGGAAGG + Intronic
915456335 1:156043316-156043338 TGGCTGGAGCTGGGGCAGGAGGG + Intronic
915626197 1:157115475-157115497 GGGATGGAGCAAGTGGAGGAGGG - Intergenic
915819760 1:159009796-159009818 GGGCTGGAGCATGTGGTGAGGGG - Intronic
915981123 1:160420476-160420498 GGACTTGGGCAGGTTGAGGAGGG - Exonic
916480665 1:165211729-165211751 GGGTTTCAGCAGGTGGAGGTGGG - Intronic
916491577 1:165306885-165306907 GGGCAGGGGGAGGCGGAGGAGGG - Intronic
916573651 1:166048606-166048628 GAGCTGGGGCAAGGGGAGGAAGG + Intergenic
916715308 1:167442617-167442639 GGGCTGGCCCAGGGGCAGGAAGG - Intronic
916878679 1:168998195-168998217 GGGATAGAGCACGTGGGGGAAGG - Intergenic
917155213 1:171990493-171990515 GGGATGGAGTGGGAGGAGGATGG + Intronic
917180391 1:172290466-172290488 TGGCTGGAGCAGAATGAGGATGG + Intronic
917526098 1:175789797-175789819 TGGCTGGAGCACATGGTGGAGGG - Intergenic
917670992 1:177273405-177273427 GAGATGGAGCAGCTGGAGAAGGG + Intronic
917854744 1:179091220-179091242 GGGCTGGAGACGGGGGATGAGGG + Intronic
918160071 1:181889904-181889926 AGGATGGAGCACGTGGGGGAAGG + Intergenic
918703826 1:187637386-187637408 GGGATGGAGAAGGAGGAGGGGGG - Intergenic
919297232 1:195718406-195718428 GAGTTGGTGCTGGTGGAGGAGGG + Intergenic
919457950 1:197842204-197842226 GATCTTGAGCATGTGGAGGAGGG + Intergenic
919640893 1:200042526-200042548 GGGGTGGGGCAGGTGGGGGATGG - Intronic
919820019 1:201466846-201466868 GGGAAGGAGAAGCTGGAGGAGGG - Intronic
919871995 1:201829085-201829107 GGGCGGGAGCGGGCGGAGGGCGG - Intergenic
920251122 1:204623157-204623179 GGGCTGGAGGAGGTGGAGAGGGG + Intronic
920292594 1:204934272-204934294 GGGCTGGTCCAGGTAGAGGTGGG + Intronic
920417035 1:205805823-205805845 GGATTGGAGTAGGTGAAGGATGG - Intronic
920525008 1:206659904-206659926 GAGCTGGAAGGGGTGGAGGAGGG - Intronic
920569095 1:207002821-207002843 GGGCAGGAAGGGGTGGAGGAGGG + Intergenic
920641919 1:207760785-207760807 TGGCAGGAGCAGGAGGAGCAAGG + Intronic
921785899 1:219229375-219229397 TGGCTGGGGCAATTGGAGGAAGG + Intergenic
922132639 1:222795039-222795061 GGGGTGGAGGAGGGGCAGGAGGG - Intergenic
922174878 1:223189426-223189448 GGGCTGGTGCAGGTGGGGGCTGG + Intergenic
922174882 1:223189442-223189464 GGGCTGGTGCAGGTGGGAGCTGG + Intergenic
922174902 1:223189506-223189528 GGGCTGGTGCAGATGGGGGCTGG + Intergenic
922174906 1:223189522-223189544 GGGCTGGTGCAGGTGGGCGCTGG + Intergenic
922174920 1:223189570-223189592 GGGCTGGTGCAGGTGGGAGCTGG + Intergenic
922174926 1:223189586-223189608 GAGCTGGTGCAGGTGGGGGCTGG + Intergenic
922174940 1:223189634-223189656 GGGCTGGTGCAGGTGGGGGCTGG + Intergenic
922174944 1:223189650-223189672 GGGCTGGTGCAGGTGGAGGCTGG + Intergenic
922174971 1:223189746-223189768 GGGCTGGTGCAGGTGGGGGCTGG + Intergenic
922722649 1:227906531-227906553 AGGATGGAGCAGGAGGAGGGAGG - Intergenic
922762486 1:228141462-228141484 GGGCTGGGCCAGGTGGATGAAGG - Intronic
922796922 1:228344829-228344851 GGGCTGGAGCCTGTGGAAGTAGG - Intronic
923098477 1:230793945-230793967 GGGCTAGAGGAGGGGGATGAGGG - Intronic
923475302 1:234326086-234326108 AGGAAGGAGCAGGAGGAGGATGG + Intergenic
923483965 1:234411476-234411498 GGCCTGGAGAAGGAGCAGGAAGG + Intronic
923554946 1:234993166-234993188 GGGCAGGAGCAGGTTCAGGAAGG + Intergenic
923750607 1:236742917-236742939 AGGCTGGAGCAGGCTGAGAAGGG + Exonic
923826908 1:237510259-237510281 GGGATGTAGCAGGAGAAGGAAGG + Intronic
923887295 1:238173245-238173267 TGGCTGGAGCAGGAGGTGGGAGG - Intergenic
924332416 1:242953390-242953412 GGAGAGGAGCATGTGGAGGAAGG + Intergenic
1062907281 10:1187409-1187431 GGATGGGAGCAGGAGGAGGAGGG - Intronic
1062936647 10:1395453-1395475 GGGCTGGAGGAGTTAGAGGAGGG - Intronic
1062982526 10:1737185-1737207 AGGCAGGTGCAGGTGCAGGAGGG - Exonic
1063161865 10:3424274-3424296 GGGATGGCGCAGGTGGAGCACGG - Intergenic
1063253148 10:4296193-4296215 GGGGTGGAGGAGGTGGAGGATGG - Intergenic
1063253352 10:4298859-4298881 TGGCTGGAGCAGGAGGAACAGGG - Intergenic
1063379597 10:5576002-5576024 GGTCTGGGGCAGGTGGCAGAGGG - Intergenic
1063567002 10:7180013-7180035 GGGCTGGGGAAGCTGGCGGATGG + Intronic
1063640502 10:7825489-7825511 GGGCTGGAAGTGGTGGAGAATGG - Intronic
1063866044 10:10366831-10366853 AGTGAGGAGCAGGTGGAGGAAGG - Intergenic
1063982895 10:11470225-11470247 AGGATGGAGAAGGTGGAGGATGG + Intronic
1064360611 10:14661046-14661068 TGGCTGGAGAAGGAGGAAGAGGG - Intronic
1065099793 10:22321484-22321506 GCGCCGGAGCAGGAGGAGGCCGG + Exonic
1065449810 10:25845138-25845160 GGGCTGGAGGAGAAAGAGGATGG - Intergenic
1065797179 10:29318561-29318583 GGGACGGAGGAGGTGGAGAAGGG + Intergenic
1065840997 10:29700975-29700997 GGGCTGGAGCGTGGAGAGGAAGG - Intronic
1065869179 10:29941393-29941415 GGGCAGGAGCAGGAAAAGGAAGG + Intergenic
1065945976 10:30605772-30605794 GGGCCGGAGGAGGTGGAGAAGGG - Intergenic
1066074081 10:31855000-31855022 GAGGAGGAGCAGGAGGAGGATGG + Intronic
1066648543 10:37634789-37634811 GGGCTGGTGCAGTGGGAGGCGGG + Intergenic
1067081398 10:43214543-43214565 GGGCTGGTGGTGTTGGAGGATGG - Intronic
1067100936 10:43334027-43334049 GGGCTTTGGGAGGTGGAGGAGGG + Intergenic
1067571713 10:47376627-47376649 GGGCTGGGGGAGAAGGAGGATGG - Intronic
1067837900 10:49652862-49652884 GGGCTGGTGCGTGTGGAGGGTGG - Intronic
1067947804 10:50701404-50701426 GGGCTGGCGCTGGGTGAGGATGG + Intergenic
1068035916 10:51759508-51759530 AGGCTGAGGCAGGTGGAGGGTGG - Intronic
1068373124 10:56144862-56144884 GGGGTGGAGCAGGGGGAGGAGGG + Intergenic
1068903305 10:62294550-62294572 GAGATGGAGGAGGAGGAGGAAGG - Intergenic
1069117711 10:64528492-64528514 TGGCTGGAGCAGGAGGAAGGCGG - Intergenic
1069582388 10:69574720-69574742 GGGCTGGAGCAGGTGACTGCTGG - Intergenic
1069598394 10:69687444-69687466 GGGCTGGGGCAGGAGGACAAGGG - Intronic
1069874060 10:71550912-71550934 GGGCTGGCTCTGGTGGTGGAGGG - Intronic
1069883568 10:71609251-71609273 GGGCTGCAGCAGGGGGTAGAAGG - Intronic
1070392107 10:75980321-75980343 GTGCTGGAGAAGGGGGAGCAGGG - Intronic
1070569280 10:77628882-77628904 AGGATGGAGCAAGAGGAGGAGGG + Intronic
1070680495 10:78445714-78445736 GTGCTGGAGCAGGTGGGGAAGGG - Intergenic
1070747795 10:78945323-78945345 GGGTGGGTGGAGGTGGAGGAAGG - Intergenic
1070883121 10:79866397-79866419 GGGCTGGCGCTGGGTGAGGATGG + Intergenic
1070976301 10:80608671-80608693 GGGCGGGAGGAGGAGGAGCACGG - Intronic
1071191607 10:83108237-83108259 GGGCTGAAGCAGGAGGAAGCTGG + Intergenic
1071649689 10:87382712-87382734 GGGCTGGCGCTGGGTGAGGATGG + Intergenic
1072032000 10:91530096-91530118 GGGCTGGAGAGGGAGGGGGAAGG - Intergenic
1072195728 10:93116018-93116040 AGGCAGGAGGAGGAGGAGGAGGG + Intergenic
1072301673 10:94067875-94067897 AGCTTGGAGCAGGTGGAGAAGGG + Intronic
1072426484 10:95334829-95334851 GCCCTGGAACAGGTTGAGGAAGG - Intronic
1072533161 10:96338718-96338740 GTTCTGGAGCTTGTGGAGGAGGG + Intergenic
1072591661 10:96832854-96832876 GGGGTGGCGCAGGAGGAGGACGG - Intronic
1072639583 10:97201868-97201890 AGGAGGGAGCAGGTGGAGGGAGG - Intronic
1072733359 10:97863120-97863142 GGGCAGGAGCAGGGGCAGGGAGG + Intronic
1073079676 10:100851147-100851169 GGGCTGTTGCAGCTGTAGGAAGG - Intergenic
1073117583 10:101100421-101100443 GGGCTGGTGCCGGTGGGGCAGGG - Intronic
1073299719 10:102463496-102463518 GGGCTGGAGGAGGGGAAGGGAGG + Intronic
1073340929 10:102744035-102744057 GAGCAGGAGCAGGAGGGGGATGG + Exonic
1073942919 10:108718562-108718584 CAGTTGGAGCAGGTGGAGGAGGG + Intergenic
1073972304 10:109058655-109058677 TGGCTGGGGAAGCTGGAGGAGGG + Intergenic
1074095824 10:110311592-110311614 AGGCTGGAGGAGGTGGGGGAGGG - Intergenic
1074145020 10:110709992-110710014 GGTCTGGAGGACGTGTAGGAGGG - Intronic
1074804071 10:117029681-117029703 AGGCTGGAGCAGGAGCAAGAAGG - Intronic
1074864620 10:117537550-117537572 GAGCTGGAGCTGATGGAGGCAGG + Intergenic
1075086795 10:119419111-119419133 GGGCTGGAGAAGGGAGAGGGGGG - Intronic
1075119053 10:119651279-119651301 GGGCGGGAGGAGGTGGGGGAGGG + Intergenic
1075139189 10:119816205-119816227 TAGCTGGAGGAGGTGGAGCAGGG + Intronic
1075514400 10:123097669-123097691 TGGCTGTGGGAGGTGGAGGAAGG + Intergenic
1075961014 10:126567760-126567782 AGACTGGAGCAGGTGGAGAAGGG + Intronic
1076242494 10:128919702-128919724 GGGATGGAGGAGGAGGAGAAGGG + Intergenic
1076404646 10:130203792-130203814 GGACAGGGGCAGGTGGAGGCGGG - Intergenic
1076485909 10:130816841-130816863 GAACTGCAGCAGGTGGAGGGCGG - Intergenic
1076579023 10:131494528-131494550 GGGATGGAGCAGGGGCAGGTTGG + Intergenic
1076671187 10:132121881-132121903 GGGCTGGTGAAGGAGGGGGAGGG + Intronic
1076728086 10:132422535-132422557 GGGCTGGAGCGGGGCCAGGAGGG - Intergenic
1076804737 10:132849736-132849758 GGGCTGTAGGGGGTGGGGGATGG + Intronic
1076870343 10:133189823-133189845 GGGCTGGGGCAGGGTGGGGAGGG - Intronic
1076885437 10:133260044-133260066 TGGCTGGAGCTGGGGGAGGCAGG + Intergenic
1076915976 10:133423365-133423387 GGCCTGGAGGACGAGGAGGACGG - Exonic
1076993920 11:289316-289338 GGGCAGGCGCGGGTGGGGGAGGG - Intronic
1077109791 11:857163-857185 GGGCTGGGGCAGTTGTGGGAGGG + Intronic
1077132228 11:978835-978857 GGGCGGGACCAGGTGGGTGAGGG + Intronic
1077210773 11:1370091-1370113 GGGAAGGAGGAGGAGGAGGAGGG + Intergenic
1077252893 11:1568372-1568394 GGGCTGGAGGGGCGGGAGGACGG + Intronic
1077305630 11:1867594-1867616 GGGGTGATGCGGGTGGAGGAGGG - Intronic
1077360407 11:2138137-2138159 GGCCGGGAGCGGGCGGAGGAAGG + Intronic
1077370153 11:2177981-2178003 GGGCTGGAGGGGGAGTAGGACGG - Intergenic
1077370256 11:2178347-2178369 GGGCTGGAGGGGGAGTAGGACGG + Intergenic
1077371096 11:2181994-2182016 GAGATGGAGCAGGTGGGGCAGGG + Intergenic
1077440144 11:2564738-2564760 GGGCTGGGGAAGGGGGAGTAGGG - Intronic
1077495078 11:2883048-2883070 GGACTGGAGCAGGTGGGTGTGGG + Intergenic
1078464168 11:11538338-11538360 GGCAGGGAGCAGCTGGAGGAGGG + Intronic
1078652735 11:13210738-13210760 GGACTGAAGAGGGTGGAGGATGG - Intergenic
1078697020 11:13644576-13644598 TAGCTGGAGCAGGAGGAAGAGGG + Intergenic
1079003221 11:16774745-16774767 AGGTTGGAGCAGGGTGAGGAAGG - Intergenic
1079264919 11:18921615-18921637 GGGATGGAGCACGTGGGGGAAGG + Intergenic
1079267094 11:18943762-18943784 GGGATGGAGCACGTGGGGGAAGG + Intergenic
1079834072 11:25309045-25309067 GAGCAGGAGCAAGAGGAGGAAGG - Intergenic
1080519919 11:33059836-33059858 GGGCCGGGGCAGGTTGAGAAAGG + Intronic
1080587840 11:33697492-33697514 TGGCTGGAGCAGGAGGAGTGAGG - Intergenic
1080635646 11:34121030-34121052 GGGCTGAAGCAGGGTGAGTAGGG + Intronic
1080749486 11:35139224-35139246 GGGCAGGGGCCGGCGGAGGACGG - Exonic
1080783031 11:35449007-35449029 GGGATGGAGCTCCTGGAGGAAGG - Intronic
1080923882 11:36735979-36736001 TGGCTGGAGCATGTAGAGTAAGG - Intergenic
1081093281 11:38899860-38899882 GAGGTGGAGGAGGAGGAGGAAGG + Intergenic
1081652334 11:44832722-44832744 AGGCAGGAGCAGGTGCAGCAAGG - Intronic
1081659551 11:44879638-44879660 TGGCTGGAACAGGGTGAGGAGGG + Intronic
1081747902 11:45485897-45485919 AGGCTGCTGGAGGTGGAGGAGGG - Intergenic
1081972260 11:47207675-47207697 AGGGTGGAGAAGGGGGAGGATGG - Intergenic
1082063993 11:47883937-47883959 GGGCTGGGGGAAGTGGAGAATGG + Intergenic
1083205781 11:61148172-61148194 GTGCTGGAGCTGGTGGAGGCTGG - Intronic
1083253914 11:61485040-61485062 GGCCGTGAGCAGGAGGAGGAAGG - Intronic
1083275055 11:61592188-61592210 GGGCTGGAGCAGAGGGAGGATGG + Intergenic
1083553927 11:63610811-63610833 AGGATGGCGCAGGTGGAGGAGGG + Intronic
1083734374 11:64671181-64671203 GGGGTGGAGTAGCAGGAGGAAGG + Intronic
1083766875 11:64845447-64845469 AGGCTGGAGGAGGTTGGGGAGGG + Intergenic
1083767049 11:64846540-64846562 GGGCAGGATCAGGTTGAGGGAGG + Intergenic
1083788890 11:64971473-64971495 GGGAAGGAGGAGGAGGAGGAGGG + Intronic
1083799559 11:65038664-65038686 GGGCAGGAGGAGGAAGAGGATGG + Exonic
1083990542 11:66243498-66243520 GGCCTGGAGCAGGAGGGAGAAGG - Exonic
1084043893 11:66558048-66558070 GGGCTGGAGCAGGTGGAAAAGGG + Exonic
1084309947 11:68311297-68311319 GAGCTGGAGCTGGTGGTAGAAGG - Intergenic
1084323163 11:68384724-68384746 GGTCAGGAGCATGTGGAGGGTGG + Intronic
1084365140 11:68692860-68692882 GGGCTGGAGCTGGTGGAGCTGGG + Intergenic
1084409398 11:68997604-68997626 GGCCTGGAGCAGGTGCCGGGTGG + Intergenic
1084907423 11:72358807-72358829 GGGGTGGGGGGGGTGGAGGAGGG - Intronic
1084971980 11:72777028-72777050 GCCCTGGAGCAGGTGTGGGAGGG - Intronic
1085122078 11:73973693-73973715 GGGCAGGGGCAGGTGGAGGGGGG + Intergenic
1085266404 11:75240512-75240534 GTGCTGGAGAAGGAGGAGGAAGG + Intergenic
1085448342 11:76615904-76615926 GGGCTGAAGCAGGGTGGGGATGG + Intergenic
1085525844 11:77163031-77163053 GGGCTGGAGCAGGGGAAGGCAGG - Intronic
1085862107 11:80246256-80246278 TGGCTGGAGCAGGATGAGCAGGG + Intergenic
1085929124 11:81059473-81059495 TGGCTGGAGCAGAGGGAGGTAGG - Intergenic
1086273736 11:85098900-85098922 TGACTGGAGCAGGTGGAGAAGGG - Intronic
1086393662 11:86391926-86391948 AGGCTGGAGCAGGAGTAAGAGGG + Intronic
1086737890 11:90329840-90329862 GGACGGGAGGAGGGGGAGGAGGG - Intergenic
1087012986 11:93530774-93530796 GGGCTGGAGAAGGGGGAGAGAGG - Intronic
1087713005 11:101576037-101576059 GGGCTGGAACACGTGGACCATGG - Intronic
1087804207 11:102538489-102538511 GGGCTGACTCAGGAGGAGGAGGG + Intergenic
1088314288 11:108491462-108491484 GGGCTGATGCAGGTTGAGGCAGG - Intronic
1088355042 11:108934135-108934157 GAGCTGGATCAGGTGAAGGAGGG + Intronic
1088759178 11:112913098-112913120 GTGCTGGCTGAGGTGGAGGAAGG - Intergenic
1089005571 11:115087904-115087926 GGACAGGAGCAGGTGAAGGGAGG + Intergenic
1089459741 11:118645526-118645548 GGGCGGGAGCGTGGGGAGGAGGG + Exonic
1089640433 11:119844246-119844268 GGGCAGGGGCAGGGGGTGGAGGG - Intergenic
1089692498 11:120195609-120195631 GGGCAGGAGCAGGGGCAGGGAGG - Intergenic
1089968061 11:122670297-122670319 TGGCAGCAGCAGGTGGAGGCTGG - Intronic
1090428533 11:126627303-126627325 AGGCTGGAGCAGGTGGCCAAGGG + Intronic
1090450206 11:126799672-126799694 GGGGTGGAGCAGGAGGAGCCGGG + Intronic
1090652442 11:128819357-128819379 GGGCTACAGCTGGTTGAGGAGGG - Intergenic
1090713185 11:129406583-129406605 GTGCTTGGGGAGGTGGAGGAGGG + Intronic
1090765269 11:129870913-129870935 GGAGTGGAGTAGGTGGAGGGAGG - Intronic
1090829877 11:130413919-130413941 GGGCTGGTGCAGGTGCAGATTGG - Intronic
1090838576 11:130471196-130471218 GGGGTGCTGCAGGTGGTGGACGG + Exonic
1091207957 11:133833696-133833718 GGGCAGGGGCAGGCGGAGGGCGG - Intergenic
1091302794 11:134518234-134518256 GGACTGGAGCTGGGAGAGGATGG + Intergenic
1091332278 11:134739295-134739317 GGGTTGGAGCTGGCGGAGGCAGG + Intergenic
1091632661 12:2173688-2173710 GTGGTGGAGCAGGTGGGGGTAGG - Intronic
1091704916 12:2687213-2687235 GGGCAGGGGCAGGAGGTGGAAGG + Intronic
1091746801 12:2997997-2998019 GGGCTGGAGGGCGGGGAGGATGG - Intronic
1091779269 12:3203821-3203843 GTGGAGGAGCAGGTGCAGGAGGG + Intronic
1091780680 12:3212886-3212908 GGGCTCGAGGATCTGGAGGATGG + Intronic
1091922198 12:4314082-4314104 CGGCTGGAGCTGGATGAGGAGGG + Intergenic
1091963280 12:4717679-4717701 AGGCTGAGGCAGGAGGAGGATGG - Intronic
1091968336 12:4764347-4764369 TGGCGGGAGCAGTGGGAGGAGGG - Intronic
1092097981 12:5860064-5860086 GTGCTGGAGCCTGGGGAGGAGGG - Intronic
1092167495 12:6351702-6351724 GGGCTGGCAGTGGTGGAGGAGGG + Intronic
1092219111 12:6700730-6700752 GCGCTGGAGCGGGTGGGGGGCGG + Intronic
1092246300 12:6866263-6866285 GGGATGGAGCAGGACGGGGACGG + Exonic
1092523387 12:9294892-9294914 CGGCTGGAGCAGCTGGAGTCTGG + Intergenic
1093087780 12:14885927-14885949 GAGCTGGAGAAGGTGGGGAAGGG + Intronic
1093157487 12:15704565-15704587 GGGCTGTGGAAGGTGGAGAATGG + Intronic
1093368686 12:18337614-18337636 GAGCTGGAGCAGAGGGAGGCGGG + Intronic
1093473614 12:19531618-19531640 GGGCAGGGGCAGGGGGAGAATGG - Intronic
1093569056 12:20644832-20644854 GGGGAGGAGGAGGAGGAGGAGGG - Intronic
1093768121 12:22988318-22988340 GGGCTGGAGAAGCTGAAGGGTGG - Intergenic
1094509038 12:31085044-31085066 CGGCTGGAGCAGCTGGAGTCTGG + Exonic
1095357885 12:41297694-41297716 TGGCTGGAGAAGGAAGAGGAAGG - Intronic
1095380183 12:41581632-41581654 GGGAGAGAGCAGATGGAGGAAGG + Intergenic
1096073790 12:48789565-48789587 GGGCTGGGGCAGGGGCAGGGAGG - Intergenic
1096148957 12:49296862-49296884 GGCCGGGAGCAGGCAGAGGATGG - Intronic
1096178155 12:49536678-49536700 GAGGTGGAGGAGGAGGAGGAGGG - Intergenic
1096502125 12:52070414-52070436 GGGCGTGAGGAGGAGGAGGAAGG + Exonic
1096604900 12:52757708-52757730 TGCCTGCAGCAGGTGGGGGAAGG - Intergenic
1096678947 12:53242148-53242170 GGGCAAGAGCAGGTGCAGGGTGG - Intergenic
1096743716 12:53712430-53712452 CGGCTGGAGCAGGAAGATGAAGG - Intronic
1096774353 12:53955179-53955201 GAGCTGGCGCGCGTGGAGGACGG + Exonic
1096878661 12:54649577-54649599 GGTCTGGAATAGATGGAGGAGGG - Intergenic
1097058900 12:56267659-56267681 GGGCTGCAGCAGGTGCTGGGGGG + Intronic
1097233839 12:57526972-57526994 GTGCTGAAGGAGGTGGAAGAAGG - Exonic
1097265360 12:57741195-57741217 GGGCAGGAGGATGTGGCGGATGG + Intronic
1097398521 12:59103641-59103663 TTGCTGGGGCAGGTGGGGGAGGG - Intergenic
1097560530 12:61199371-61199393 GGGCTGGGGCAGGAGGGTGAGGG + Intergenic
1097626434 12:62007107-62007129 TGGCTGGAGCAGAAGGAGCATGG - Intronic
1097697798 12:62791266-62791288 AGGCTGGAGGATGAGGAGGAGGG + Intronic
1098032612 12:66269767-66269789 GGGCTGGAGGAGAGGGAGGTAGG - Intergenic
1098624993 12:72654650-72654672 GGGCTTGAGCAATTGGTGGATGG - Intronic
1099398453 12:82171015-82171037 GGGGAGGAGGAGGAGGAGGAAGG + Intergenic
1099555866 12:84107684-84107706 GGGCTGAAGTGGGTGGGGGAGGG + Intergenic
1100089797 12:90955086-90955108 GGGCTGGGGCCGGGGGAGGCAGG + Exonic
1100172136 12:91986990-91987012 GGGTGGGAGAAGGTGGAAGAGGG - Intronic
1100203574 12:92325277-92325299 GGGGAGGAGCAGGTGGTGGGTGG + Intergenic
1100572091 12:95852441-95852463 GAGCCTGAGCAGGAGGAGGAAGG - Intergenic
1100702306 12:97161470-97161492 GGGCTGAAGCAGGGTGAGGAGGG + Intergenic
1101246875 12:102891886-102891908 TGGTTGGAGCAGGTGGAGGCTGG - Intronic
1101541869 12:105672659-105672681 GGGCTGCAGGAAGCGGAGGAAGG - Intergenic
1101604737 12:106239577-106239599 AGGCTCCAGCACGTGGAGGATGG - Exonic
1101726543 12:107392943-107392965 AGGCTGCAGAAGGTGAAGGATGG + Intronic
1101761650 12:107663700-107663722 GGGATGAAGTTGGTGGAGGAAGG - Intergenic
1101777952 12:107810714-107810736 GGGCTGGAGTATATGGAGGTGGG + Intergenic
1101965882 12:109281600-109281622 GGGCTGGACCTGGTGGTGCAGGG + Exonic
1102394296 12:112574360-112574382 GGGTTGATGAAGGTGGAGGAGGG + Intronic
1102394338 12:112574495-112574517 GGGTTGATGAAGGTGGAGGAGGG + Intronic
1102394404 12:112574696-112574718 GGGGTGATGAAGGTGGAGGAGGG + Intronic
1102394431 12:112574785-112574807 GGGGTGATGAAGGTGGAGGAGGG + Intronic
1102394465 12:112574879-112574901 GGGGTGGTGAAGGTGGAGGAGGG + Intronic
1102394511 12:112575005-112575027 GGGGTGGTGGAGGTGGAGGAGGG + Intronic
1102454877 12:113065185-113065207 GAGCTGGAGCAGGTGGGGCAGGG + Intronic
1102504440 12:113374783-113374805 GAGCTGCAGCAGGCTGAGGAGGG - Exonic
1102528988 12:113532402-113532424 GGGCTGGAGTATGTGGATGGCGG - Intergenic
1102570597 12:113824953-113824975 GGTCTTGAGCAGGGGGAGGTGGG - Intronic
1102677414 12:114668113-114668135 GGGCTGGGGACGGAGGAGGAGGG + Intergenic
1102737868 12:115179179-115179201 GGGAAGGAGGAGGGGGAGGAAGG + Intergenic
1103204644 12:119118949-119118971 AGGCTGGACCAGGAGTAGGATGG - Intronic
1103325086 12:120115197-120115219 GGTTTGGATCAGGTGAAGGATGG - Intronic
1103345266 12:120245071-120245093 GTGCTGGGGAAGGAGGAGGAGGG + Intronic
1103361022 12:120353713-120353735 TGGCTGGAGCAGAGGGAGGGAGG - Intronic
1103932562 12:124458306-124458328 GGGCTGCAGCAGAGAGAGGAGGG + Intronic
1103949050 12:124541632-124541654 GGGATGGAGCTGGAGGGGGATGG + Intronic
1104015623 12:124959934-124959956 GCCCTGGAGCAGGGGGAGGGAGG + Intronic
1104072174 12:125355348-125355370 GGCCTGGAGGAGCTGGAGGCAGG + Intronic
1104360085 12:128124807-128124829 TGGCCTGGGCAGGTGGAGGAAGG - Intergenic
1104460271 12:128950180-128950202 GGGATGGAGCAGCTGCAGGGAGG + Intronic
1104637526 12:130447472-130447494 GCGCTGGAGGCGGGGGAGGAGGG + Intronic
1104842012 12:131829949-131829971 GGTCTTGAGGAGGTGGAGGGGGG - Intronic
1104842256 12:131830731-131830753 GGGCTGGAGCCGGGGCTGGAGGG + Intronic
1105353131 13:19633746-19633768 AGGATGGAGCAGGTTGCGGAGGG + Exonic
1105353399 13:19635852-19635874 GGGCGCGACCAGGTGGAGGTAGG + Intronic
1105465631 13:20637127-20637149 GGGCTGGGGGAAGAGGAGGATGG + Intronic
1106230485 13:27817418-27817440 GGGATGGAGCAGCAGGAGGCTGG + Intergenic
1107298424 13:38939749-38939771 TGGCTGGAGCAGGAGGAAGGGGG + Intergenic
1107845517 13:44508751-44508773 TGGCTGGAGCATGGGGAGCAAGG - Intronic
1107851666 13:44577408-44577430 GGGCAGGCGGAGGAGGAGGAGGG + Intergenic
1107907389 13:45073930-45073952 TGGCTGGAGCAGGAGGAAAAGGG + Intergenic
1108132972 13:47323279-47323301 TGGCTGGAGGACATGGAGGAAGG - Intergenic
1108583684 13:51849331-51849353 GGGCTGGAGGAAGGGGAGCACGG + Intergenic
1109075734 13:57832414-57832436 TGGCTGGGGCAGTTGGAGGAGGG + Intergenic
1109121965 13:58469149-58469171 TGGCTGGAGAAGGAGGAAGAGGG + Intergenic
1109210785 13:59533737-59533759 AGTCTGGGGCAGGTGGGGGATGG - Intergenic
1109457453 13:62611358-62611380 GGGATGGAGCACATGGAGGAAGG - Intergenic
1110249444 13:73365111-73365133 GGGCTGGAGCTGGGGCAGGGTGG + Intergenic
1110772501 13:79366070-79366092 AGGGTGGAGCAGGAGGAGGCTGG + Exonic
1110972168 13:81778000-81778022 GGGTTGGAGGAGGGTGAGGATGG - Intergenic
1110975479 13:81828564-81828586 GGGAAGGAGGAGGAGGAGGAGGG + Intergenic
1112073131 13:95876630-95876652 GTGCTGTATCAGGTTGAGGAAGG + Intronic
1112091823 13:96090944-96090966 GTGCAGGAGCTGGTGCAGGAGGG - Exonic
1112131398 13:96527762-96527784 TGGCTGGAGCAGAGGGAGGCAGG + Intronic
1112505248 13:99971153-99971175 GGGCAGGAGGAGGAGGAGGCGGG + Exonic
1112622608 13:101067198-101067220 GGGGAGGAGAAGGTAGAGGAAGG + Intronic
1112664897 13:101558321-101558343 GGGAGGGAGAAGGTGGAGGTTGG + Intronic
1112752897 13:102599642-102599664 GGGCATGATCAAGTGGAGGATGG + Intronic
1112783322 13:102925833-102925855 GGGCTGGAGCAGGGTGGGCAAGG + Intergenic
1112864029 13:103871710-103871732 TGGCTGGAGCAGGAGGAAGGGGG + Intergenic
1113087150 13:106580374-106580396 AGGTGGGAGGAGGTGGAGGATGG + Intergenic
1113144745 13:107196147-107196169 GGAGTGGAGAAGGTGGAAGAAGG + Intronic
1113346475 13:109482962-109482984 GAGCTAGAGCAAGTGAAGGATGG + Intergenic
1113412066 13:110099091-110099113 GAGGAGGAGGAGGTGGAGGATGG + Intergenic
1113539176 13:111093369-111093391 GTGCTGGGGGAGGTGGAAGATGG - Intergenic
1113769362 13:112898566-112898588 GCGCTGGGGCAGGAGGAGCAGGG - Intronic
1113792426 13:113036002-113036024 TGGCCTCAGCAGGTGGAGGATGG + Intronic
1113803073 13:113096446-113096468 GTGGTGGAGCTGGTGCAGGAGGG + Exonic
1113814481 13:113161762-113161784 GGACCTGAGCAGGAGGAGGACGG - Intronic
1113814508 13:113161846-113161868 GGACCTGAGCAGGAGGAGGATGG - Intronic
1113814537 13:113161930-113161952 GGACCTGAGCAGGAGGAGGATGG - Intronic
1113814588 13:113162098-113162120 GGACCTGAGCAGGAGGAGGATGG - Intronic
1113814629 13:113162224-113162246 GGACCTGAGCAGGAGGAGGATGG - Intronic
1113814808 13:113162770-113162792 GGACCTGAGCAGGAGGAGGATGG - Intronic
1113814846 13:113162901-113162923 GGACCTGAGCAGGAGGAGGATGG - Intronic
1114267387 14:21080954-21080976 CGGCTGGAGCAGGTTGAGAGTGG + Exonic
1114483576 14:23049563-23049585 GGGGTGGAGGAGGAGGAGAAGGG + Intronic
1114665059 14:24372731-24372753 GGGCTGGAGTTGGGGGAGGAGGG + Intronic
1114852551 14:26398826-26398848 AGGCTGAAGCTGGAGGAGGATGG - Intergenic
1115354762 14:32435567-32435589 GGGATGGAGCTGATGGAGGTGGG - Intronic
1115712636 14:36067630-36067652 TGGCTGGAGCAGCTGGAGACTGG - Intergenic
1117308135 14:54496304-54496326 GGACTGGAGAAGGGGGAGTAGGG - Intergenic
1117411109 14:55451975-55451997 GGGGTTGAGCAGGTGGAAGATGG - Intronic
1117497454 14:56319821-56319843 GGGGTGGAGCAAGTGAGGGAGGG - Intergenic
1118199285 14:63657402-63657424 GGGCTGGAAGAGGTGGAAAATGG - Intergenic
1118225773 14:63897783-63897805 GAGCAGGAGCAGGGGGAGCATGG - Intronic
1118262152 14:64257747-64257769 GGGATGGGGTAGGTGGGGGATGG + Intronic
1118262158 14:64257763-64257785 GGGATGGGGTAGGTGGAGGTTGG + Intronic
1118762665 14:68890243-68890265 TGCCTGGAGCAGGTGGAGAAGGG - Exonic
1119020601 14:71108873-71108895 TGGCTGGAGCTGCTGGAGGAAGG - Exonic
1119100153 14:71871969-71871991 GGGGTGGAGGGGGTGGTGGAGGG + Intergenic
1119145494 14:72310107-72310129 GGGGTGGAGAAGGTGCTGGAGGG - Intronic
1119260778 14:73237156-73237178 GGGGTGGAGAAGGTGGTGGCTGG + Intergenic
1119675034 14:76547184-76547206 AGGCTGGAGAAGGAGAAGGAAGG + Intergenic
1119744277 14:77033213-77033235 GGGCTGGGGAGGGTGGGGGAAGG + Intergenic
1119769820 14:77213549-77213571 GGGCGGGGGAAGGTGTAGGAAGG - Intronic
1120213668 14:81659273-81659295 GAGATGGTGCGGGTGGAGGAAGG - Intergenic
1120296592 14:82649059-82649081 AGGCTGGAGGAGGATGAGGAAGG + Intergenic
1120765487 14:88323735-88323757 GCGCTGCAGGAGGCGGAGGAAGG + Intronic
1120974527 14:90237081-90237103 GGGGTGGAGGTGGTGGGGGAAGG - Intergenic
1121080413 14:91103400-91103422 GGGATGGAGACGGAGGAGGAGGG - Intronic
1121176851 14:91897006-91897028 GGGCTGTTGCAGGTGGATGGTGG - Intronic
1121444716 14:93971257-93971279 GGGCTGGAGCTTGGGGAGGAAGG + Intronic
1121559935 14:94866916-94866938 GGGCAGGTGCAGGAGGAAGAGGG + Intergenic
1121654994 14:95588509-95588531 GGGCTGGAGGAGGATGGGGAGGG + Intergenic
1121668256 14:95688854-95688876 GGGCTGGAGGGAGTCGAGGATGG + Intronic
1121670856 14:95709789-95709811 GGGCAGGACCAGATGGAGGCAGG + Intergenic
1122270697 14:100567478-100567500 GGGCTGGGGCGGGTGGTGGTTGG + Intronic
1122408894 14:101516152-101516174 GGACTGGAGCAGGTGGACTGGGG - Intergenic
1122422693 14:101587445-101587467 GGGCTGGAGGAGCTCGAGGCAGG + Intergenic
1122524419 14:102370640-102370662 GGGCTTTAGCAGGAGGAAGATGG + Intronic
1122580603 14:102769290-102769312 GTGCTGGAGCAGGTGATCGAGGG + Intergenic
1122656794 14:103267467-103267489 AGGCTGGAGCGGGAGGAAGAGGG + Intergenic
1122782672 14:104150206-104150228 GGGGAGGAGGAGGAGGAGGAGGG - Intronic
1122794774 14:104200743-104200765 GGCCCAGAGCAGGTGGGGGAAGG - Intergenic
1122812973 14:104298038-104298060 ATGCAGGGGCAGGTGGAGGAAGG - Intergenic
1122813408 14:104300216-104300238 TGGCTGGCCCCGGTGGAGGAGGG + Intergenic
1122874198 14:104655872-104655894 GGGCGTGATCAGGAGGAGGATGG + Intergenic
1122886931 14:104714340-104714362 ACCCTGGAGCAGTTGGAGGAGGG + Exonic
1122961152 14:105094079-105094101 GGGTTGGAGGAGATGGAGGCAGG - Intergenic
1123021371 14:105399275-105399297 GGGTAGGAGCAGGGGGAGGTGGG - Intronic
1123134111 14:106011776-106011798 GGTCTGGAGCAGGTGCAGGGAGG - Intergenic
1123165800 14:106324109-106324131 GGTCAGGAGCAGGTGCAGGGAGG - Intergenic
1123168497 14:106349137-106349159 GGTCAGGAGCAGGTGCAGGGAGG - Intergenic
1123194755 14:106605971-106605993 GGTCAGGAGCAGGTGCAGGGAGG - Intergenic
1123197039 14:106627103-106627125 GGTCAGGAGCAGGTGCAGGGAGG - Intergenic
1123198380 14:106638973-106638995 GGTCAGGAGCAGGTGCAGGGAGG - Intergenic
1123222814 14:106872684-106872706 GGTCAGGAGCAGGTGCAGGGAGG - Intergenic
1123691959 15:22845677-22845699 GGGTTGCAGGAGGAGGAGGAGGG + Intronic
1123787638 15:23688747-23688769 GAGAAGGAGGAGGTGGAGGAGGG - Intergenic
1124059672 15:26278290-26278312 GGGCTGGAGGAAGGGGAGAAGGG - Intergenic
1124343949 15:28908941-28908963 GGGCTGGGGGAGGTGGAAGGAGG - Intronic
1124373276 15:29115394-29115416 GGTCTGGCTCAGGAGGAGGAGGG + Intronic
1124955022 15:34354640-34354662 GGGCAGCAGCAGGAGGAGGAAGG + Exonic
1125006176 15:34820458-34820480 CGCCTGGAGAAGGTGGATGATGG - Intergenic
1125289600 15:38130990-38131012 GGGATGGAGGAGGCGGGGGAAGG + Intergenic
1125364598 15:38900468-38900490 GGGTAGAAGCGGGTGGAGGATGG + Intergenic
1125506090 15:40268484-40268506 GTGGTGGAGGAGGAGGAGGAAGG - Intronic
1125719063 15:41836395-41836417 GGGCTGGCTGGGGTGGAGGAGGG + Intronic
1126093908 15:45074272-45074294 GGGCTGGGGCATGTTGGGGAGGG - Exonic
1126336301 15:47589392-47589414 GGGCTGGAGCAGGAACAGGAAGG - Intronic
1126522800 15:49615541-49615563 TGGCTGGAGCAGGAGGAAAAGGG - Intronic
1126777630 15:52112882-52112904 GGACTGGAACAGGTGCAGGTGGG - Intergenic
1127328465 15:57917053-57917075 GGGCTGGAGGAAGGGGAGGATGG + Intergenic
1127480416 15:59372379-59372401 GGGGTGGAGAAGGTGGACGCGGG - Intronic
1128249244 15:66153013-66153035 GGGCTGGAGGTGTTGGAGCAGGG - Intronic
1128340789 15:66821320-66821342 GGGCTGGGACAGCTGGAGGAAGG + Intergenic
1128384032 15:67134569-67134591 GAGCTGGAGAAGCTGGAGGTAGG - Intronic
1128869821 15:71145864-71145886 GAGGAGGAGCAGGAGGAGGAGGG + Intronic
1129117296 15:73371668-73371690 GGGCAGGCACAGATGGAGGAAGG + Intergenic
1129155230 15:73713533-73713555 AGGCTAGAGCAAGAGGAGGAAGG - Exonic
1129253774 15:74322610-74322632 TGGCTGGACCACCTGGAGGAAGG + Intronic
1129464058 15:75713861-75713883 GGGCTGGAGCAGATAGATGGAGG - Intergenic
1129523270 15:76198917-76198939 GGTCTGGAGCAGAGGGAGTAGGG + Intronic
1129665308 15:77576313-77576335 ATGCTGGAGGAGGAGGAGGAGGG + Intergenic
1129665324 15:77576353-77576375 GGGGAGGAGAAGGAGGAGGAGGG + Intergenic
1129687633 15:77695685-77695707 AGGCTGGGGCAGGGGGAGGCTGG - Intronic
1129876346 15:78978065-78978087 GGGCTGTTGCAGGTGGGGCAAGG + Intronic
1129919788 15:79310823-79310845 GTGCTGCAGCAGCTGGAGGGTGG + Intergenic
1129933069 15:79428325-79428347 GGGATGGGGGAGGTAGAGGAGGG - Intergenic
1130646386 15:85730910-85730932 GGGACAGAGCATGTGGAGGAAGG - Intronic
1130662676 15:85843004-85843026 GGGCTGGAGCAGGTGCTGCATGG + Intergenic
1130726287 15:86442920-86442942 GGGCAGGAGCAGGGGGTGGGAGG - Intronic
1130744361 15:86635262-86635284 GGGAAGGAGGAGGAGGAGGAGGG - Intronic
1130890695 15:88131535-88131557 TGACTGGGGCAGGGGGAGGATGG + Intronic
1130914355 15:88293026-88293048 GGGCTGGAGAGAGTGGGGGATGG - Intergenic
1130959825 15:88652390-88652412 GGGGAGGAGGAGGGGGAGGAGGG - Intronic
1130959850 15:88652451-88652473 GGGGAGGAGGAGGGGGAGGAGGG - Intronic
1130995581 15:88902012-88902034 GGGCAGGAGGTGGTGGAGCAGGG - Intronic
1131005295 15:88972802-88972824 GGGCTGGAGCAAGTGGCTGAAGG + Intergenic
1131052929 15:89360029-89360051 AAGCTGGAGAAGCTGGAGGAAGG + Intergenic
1131165872 15:90141898-90141920 GGAGTGGAGCCCGTGGAGGATGG + Intergenic
1131261169 15:90888658-90888680 GGCCTGGAGCAGCTGGAAGATGG + Intronic
1131262391 15:90894095-90894117 CGGCTGGAGCATCTGGAAGAGGG - Intronic
1131342894 15:91619462-91619484 GAGCTGGAGCAGGTGAAGGGGGG - Intergenic
1131493489 15:92882769-92882791 GGGCGGGGGGAGGAGGAGGAGGG + Intergenic
1131514479 15:93067930-93067952 AGGCAGGACCAGGAGGAGGAAGG + Intronic
1131676395 15:94674728-94674750 GGCCTGGAGCAGATGAAGGGAGG + Intergenic
1132069780 15:98766010-98766032 GGGTTAGGGCAGGAGGAGGAAGG + Intronic
1132154580 15:99486566-99486588 GGGGTGGAGTCGGGGGAGGAAGG + Intergenic
1132453219 15:101979886-101979908 GGGCTGGGGCGGGGGGAGGGTGG - Intergenic
1132482927 16:175577-175599 TAGGTGGAGGAGGTGGAGGAGGG - Intergenic
1132718880 16:1306310-1306332 GGCATGGAGCAGGTGGGGGAGGG - Intergenic
1132991518 16:2798181-2798203 GTGCTGGAGGAGGTGGTGGGTGG + Intergenic
1133118170 16:3589979-3590001 GTGCTGCAGCAGGAGGATGAGGG - Exonic
1133220373 16:4316910-4316932 GGTCTGGAGCGGGTGGAGGAGGG + Intronic
1133234467 16:4381484-4381506 GGGCTGCAGCAGCTGGACGAGGG + Exonic
1133398726 16:5469146-5469168 AGCATGGAGCAGGTGGTGGAGGG + Intergenic
1133599587 16:7326193-7326215 GGGATTGAGGAGGTGGTGGAGGG + Intronic
1133643537 16:7741032-7741054 GGGATGGGGCAGAGGGAGGAGGG - Intergenic
1134063778 16:11213825-11213847 GGGCTGGAGTAGGTGGCCCACGG - Intergenic
1134369489 16:13609760-13609782 GAGCAGGAGCAGATGGGGGAAGG + Intergenic
1134619103 16:15674211-15674233 GGGAGGGAGAAGATGGAGGAAGG - Intronic
1135123401 16:19785994-19786016 GGGCCGGAGCATGAGGAGCAAGG + Intronic
1135425890 16:22335729-22335751 GGGCTGGACCAGGGTGGGGAGGG - Intergenic
1136047769 16:27628701-27628723 AGGCTGGAGCACTTGGAGCAAGG + Exonic
1136075215 16:27812498-27812520 GGACAGTAGCAGGTGGTGGACGG + Intronic
1136139759 16:28281283-28281305 GGGGTGGAGCAGGAGGGGGCTGG - Intergenic
1136151975 16:28356825-28356847 CACCTGGAGGAGGTGGAGGAGGG + Intronic
1136349831 16:29699551-29699573 GGGCTAGAGCAGCTGCAGGGAGG + Intergenic
1136539905 16:30923521-30923543 GGGGAGGAGGAGGAGGAGGAGGG + Intronic
1136624202 16:31451868-31451890 GAGCTCCAGCAGGTGGGGGAGGG - Intergenic
1136684836 16:31988083-31988105 AGGCTGGAGCAGGTGGTGGCTGG + Intergenic
1136785450 16:32931618-32931640 AGGCTGGAGCAGGTGGTGGCTGG + Intergenic
1136884322 16:33922186-33922208 AGGCTGGAGCAGGTGGTGGCTGG - Intergenic
1137306305 16:47203865-47203887 GGGCTGGAGCAGGAGGGAAATGG + Intronic
1137557051 16:49477284-49477306 GGGAAGGAGGAGGGGGAGGAGGG + Intergenic
1137557061 16:49477305-49477327 GGGAAGGAGGAGGGGGAGGAGGG + Intergenic
1137557071 16:49477326-49477348 GGGAAGGAGGAGGGGGAGGAGGG + Intergenic
1137557086 16:49477356-49477378 GGGAAGGAGGAGGGGGAGGAGGG + Intergenic
1137580595 16:49631433-49631455 GGGCTGAAGCTGCAGGAGGAGGG - Intronic
1137593580 16:49708826-49708848 GTGCTGAAGCAGGAGGAGGCAGG - Intronic
1137626136 16:49909991-49910013 GGGCTGGAGGAGCTTGAAGAAGG - Intergenic
1137659323 16:50190861-50190883 GGGCTGGAGGAAGGGGAGAAGGG - Intronic
1137906870 16:52332316-52332338 GAGCTAGAGCAGGGGGAGGGAGG - Intergenic
1138126166 16:54440471-54440493 AGGATGGAGGAGGAGGAGGAAGG - Intergenic
1138190669 16:55011061-55011083 CAGCTGGAGCAGCTGCAGGATGG + Intergenic
1138225454 16:55290742-55290764 GTGCTGGAGGAGGTTGAAGATGG + Intergenic
1138346888 16:56325669-56325691 GCACTGGAGGAGGTGGAGGCAGG - Intronic
1138550231 16:57743863-57743885 GGGCTGTGGCGGTTGGAGGAGGG - Intronic
1138607825 16:58099967-58099989 GAGCTGGAGAAGGTGAAAGAGGG + Intergenic
1138889841 16:61128833-61128855 GTGCGGGAGCCGGTGGGGGAGGG + Intergenic
1139018120 16:62714826-62714848 GGGGAGGAGGAGGTGGAGAAGGG - Intergenic
1140033993 16:71359209-71359231 TGGCTGGAGCAGCTGAAGGCAGG - Intronic
1140455492 16:75102980-75103002 GTTCTGGAGAAGGTGGAGGATGG - Intronic
1141372428 16:83500447-83500469 GGGGAGGAGGAGGCGGAGGAGGG - Intronic
1141616886 16:85214847-85214869 GGGGTGGGGCAGGAGGAGAAGGG + Intergenic
1141701004 16:85642021-85642043 AGGCTGGAACAGCTGGAGGGAGG - Intronic
1141731823 16:85828059-85828081 GGACTGGAGCAGCGGGAGGCTGG + Intergenic
1141754439 16:85982079-85982101 GGGCTGGAGAAGGTGGTGGAGGG + Intergenic
1141775761 16:86121756-86121778 AGGCAGGAGGAGGAGGAGGAGGG - Intergenic
1141992459 16:87618328-87618350 GGGCAGCAGCTGGGGGAGGAGGG + Intronic
1142007013 16:87694145-87694167 GAACTGGACCAGGAGGAGGAGGG + Intronic
1142125967 16:88410899-88410921 GGGCTGGAGGAGGAGGAGGTGGG - Intergenic
1142143619 16:88483418-88483440 GGGCCAGAGGTGGTGGAGGAAGG - Intronic
1142145750 16:88492334-88492356 GGGCTGGGGCAGGTTCAGAAGGG - Intronic
1142184391 16:88687450-88687472 GGGGTGGAGAAGGTGGGGGGTGG + Intergenic
1142186771 16:88698436-88698458 GGGCCCGAGCAGGAGGAGGGTGG + Intronic
1142302271 16:89265655-89265677 TGGCTGGAGCTGGAGGAAGATGG - Intergenic
1142305118 16:89280423-89280445 GGGCTGGAGGACGTCAAGGACGG - Exonic
1142362238 16:89632944-89632966 GGGCTGCAGGAGGAGGAGGGAGG + Intronic
1142499494 17:324273-324295 GAGGCGGAGCAGGTGGAGGCAGG - Intronic
1142599058 17:1044183-1044205 GGGCAAGAGCCGGTGGAGGGGGG + Intronic
1142667433 17:1470882-1470904 GGGCTGGAGCTGGTGGGGAGGGG + Intronic
1142672281 17:1492711-1492733 TGGTTGGAGCAGGAAGAGGAGGG + Exonic
1142688867 17:1592931-1592953 GGGCTGGGGCAGGGGAAGGGCGG - Intronic
1142742292 17:1938093-1938115 GAGCTGGAGCAGGTGGGGCTGGG - Intronic
1143141740 17:4745088-4745110 GGAGGGGAGCAGGGGGAGGACGG - Intronic
1143284917 17:5781766-5781788 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284923 17:5781800-5781822 ATGCAGGTGCAGGTGGAGGATGG + Intronic
1143284929 17:5781834-5781856 ATGCAGGTGCAGGTGGAGGATGG + Intronic
1143284940 17:5781890-5781912 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284946 17:5781924-5781946 ATGCAGGTGCAGGTGGAGGATGG + Intronic
1143284957 17:5781980-5782002 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143365049 17:6401964-6401986 TGGCTGGAGCAGGAGGAGGAGGG + Intronic
1143410161 17:6703898-6703920 GGCCTGGAGCTGGTGGACAAGGG - Exonic
1143483413 17:7239500-7239522 GAGGTGGAGGAGGAGGAGGAGGG - Exonic
1143582026 17:7833295-7833317 GGGCAGGAGCGGGTGTGGGATGG - Intronic
1143608889 17:8006430-8006452 GGGCTGCCGCAGGTGGCAGATGG + Exonic
1143621641 17:8084325-8084347 GAGCTGAGGCAGGTGGAGGAGGG - Intronic
1143631194 17:8141240-8141262 GGGCTGGAGCCCATGGAAGAGGG - Exonic
1143696473 17:8623939-8623961 GGGGTGGAGGAGCTGCAGGATGG - Intronic
1143978020 17:10844599-10844621 GAGGTGGAGCAGTTGGAAGATGG - Intergenic
1144012584 17:11163740-11163762 GGGACAGAGCAAGTGGAGGAAGG + Intergenic
1144346501 17:14354463-14354485 TGGCTGGAGCAGGGGGACCAAGG - Intergenic
1144396863 17:14852820-14852842 GAGCAGGAGCAAGTGGAGGAGGG + Intergenic
1144572341 17:16407742-16407764 GGGGTGGAGGAGCCGGAGGAGGG + Intergenic
1144738507 17:17568268-17568290 GGGCTGGAGGAGGTGATGGTGGG - Intronic
1144837815 17:18166414-18166436 GAGATGGAGCAGGTGGACGGCGG + Exonic
1144872622 17:18380462-18380484 GGGCTGGAGTGGGAGGAGGTGGG + Intronic
1145092264 17:19995716-19995738 AGGCTGAAGCAGGAGGAGAATGG - Intergenic
1145193667 17:20868674-20868696 CGGCTGGAGCAGGTAGGAGAAGG + Intronic
1146173623 17:30650934-30650956 GGGCTGGACCAGGTGAGGGCCGG - Intergenic
1146347076 17:32066955-32066977 GGGCTGGACCAGGTGAGGGCCGG - Intergenic
1146660743 17:34663712-34663734 GGGCTGCAGCAGGGGGAGGTGGG - Intergenic
1146693254 17:34891040-34891062 TGGCTGGAGCAAGGGGAGGGTGG - Intergenic
1146836897 17:36118243-36118265 GGGGTGGATCAGGTGCTGGAAGG + Intergenic
1146896641 17:36545868-36545890 GGCCTGGGGGAGGGGGAGGAGGG - Intronic
1146911289 17:36649948-36649970 GGGCTGGGGGAGGGGAAGGAGGG + Intergenic
1147121748 17:38339195-38339217 GGGCAGGAGCAGGAGGAATAGGG + Intronic
1147125526 17:38365378-38365400 GGGGTGGAGGAGGCGGAGGTAGG - Exonic
1147145776 17:38483764-38483786 AGGCTGGAGCAGGTGGTGGCTGG + Intronic
1147264378 17:39225879-39225901 GGGCTGGGGCCGGCGGGGGAGGG - Intergenic
1147332556 17:39707414-39707436 TGGCTGGAGCAGGTGGACAGGGG - Intronic
1147761501 17:42800326-42800348 GGGTTGGTGAAGGGGGAGGAAGG + Intronic
1147864171 17:43542107-43542129 GGACTGGAGCCCTTGGAGGAGGG + Intronic
1147917981 17:43900115-43900137 GGCAGGGAGCAGGAGGAGGAAGG - Intronic
1147995822 17:44359878-44359900 GTGCAGGGGCAGGTGGAGGGGGG - Intronic
1148128300 17:45247929-45247951 GGGCTGGATCAGGCGGAAGCCGG + Intergenic
1148324781 17:46776908-46776930 GGGCTGGGAGAGGGGGAGGAAGG - Intronic
1148352273 17:46949751-46949773 AGACTGGAGCAGGTGGAGCCTGG + Intronic
1148782828 17:50131002-50131024 GCCCTGGAGCAGGTGGGGGTGGG + Intergenic
1148963222 17:51410877-51410899 GGGCTGGAGGAGGAGAATGAAGG + Intergenic
1149155533 17:53624754-53624776 GGGTTGCAGCATGGGGAGGAAGG + Intergenic
1149261392 17:54884099-54884121 GGGCGGGAGCAAAAGGAGGATGG - Intergenic
1149468491 17:56897889-56897911 TGCCTGGTGCAGATGGAGGAGGG - Intronic
1149498294 17:57132658-57132680 GGGCTGGAGGGGGTGAGGGAGGG + Intergenic
1149512760 17:57256626-57256648 GGGGAGGAGGAGGGGGAGGAGGG + Exonic
1149563777 17:57627738-57627760 AGGACGGAGCAGGAGGAGGAGGG - Intronic
1149565226 17:57636440-57636462 GGGCTAGAGGAGGGGGTGGATGG - Intronic
1149595191 17:57861146-57861168 GAGCTGGAGGAGGAGGAGGAAGG + Intergenic
1149626296 17:58083202-58083224 GAGCTGGAGCGGGTGGGGGAGGG - Intergenic
1149649707 17:58269173-58269195 GGGCTGGAAGTGGTGTAGGACGG - Intergenic
1149655883 17:58309372-58309394 GGGCTGGGACTGGTGGAGGTGGG + Exonic
1149659907 17:58328830-58328852 GGGGAGGAGGAGGAGGAGGAGGG - Intergenic
1150251051 17:63704607-63704629 GGGCTGTAGCGGGTGGGGGGGGG + Intronic
1150338080 17:64344508-64344530 GGGGTGGAGGAGGGGCAGGAAGG - Intronic
1150364843 17:64573177-64573199 GGGGAGGAGGAGGAGGAGGAGGG + Intronic
1150644563 17:66969834-66969856 GGCCTGGAGTGGGTGGAGAAAGG - Intronic
1150748222 17:67834079-67834101 AGGCTGGAGAAGGTGATGGATGG - Intronic
1151174458 17:72275658-72275680 AGGATGAAGCAGGTGGAAGAGGG - Intergenic
1151367030 17:73624073-73624095 TGGCTGGAGCAGGAGCAGGGAGG + Intronic
1151382401 17:73734902-73734924 TGGCTGGAGCAGCAGGTGGAAGG - Intergenic
1151383816 17:73743182-73743204 GGGCGGGAGGAGGCGGAGGTGGG - Intergenic
1151480860 17:74369427-74369449 GGGCGGGGGAAGGAGGAGGAAGG - Intronic
1151514148 17:74581358-74581380 GGGCTCTAGCAGGAGCAGGACGG + Intronic
1151527636 17:74681792-74681814 TGGATGGGGCAGGTGGTGGATGG - Intronic
1151546537 17:74796777-74796799 AGGCTGGGGAAGGTGGAGAAGGG - Intronic
1151726350 17:75887053-75887075 AGGCTGAGGCAGGAGGAGGAAGG + Intronic
1151734071 17:75927851-75927873 GGCCTGGAACAGCTCGAGGAAGG + Intronic
1151927476 17:77209489-77209511 GGGCCGGCCCAGGTGCAGGAAGG - Intronic
1151945930 17:77319882-77319904 GGGCTGGAGGAGGTGGAGAGAGG + Intronic
1152031205 17:77844584-77844606 GGGCTGGAGGAGGAGGAAGGAGG + Intergenic
1152045196 17:77930723-77930745 GGGCTGGGGGAGGTGGGGTAGGG - Intergenic
1152071158 17:78134388-78134410 GGGCAGGTGGAGCTGGAGGAGGG + Exonic
1152151551 17:78604340-78604362 GGACTCAGGCAGGTGGAGGAGGG - Intergenic
1152232049 17:79118648-79118670 GCCTTGGAGGAGGTGGAGGAGGG - Intronic
1152298198 17:79480570-79480592 GGGGCTGTGCAGGTGGAGGAAGG - Intronic
1152312202 17:79558258-79558280 GGCCTGGCGCAGGAGCAGGAAGG + Intergenic
1152319589 17:79601036-79601058 GGGCGGGAGCAGCGGGAGCATGG - Intergenic
1152435388 17:80273297-80273319 GGGCAGGAGCTGAAGGAGGAAGG + Exonic
1152456866 17:80421770-80421792 GGGATGGAGCAGGTGGCCGAAGG + Intronic
1152618609 17:81349561-81349583 GGGCTTGGCCAGGTGGAGGTCGG + Intergenic
1152623967 17:81379974-81379996 GGGGGGGAGCAGGGGGTGGAGGG - Intergenic
1152642920 17:81456640-81456662 GGGCTGGAGGAGGGGGCGGCAGG + Intronic
1152663057 17:81551917-81551939 GGGCAGGAGCAGGTGAGGGCGGG - Exonic
1152763044 17:82119543-82119565 GGCCTGGGGCTGGTGCAGGAAGG + Intronic
1152805396 17:82353545-82353567 GGGCTCCAGCAGATGTAGGAAGG - Intergenic
1152863527 17:82709387-82709409 TGGGTGGGGCAGGTGGAGCAGGG - Intergenic
1152875364 17:82783506-82783528 GGGCTGGGGAAGGTGAGGGACGG - Intronic
1152961037 18:80293-80315 GGCCTGGAGGAGGAGCAGGAAGG - Intergenic
1153027718 18:686705-686727 GGGCACTGGCAGGTGGAGGAGGG + Intronic
1153550712 18:6258811-6258833 GGGTGGGAGAGGGTGGAGGAGGG + Intronic
1153652813 18:7256357-7256379 AGGCTGGAGCAGGCAGAGAATGG - Intergenic
1153814433 18:8780401-8780423 GGGCTGGACAAGGTGGGGGCAGG - Intronic
1153927134 18:9843962-9843984 GCTCTGGGGCAGGTGGAGGAAGG + Intronic
1154027609 18:10723483-10723505 GGGCTGTAGCTGGAGGAGGGTGG + Intronic
1154031228 18:10756000-10756022 GGGATGGAGAATGAGGAGGAGGG + Intronic
1154313411 18:13284760-13284782 GGCCTCGAGCAGGGGCAGGAAGG - Intronic
1154502893 18:15005352-15005374 TGGCTGGAGCAGATGAGGGAAGG - Intergenic
1155168590 18:23250351-23250373 GGGGTTGAGAAGCTGGAGGAAGG + Intronic
1155707695 18:28837288-28837310 TGGCTGGAGCAGGAGAAAGATGG + Intergenic
1155991745 18:32285422-32285444 GGGCTGGATAGGGTGCAGGAAGG - Intronic
1156233143 18:35174483-35174505 GGGGTGGAGTGGGTGGGGGAGGG - Intergenic
1156251998 18:35360257-35360279 TTGCTGGGGCAGGTGGGGGAGGG + Intergenic
1156255340 18:35390221-35390243 GGACTGGGGCAGGTGGGGCAGGG - Intergenic
1156475804 18:37404607-37404629 GTGCTGGAGCAGGTCGAGCCAGG - Intronic
1156525584 18:37764785-37764807 GAACTGGAGCAGAAGGAGGAGGG - Intergenic
1157220206 18:45824109-45824131 GGGTGGGGGCAGGTGAAGGAGGG + Intergenic
1157357670 18:46950334-46950356 GGTCTGGAGAAGCTGGAGGAGGG + Intronic
1157449372 18:47773748-47773770 GGGAGGGAGCAGGGGGAGGCAGG + Intergenic
1157488626 18:48107217-48107239 GGAGGGGAGAAGGTGGAGGAGGG + Intronic
1157513691 18:48296175-48296197 GGGCCTGAGCAGGTGGTGGGGGG - Intronic
1157686367 18:49645882-49645904 GGGCGTGAGGAGGCGGAGGATGG + Intergenic
1157754546 18:50206253-50206275 TGGCTGGGGCTGGTGGAGGGTGG - Intergenic
1157796524 18:50580175-50580197 AGGCTGGAGGAGGAGGAGGCAGG + Intronic
1157984614 18:52422918-52422940 GGGCTTGTGCAGGTGGTGGCAGG + Intronic
1158099857 18:53818950-53818972 GGGCTGGAGGAGGAGGAAGGTGG + Intergenic
1158142410 18:54269559-54269581 GGGGTGGAGCCGGAGGAGGAAGG + Exonic
1158477260 18:57791143-57791165 GGGCTGGAGCCAGTGGGGAATGG - Intronic
1158525505 18:58209349-58209371 GAGGTGGAGGAGGAGGAGGAGGG - Intronic
1158566235 18:58556560-58556582 GTGGTGGAGCTGGTGGAGGAAGG + Intronic
1158733273 18:60050120-60050142 TGGCTGGAGAAGCTGGAGAAGGG + Intergenic
1158779167 18:60625706-60625728 GGGCTGAAGCAGTTGGGGGAGGG + Intergenic
1158893273 18:61892994-61893016 GGGCTGGAGCGGGTGCACTAGGG + Exonic
1158936979 18:62373650-62373672 GAGCTGGAGAAGGAGGGGGATGG + Intronic
1158947491 18:62459576-62459598 GGGCTGGGGCGGGTGGAGAGAGG + Intergenic
1159130181 18:64272310-64272332 GGGCTGGAACAAGAGAAGGACGG - Intergenic
1159677491 18:71303977-71303999 TGGCTGGAGCAGGAGGAAGAGGG - Intergenic
1159877366 18:73827543-73827565 GGGTGGGAGCAAGAGGAGGAGGG + Intergenic
1159950339 18:74478308-74478330 GGGCAGGAGCAGGTGGGGGCAGG - Intergenic
1160033163 18:75279561-75279583 GAGCTGGAGCAGGAGGACGGTGG + Intronic
1160358499 18:78248851-78248873 GGGAGTGAGCAGGTGAAGGAGGG + Intergenic
1160392597 18:78546646-78546668 GGGGTGGAGGATGTGGATGATGG - Intergenic
1160408960 18:78661689-78661711 TGGGTGGAGCAGGAAGAGGAGGG + Intergenic
1160751762 19:737766-737788 TGGCTGGAGCAGCGTGAGGAGGG + Intronic
1160827022 19:1085330-1085352 GGGAGGGAGCTGGTGGAGGATGG - Intronic
1160838628 19:1136485-1136507 GGGCCTGGGCAGGTGCAGGAGGG - Intronic
1160988422 19:1850863-1850885 TGGCTGGACCAGGGTGAGGAGGG + Intergenic
1161000649 19:1909182-1909204 GGGCAGATGCAGGTGGGGGAAGG + Intronic
1161085237 19:2332139-2332161 GGGCTGGGGCAGCTGTGGGAAGG + Intronic
1161107532 19:2452047-2452069 GGGCGGGGGCAGGTGCAGGGAGG - Intronic
1161163175 19:2771889-2771911 CGGAAGGAGCAGGTGGAGAAGGG - Intronic
1161168860 19:2803104-2803126 GGGCTGGGGCAGGGAGAGCATGG - Intronic
1161226158 19:3146918-3146940 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161243053 19:3233655-3233677 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161248919 19:3270334-3270356 GAGCCAGAGAAGGTGGAGGAGGG + Intronic
1161253090 19:3291727-3291749 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161257915 19:3320138-3320160 TGGCTGGAGCAGAGTGAGGAGGG + Intergenic
1161265580 19:3362111-3362133 GAGCTGGTGCAGGAGGAGCAGGG + Intronic
1161301605 19:3545398-3545420 TGGCTGGAGTAGAGGGAGGAGGG - Intronic
1161345959 19:3768823-3768845 CGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161354482 19:3811237-3811259 GGGGTGGAGCAGGGGGAGAGGGG - Intronic
1161378390 19:3951508-3951530 GGCCTGGAGCAGGTGTTGGGAGG - Intergenic
1161389761 19:4014912-4014934 AGGATGGAGGAAGTGGAGGAGGG + Intronic
1161421792 19:4179927-4179949 GGGCTGCAGCAGGAGCAGGAGGG + Intronic
1161445989 19:4319442-4319464 AAGCTGGAGTTGGTGGAGGATGG + Intronic
1161477677 19:4495542-4495564 GGGCTGGAGTGGAGGGAGGAGGG + Intronic
1161477847 19:4496259-4496281 GCGCTGGAGCAGTGGGAAGAGGG - Intronic
1161477958 19:4496684-4496706 GGCATGGAGCGGGTGGAGGCTGG + Intronic
1161490376 19:4557922-4557944 GGGATGGAGCAGGTCGTGCAGGG - Intronic
1161515469 19:4693836-4693858 TGGCTGGAGCACAGGGAGGAGGG - Intronic
1161596647 19:5154164-5154186 TGGCTGGAGCAGAGGGAGGCAGG + Intergenic
1161606200 19:5216179-5216201 GGGCAGGAGCAGGTGCAAGAAGG + Intronic
1161619216 19:5289594-5289616 CGGCTGGAGCAGAGGGAGGAGGG - Intronic
1161623205 19:5310064-5310086 TGGCTGGAGCAGAGTGAGGAGGG - Intronic
1161625415 19:5323688-5323710 GGGATGGAGCAGGTTGTGCAAGG + Intronic
1161634217 19:5377170-5377192 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161642950 19:5435715-5435737 TGGCTGGAGCAGAGTGAGGAGGG - Intergenic
1161645165 19:5448812-5448834 GGGCGGGGGGAGGTGGAGGTGGG + Intergenic
1161649338 19:5474753-5474775 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161650380 19:5480599-5480621 GGGCTGGGGCAGGTCGTGCAGGG + Intergenic
1161663815 19:5563082-5563104 TGGCTGGAGCAGAGTGAGGAAGG + Intergenic
1161716770 19:5880629-5880651 GGGCTGGAGATGGAGGAGGCCGG + Intronic
1161719745 19:5896218-5896240 TGGCTGGAGCAGAGTGAGGAGGG + Intronic
1161809894 19:6465583-6465605 GAGCTGGAGCTGGTGGATGAAGG - Exonic
1161857106 19:6772396-6772418 GGGCTGGACCAGACAGAGGAGGG + Intergenic
1161931684 19:7344870-7344892 GGGCTGGACGGGGTGGTGGAGGG + Intergenic
1162009181 19:7801360-7801382 GGGCTGCAGCTGGTGGGGGCCGG + Intergenic
1162070532 19:8149613-8149635 GGGCGGGAGGAGTTGGAGGAGGG + Exonic
1162304437 19:9863223-9863245 TGGCTGGAGCAGATTGAGTAAGG + Intronic
1162372425 19:10287448-10287470 GGGCTGGAAGAGGTGGGGGAAGG + Intronic
1162452378 19:10762883-10762905 GGGTGGGGGCAGGTGGGGGATGG + Intronic
1162536579 19:11266023-11266045 AGGCTGGAGCTGGTGGACCAGGG + Intergenic
1162553714 19:11373503-11373525 AGGTTGGAGCATGTGGATGATGG + Intergenic
1162797596 19:13094961-13094983 GGGCGGGGTCAGGGGGAGGAAGG - Exonic
1162918138 19:13885166-13885188 GGGGAGGAGAAGGAGGAGGAGGG + Intronic
1162939210 19:13997915-13997937 GGGCAGGGGCTGGAGGAGGATGG - Intronic
1163125948 19:15244313-15244335 AGGCTGCGGCAGGTGCAGGATGG + Exonic
1163153333 19:15427531-15427553 AGGCTGCAGCAGGAGGAGAAAGG + Exonic
1163295730 19:16411287-16411309 GGGCTGGAGAAAGGGGAGAATGG + Intronic
1163377423 19:16942021-16942043 TGGCTGGAGCAGGAGGAGGAGGG - Intronic
1163410948 19:17154224-17154246 TGGCTGGAGCTGGTGGGGCAGGG - Intronic
1163417341 19:17194686-17194708 GGGCCGGAGCCAGCGGAGGATGG + Exonic
1163441472 19:17324378-17324400 GAGCTGGAGCAGGAGAAGGGTGG + Intronic
1163502793 19:17686645-17686667 GGGCTGGGGGTGGTGGAAGAAGG - Intronic
1163520329 19:17788083-17788105 GGGCTGGAGGAGGGGGTGGCAGG - Intronic
1163776111 19:19218890-19218912 GGGTTGGAGAAGGTGGAGAGAGG - Intronic
1163828535 19:19536961-19536983 AGGCTGGGTCAGATGGAGGAGGG + Intronic
1164292634 19:23881469-23881491 GGGGAGGAGAAGGGGGAGGAGGG + Intergenic
1164394285 19:27850337-27850359 GGGCTTGAGCAGGGGGTGCAGGG + Intergenic
1164521282 19:28982147-28982169 GGGAAGGAGGAGGTGAAGGAAGG + Intergenic
1164563960 19:29312613-29312635 GGTGTGGAGCAGGGGGAGGTGGG + Intergenic
1164574821 19:29399734-29399756 TCTCTGGGGCAGGTGGAGGATGG - Intergenic
1164609225 19:29621025-29621047 GGGCTGGAGCAGCAGGTGGTGGG - Intergenic
1164919615 19:32079058-32079080 GGGCTGGAGCTGGTGGCGGGGGG - Intergenic
1165042856 19:33081245-33081267 GGGCTGGAGCCTCTGGAAGAAGG + Exonic
1165135612 19:33666522-33666544 GGTCTGGGGCAGGTGGCCGATGG + Intronic
1165277356 19:34766400-34766422 GGGCTGGAGAAGGTGAAAAATGG + Intronic
1165313082 19:35040205-35040227 GGGCTGGAGCAGTTTGGGGCAGG + Intronic
1165388300 19:35524536-35524558 GGGAGGGAGCAGGTGGAGAGAGG + Intronic
1165431580 19:35776094-35776116 GGGATGGAGCGGGTGGGGGGTGG - Intronic
1165867811 19:38949783-38949805 GGGCTGGAGAAGGTGAAGCCGGG - Exonic
1165901103 19:39169768-39169790 GGGCTGGGGGAGGTGGTGGTGGG - Intronic
1165913265 19:39242788-39242810 GGGCTGGAGAGGGTGGAGGATGG + Intergenic
1165917854 19:39271952-39271974 GGGCTGGAGAGGGTGGAGGATGG - Intergenic
1165933931 19:39377721-39377743 GAGCTGGAGCTGGTGGAGGTGGG - Exonic
1166099015 19:40560080-40560102 GCGCTGGAGCAGATGGTGGGAGG + Intronic
1166248217 19:41546115-41546137 GGGCACAAGCAAGTGGAGGAGGG - Intergenic
1166546217 19:43636050-43636072 GGGCTGGATCTGATGGAGGAGGG - Intronic
1166764843 19:45246550-45246572 GGGCTGGAGCTGGTGCTGGGTGG + Intronic
1166959407 19:46488726-46488748 AGGCTGGAGCAGGAGGAGGCTGG - Intronic
1167019076 19:46861031-46861053 GAGGTGGAGGAGGCGGAGGAGGG + Intergenic
1167295058 19:48645080-48645102 AGGCTGGACAAGGTGGGGGACGG + Intronic
1167331793 19:48860610-48860632 GGGCGGAAGGAGGTGGAGGGGGG - Intronic
1167426316 19:49431518-49431540 GGGCTGGAGCAGGTCTGGAAGGG - Intronic
1167461366 19:49626145-49626167 GGGCTTGGGGAGGTGGAGGGGGG + Exonic
1167494203 19:49808537-49808559 GGGCAGGGGCAGGGGTAGGAGGG - Intronic
1167499262 19:49836254-49836276 TGGCTGGAGGTGGTGGAGGGAGG - Exonic
1167587566 19:50383655-50383677 GGGCTGGCACAGGGGCAGGAAGG - Intergenic
1167588308 19:50387646-50387668 GTGCTGAAGCTGGAGGAGGAAGG - Intronic
1167640266 19:50677897-50677919 TGGCTGAAGGAGGTGGGGGAGGG - Intronic
1167763064 19:51461637-51461659 GAGTTGGTGCAGGTGCAGGAGGG - Intergenic
1167775656 19:51553039-51553061 GGGGAGGAGAAGGAGGAGGAGGG + Intergenic
1167906882 19:52668540-52668562 CAGCTGTAGGAGGTGGAGGAGGG - Intronic
1167970098 19:53183843-53183865 TGGCTGGAGCAGAGGGAGCAAGG + Intronic
1167988842 19:53340804-53340826 TGGCTGGAGCAGAGGGAGGGAGG - Intronic
1168077195 19:53987514-53987536 GGGATGGAGGAAGTGGAAGAAGG + Exonic
1168200164 19:54809192-54809214 GGGCTTGAGAAGGGGAAGGAAGG + Intronic
1168231964 19:55038337-55038359 AGGCCGGGGCTGGTGGAGGAAGG - Intergenic
1168240394 19:55086281-55086303 GTGCTGGAGCAGGTGGTGACTGG + Intronic
1168304702 19:55429214-55429236 GGGCTAGAGCTAGTGGAGGGGGG + Exonic
1168418216 19:56183001-56183023 AGGGTGGAGCAGGGGGAGGAGGG - Intronic
1168650130 19:58087287-58087309 GGGCACGAGCAGGTGGGTGAGGG - Intronic
1168651967 19:58097589-58097611 GGGCTGGAGCAGGGAAGGGATGG - Intronic
1168675499 19:58275058-58275080 GGGGTGGGGCAGGGGGAGGGTGG + Intronic
1202710809 1_KI270714v1_random:18518-18540 GTGCTGGAGGAGGTGGAGGCCGG - Intergenic
924972180 2:138498-138520 GGACTGGAGAGGGTGGGGGATGG + Intergenic
924999311 2:392426-392448 GGGCTGTGGCTGGTGGAGGTGGG + Intergenic
925032276 2:660187-660209 GGGAGGGAGCAGGTGGAGCAGGG + Intergenic
925139475 2:1540057-1540079 GAGCTGGGGCCGGTGCAGGAAGG - Intronic
925370794 2:3343963-3343985 GCGCTGAGGCAGGAGGAGGATGG + Intronic
925880111 2:8345373-8345395 AGGCTGGGTCAGGGGGAGGAAGG + Intergenic
925894819 2:8463104-8463126 AGGCTGGAGGAGGAGGAAGATGG + Intergenic
925903552 2:8525525-8525547 TGGCGGGATCAGGTGGTGGAAGG + Intergenic
925909932 2:8567178-8567200 AGGTGGGGGCAGGTGGAGGAAGG - Intergenic
925984526 2:9205940-9205962 GGGGTGCAGGAGGAGGAGGAGGG - Intergenic
926099427 2:10104822-10104844 TGGCTGGAGCAGGCAGAAGAGGG + Intergenic
926126868 2:10277426-10277448 GTGGTGGACCAGATGGAGGACGG + Intergenic
926160695 2:10487480-10487502 GGGCTGCCTCAGGTGGAGGTAGG - Intergenic
926208271 2:10849401-10849423 AGGCTGGAGCAGGAGGAAGAGGG + Intronic
926231583 2:11008234-11008256 GAGCTGCAGCAGAAGGAGGAAGG - Intergenic
926764812 2:16314916-16314938 CAGCTGGAGCAGGTGGACGGGGG + Intergenic
926890352 2:17634110-17634132 GTGGGGGAGAAGGTGGAGGAGGG + Intronic
926964760 2:18397657-18397679 TGGCTGGAGAAGGAGGAAGAGGG - Intergenic
927014896 2:18949560-18949582 TGGCTGGAGCAGGAGGAAGGTGG - Intergenic
927054893 2:19358668-19358690 GGGGTGGGGGTGGTGGAGGAGGG - Intergenic
927131949 2:20067835-20067857 TGGCTGGAGCAGGAGGAAGCAGG - Intergenic
927177667 2:20421954-20421976 GGGATGGTGGAGGGGGAGGATGG - Intergenic
927186342 2:20485201-20485223 GAGATGGAGCATGGGGAGGAGGG + Intergenic
927513271 2:23657853-23657875 TGGCAGGAGCAGGAGCAGGAAGG + Intronic
927612661 2:24557491-24557513 GAGGAGGAGCAGGAGGAGGAGGG - Intronic
927858254 2:26540739-26540761 GGGCGGGGGCAGGTGGGGAAGGG + Intronic
927885096 2:26713359-26713381 GGGCGGGATCAGGTGGTGGATGG + Intronic
927907900 2:26875194-26875216 GGACTGGAGTGGGTGGAGGGTGG + Intronic
927939136 2:27092825-27092847 GGCCTGGACCTGGGGGAGGATGG - Intronic
928163879 2:28955293-28955315 GGCATGGAGCAGATGGAGAAAGG - Intergenic
928169718 2:28995416-28995438 GGGCTGGAGCAGGGGCCAGATGG + Intronic
928198797 2:29233589-29233611 GGGCAGGAGGCGGAGGAGGAGGG - Exonic
928199989 2:29241658-29241680 TGGCTGCAGCAGGTGGATGGAGG + Intronic
928266138 2:29813423-29813445 TGGATGGAGGAGGAGGAGGAGGG + Intronic
928858457 2:35827939-35827961 GGGGTGGGGGAGGTGGGGGAGGG + Intergenic
928925939 2:36579557-36579579 TGGCTGGAGCAGGAGGAAGGGGG - Intronic
928954996 2:36856873-36856895 TGGCCGGAGCAGGAGGAAGAAGG - Intronic
929120224 2:38478061-38478083 GAGATGGAGGGGGTGGAGGAGGG - Intergenic
929428877 2:41870247-41870269 GGGTTGGCGCAGGCAGAGGAAGG + Intergenic
929456541 2:42070067-42070089 GGGATGGAGATGGTGTAGGATGG - Intergenic
929584633 2:43106030-43106052 GAGCTAGAGGAGGAGGAGGAGGG - Intergenic
929598983 2:43193273-43193295 GGGCTGGGGCTGGAAGAGGAGGG + Intergenic
929778265 2:44941960-44941982 AGGGGGGAGCAGGAGGAGGAGGG - Exonic
930364689 2:50424310-50424332 GGGGAGGAGGAGGAGGAGGAGGG + Intronic
930678838 2:54233652-54233674 GGTGTGGAGCAGGGGTAGGAGGG - Intronic
930990612 2:57649975-57649997 TGGCTGGAGCAGGAGGAAGGTGG - Intergenic
931170068 2:59793692-59793714 AGGCAGGAGGATGTGGAGGAAGG + Intergenic
931356118 2:61538562-61538584 GGGGTGGAGGAGGAGGAGGTGGG + Intronic
931664486 2:64600409-64600431 GGGCTGGAGGTGGTGCAGGGAGG + Intergenic
932261429 2:70330844-70330866 GGGCTGGAGCAGATGAAACAGGG + Intergenic
932336169 2:70932652-70932674 GGGTTGGGGCAGGTGGTGGATGG - Intronic
932762106 2:74444778-74444800 GGGAGGGAGAAGGTGGGGGAGGG + Intergenic
932911658 2:75812529-75812551 GGGATGGTGCGGGTTGAGGAGGG - Intergenic
932995211 2:76843704-76843726 GAGTTGGAGAAGGTTGAGGATGG + Intronic
933766158 2:85711066-85711088 GGGCTGCGGCAGGAGGAGGCAGG + Intergenic
933982947 2:87568464-87568486 GGGCAGGAGGAAGAGGAGGAAGG - Intergenic
934475007 2:94587837-94587859 GGGCTGGAGCTGGGGCTGGAGGG + Intergenic
934652317 2:96099737-96099759 GAGAAGGAGGAGGTGGAGGAAGG + Intergenic
934772879 2:96919270-96919292 TGGCTGGACGAGGTGGATGAGGG + Intronic
934939288 2:98488822-98488844 GGGCTGGAGGGGGTGGAGTAGGG + Intronic
935606188 2:104974312-104974334 GAGCTGGAGCAGGTGGAGACCGG - Intergenic
935738252 2:106123938-106123960 GGGCCTGAGCAGGTGCAGGGAGG + Intronic
935761292 2:106322959-106322981 GGGGAGGGGCAGGAGGAGGAGGG + Intergenic
935976036 2:108579976-108579998 GGGCTGGAGCTGGGGGATGCCGG + Intronic
936031874 2:109079152-109079174 GGGGAGGAGGAGGAGGAGGAGGG - Intergenic
936086140 2:109470671-109470693 TGGCCGGGGCTGGTGGAGGATGG + Intronic
936310894 2:111382331-111382353 GGGCAGGAGGAAGAGGAGGAAGG + Intergenic
936495572 2:113017775-113017797 GAGCTGGAGGAGGAGGAGGAGGG + Intergenic
936508419 2:113126656-113126678 GGGAGGAAGCAGGTGTAGGAAGG - Intronic
936528520 2:113258816-113258838 GGGCTGGGGGAGGCGGAGAAAGG - Intronic
936674581 2:114700249-114700271 GGGCAGGAGAAGGTGGAGGGTGG - Intronic
936948360 2:117951874-117951896 GGGCTGCAGGAGGAGAAGGAGGG - Intronic
937122351 2:119449636-119449658 TGGCTGGAGCAGGTGTGTGAGGG - Intronic
937214916 2:120306389-120306411 AGGTGGCAGCAGGTGGAGGACGG - Intergenic
937246390 2:120496807-120496829 GGGCTGAAGCAGAAGGAGAAGGG - Intergenic
937535060 2:122876103-122876125 GGGATGGAGAAGATAGAGGAGGG - Intergenic
938075044 2:128327474-128327496 GGGCTAGAGATGGCGGAGGATGG - Intergenic
938288192 2:130135958-130135980 GGGCTGGAGCAGGATGGGCATGG - Intergenic
938427392 2:131202938-131202960 GGGCTGGAGCAGGATGGGCACGG + Intronic
938468338 2:131536986-131537008 GGGCTGGAGCAGGATGGGCACGG + Intergenic
938502057 2:131835522-131835544 TGGCTGGAGCAGATGAGGGAAGG - Intergenic
938736638 2:134191840-134191862 TGGCGCGAGCAGGAGGAGGAGGG - Intronic
939175625 2:138744620-138744642 GGCTTGGAGCACCTGGAGGAGGG - Intronic
939475884 2:142686124-142686146 TGGCTGGAGCAGGCGGAAGAGGG - Intergenic
940344952 2:152619555-152619577 GGGGAGGAGGAGGTGGAGGAGGG - Exonic
940637536 2:156317815-156317837 GGGCAGAAGCAGGTGGCAGACGG - Intergenic
940830090 2:158457075-158457097 GGGCGGGGGCCGGTGGGGGAGGG + Intronic
941016521 2:160363573-160363595 GGGCTGGAGAAGAAGGAAGAAGG + Intronic
941639278 2:167969961-167969983 TGGCTGGAGCAGGAGCAGCAAGG - Intronic
942314978 2:174689822-174689844 GGCCTGGAACAGGTGGAGAATGG + Intergenic
942646306 2:178113998-178114020 GGGTTGGAGAAGTGGGAGGAAGG - Intronic
942852279 2:180502680-180502702 TGGCTGTAGCAGGGGGTGGAAGG + Intergenic
943130007 2:183842411-183842433 GGGATGGAGCAACTGGGGGAAGG + Intergenic
943379849 2:187131281-187131303 GGGCTGGAGGTGGGGGAAGACGG + Intergenic
944191637 2:197010044-197010066 AGGATGGAGGAGGAGGAGGAAGG + Intronic
944226587 2:197354835-197354857 GAGCTGGACCAAGTGGAAGATGG - Intergenic
945219474 2:207469112-207469134 TGGCTAGAGCAGGTGGATGAGGG - Intergenic
945735833 2:213599393-213599415 GGGCTGGCAGAGGTGGAAGAAGG - Intronic
946015886 2:216603362-216603384 GGGGAGGAGGAGGTGGAGGAGGG + Intergenic
946040724 2:216781107-216781129 GGGAAGGAGAAGGTGGGGGAAGG - Intergenic
946179745 2:217942294-217942316 GGGCTGGACCAGGCTGGGGAGGG - Intronic
946238847 2:218341778-218341800 TGGCTGGATCAGTTGGGGGATGG - Intronic
946250509 2:218408504-218408526 GGAGTGGAGGAGTTGGAGGAAGG + Intergenic
947099140 2:226600505-226600527 AGGATGGAGGAGGTGGAAGAGGG + Intergenic
947136948 2:226984926-226984948 GGGGTGGGGGAGGGGGAGGAGGG + Intronic
947591595 2:231388964-231388986 GTGGTGGGACAGGTGGAGGAGGG + Intergenic
947593425 2:231397106-231397128 AGACTGGAGAAGGGGGAGGAGGG + Intronic
947739809 2:232479971-232479993 GGCCTGGAGCAGGGTGAGGCTGG - Exonic
948342549 2:237266435-237266457 GGGGAGGAGGAGATGGAGGAGGG - Intergenic
948424893 2:237880983-237881005 GGGCAGGGGCAGGAGGAGGAGGG - Intronic
948458847 2:238119537-238119559 TGGATGGAGGAGGTGGATGAAGG + Intronic
948463822 2:238142856-238142878 GCGCTGGAGGAGGAGGAGGCAGG + Exonic
948537066 2:238654331-238654353 GGGCTGGTGGAGGTGGAAGAAGG - Intergenic
948538421 2:238666136-238666158 TGCCAGGAGCAGGTGGAAGAAGG - Intergenic
948654186 2:239466494-239466516 GGCCTGGAGCGGGAGGAGGCTGG + Intergenic
948657430 2:239485275-239485297 GGGCCTGAGTAGGTGGAGGATGG + Intergenic
948770281 2:240248250-240248272 GGGAAGGAGCAGGGGGTGGATGG - Intergenic
948782338 2:240329510-240329532 GGGCCGCAGAGGGTGGAGGAGGG + Intergenic
948787094 2:240358432-240358454 GGGCTGGAGCCTGGTGAGGAGGG - Intergenic
948862087 2:240757499-240757521 GGGCTCGAGAAGGTGGGGGAGGG + Exonic
948916415 2:241036861-241036883 AGGCAGGAGCAGGTGTAGGAGGG - Exonic
948944429 2:241212297-241212319 GTGCTCAGGCAGGTGGAGGACGG + Intronic
948947207 2:241226872-241226894 CGGCTGGAGGAGGAGGAGGGAGG - Intergenic
1168772065 20:421702-421724 TGGCTGGAGCAGAGGGATGAAGG + Intronic
1168821012 20:773934-773956 GGGCAGGAGAATGTGGAGGGGGG - Intergenic
1169029502 20:2396656-2396678 GGGCTGGGGCATGGGGAGGTCGG + Intronic
1169214413 20:3785177-3785199 GGGGAGGAGGAGGAGGAGGAAGG - Exonic
1169331191 20:4717644-4717666 GGGGTGGAGTATGGGGAGGATGG - Intergenic
1169346901 20:4835899-4835921 GGGCTGGGCCAGGGGCAGGAAGG - Intergenic
1169386681 20:5155939-5155961 TGGCTGGAGCAGGTGGTGTGAGG + Intronic
1170109842 20:12793206-12793228 GGGCTGGAGCAGGAGGAAGAGGG + Intergenic
1170110325 20:12797939-12797961 TGGCTGGAGCAGCTTGAGGAAGG - Intergenic
1170941980 20:20855650-20855672 TGGCTGGAGCAGGAGGAAGAAGG + Intergenic
1170973848 20:21141915-21141937 TGGCAGGAGAAGGTGGAGGGGGG - Intronic
1171327266 20:24305569-24305591 GGGTTGAAGGAGGAGGAGGAAGG + Intergenic
1171364770 20:24616392-24616414 GGGAGGATGCAGGTGGAGGAGGG - Intronic
1171493350 20:25537699-25537721 GGGCTGCTGCAGGTGGAGGGTGG + Intronic
1171868152 20:30505616-30505638 AGGGGGGAGCAGGGGGAGGAAGG - Intergenic
1172029052 20:31968723-31968745 GAGCTGCAGGAGGTGGACGAGGG - Exonic
1172240828 20:33411486-33411508 TGGCTGGGGGAGGTGGAGGTGGG - Intronic
1172775208 20:37403188-37403210 GTGCTGGACCAGGTGGAGCGGGG + Exonic
1172942514 20:38664137-38664159 GGGCTCCAGCAGGTGCAGGCAGG + Intergenic
1173106975 20:40146103-40146125 GAGCAGGAGGAGGAGGAGGAGGG - Intergenic
1173140481 20:40477477-40477499 GGGGTGGAGAAGGTGGGGCAGGG - Intergenic
1173358351 20:42316686-42316708 GGTCTGGAGTAGCTGGAAGATGG - Intronic
1173390094 20:42623959-42623981 GGGCTGGGGCAGGTGTGGCAGGG - Intronic
1173664259 20:44753777-44753799 GGGGTGGAGCAGCTGGGGGCTGG - Intronic
1173762915 20:45579510-45579532 GAGCTGGAACAGGTCAAGGAGGG - Intergenic
1173789138 20:45816285-45816307 AGGTCGGAGGAGGTGGAGGAGGG - Intronic
1173799127 20:45883800-45883822 GGGCTGGAGCACCTGGCGGCGGG - Exonic
1173834221 20:46114541-46114563 GGGCTGGAGCATGAAGGGGAAGG + Intergenic
1173913584 20:46689290-46689312 GGCCTGGAGCTGGTGAAGCAGGG - Exonic
1173980152 20:47217855-47217877 GGGGGCGAGCAGGGGGAGGAAGG - Intronic
1174046345 20:47736672-47736694 GGACGGGGGCAGGTGCAGGAAGG - Intronic
1174119621 20:48253131-48253153 TGGCTGGAGCAGGAGGAAGCGGG + Intergenic
1174230374 20:49041164-49041186 AGGAGGGAGCAGCTGGAGGAGGG + Intergenic
1174329202 20:49804433-49804455 TGGCTGGGGCAGGTGGGAGACGG + Intergenic
1174485682 20:50859724-50859746 GGCCTGGCGCAGGTTGAGGGGGG + Intronic
1174486007 20:50861685-50861707 GGGCTGGAGCGGGGGGAGATGGG - Intronic
1174578286 20:51553175-51553197 GGGCTGGGGCAAACGGAGGAGGG - Intronic
1174873363 20:54204061-54204083 GGGGTGGAGCAGGTGGCCAATGG - Intergenic
1175124559 20:56741608-56741630 GGGTGGTAGCAGGTGGGGGAGGG - Intergenic
1175220740 20:57415079-57415101 TGGCTGAGGAAGGTGGAGGATGG - Intergenic
1175348740 20:58302604-58302626 GAGTTGGGGCAGGCGGAGGAAGG - Intergenic
1175429363 20:58891213-58891235 GGGCGGGAGCCGGCGGAGGGAGG - Intronic
1175479569 20:59301595-59301617 GGGCAGGAGCAGGCGGCCGAGGG + Exonic
1175715960 20:61253977-61253999 AGGCAGGAGGAGGTGGTGGAGGG - Intronic
1175743238 20:61435497-61435519 CGGCCGGAGGAGGTGGAGGATGG + Intronic
1175819535 20:61901204-61901226 GAGCAGGAGCAGGAGGAGTAGGG + Intronic
1175851813 20:62097766-62097788 GGGCAGGTGCAGGTGGGAGAGGG + Intergenic
1175871128 20:62210046-62210068 GGGCTGGAGCAGGGAGGGGCAGG - Intergenic
1176031702 20:63016031-63016053 GGGCGGGGGGAGGTGGAGGCAGG - Intergenic
1176115098 20:63428731-63428753 AGCCTGGAGCAGGTGGAGGAGGG + Intronic
1176162187 20:63653532-63653554 GGGAAGGAGCGGGGGGAGGAGGG + Intergenic
1176270333 20:64232942-64232964 GCTCTGGAGCAGGTGTTGGAGGG - Intronic
1176414643 21:6467637-6467659 GGGCTGGGTGGGGTGGAGGAGGG - Intergenic
1177019033 21:15829293-15829315 GGGTGGGAGCAGGGTGAGGATGG - Intronic
1177479639 21:21669728-21669750 TGGCTGGAGCAGCTGGGGCACGG + Intergenic
1177499448 21:21933474-21933496 TGGCTGGAGAAGGAGGAAGAGGG - Intergenic
1177855934 21:26400064-26400086 CGGCTGGAGCAGGAGGAAGCAGG - Intergenic
1177970591 21:27784721-27784743 GAGCTGGAGCAGGAGGAAGAGGG + Intergenic
1178038912 21:28617283-28617305 GGGCTGGAGTAGAGGGAGGCAGG + Intergenic
1178234269 21:30823238-30823260 TGGCTTGAGCAGGAGGAAGAGGG - Intergenic
1178638777 21:34329305-34329327 TGGCTGGCGCAGGAGGAAGAGGG + Intergenic
1178702644 21:34846333-34846355 GGGCAGGAGAAGGGGGAAGAAGG - Intronic
1178806704 21:35845472-35845494 GGGTTGGAGTAGGGGGAGGTGGG - Intronic
1178856245 21:36252909-36252931 GGGATGGAGCAGGGGTGGGAGGG - Intronic
1178982143 21:37273567-37273589 GGGGTGGAGAAGGAGGAGGGGGG + Intergenic
1179031935 21:37728291-37728313 GGGCTGGAGCAGGGGGATTGGGG + Intronic
1179081832 21:38178623-38178645 GGGGAGGAGGAGGGGGAGGAGGG + Intronic
1179303733 21:40136032-40136054 GGGAGGGAGCAGGGCGAGGATGG + Intronic
1179358625 21:40684510-40684532 GGGCTGGAGCAGGTGGAGGAAGG - Intronic
1179502366 21:41818170-41818192 GGGGAGGAGCAGGTGGTGAAAGG + Intronic
1179690143 21:43075959-43075981 GGGCTGGGTGGGGTGGAGGAGGG - Intronic
1179902076 21:44399578-44399600 AGCCTGGAGCAGGTGGCCGAGGG - Intronic
1179931281 21:44572540-44572562 GGCCTGGGGCAGGTGGAGCATGG - Intronic
1180063652 21:45402265-45402287 TGGCAGGTGCAGGTGGAGGCAGG + Intergenic
1180129261 21:45816473-45816495 GGGGAGGAGGAGGGGGAGGAGGG - Intronic
1180159107 21:45991162-45991184 GGGGAGGAGCTGGTGGAGGCTGG + Intronic
1180611377 22:17100410-17100432 GGGCTTGGGCAGGTGGTGAACGG - Exonic
1180754064 22:18148054-18148076 GGACTGGAGCAGGTTGAGGAGGG - Intergenic
1180783420 22:18534375-18534397 GGGCTGGGGCAGGGCGAGAAGGG - Intergenic
1180885553 22:19240873-19240895 GGGCAGCAGCAGGAGGAGGTTGG + Intronic
1180919859 22:19516111-19516133 GGGATGGAGCAGGATGAGGCGGG + Intronic
1180975462 22:19845544-19845566 GGGCTGGGGCCTGTGGATGATGG - Intronic
1181041733 22:20195532-20195554 AGGCTGGGGCAGGGTGAGGACGG - Intergenic
1181126986 22:20708424-20708446 GGGCTGGGGCAGGGCGAGAAGGG - Intronic
1181162011 22:20965048-20965070 GGGCCGGAGCAGGTGGGGGGCGG - Intergenic
1181240320 22:21473727-21473749 GGGCTGGGGCAGGGCGAGAAGGG - Intergenic
1181455295 22:23056122-23056144 TGGCTGGAGCAGGTGAATGAAGG + Intergenic
1181554121 22:23657838-23657860 GAAATGGAGCAGGAGGAGGAGGG - Intergenic
1181695707 22:24591915-24591937 GAGTTGGAGGAGGTGGAGAAGGG + Intronic
1182063590 22:27415270-27415292 GGACTGGAGCAGGCTGGGGATGG + Intergenic
1182294356 22:29304521-29304543 GGGCTGCTGGAGGTGGAGGAGGG - Intergenic
1182311259 22:29409475-29409497 GGGCTGGAGTGTGTGGAGGTGGG - Intronic
1182618352 22:31603798-31603820 GGCCTGGAGCCAGTGGAGGGAGG + Exonic
1182689715 22:32150556-32150578 GGGCTGGATCATGTGCAGGTGGG + Intronic
1182689834 22:32151630-32151652 GGGCTGGAGTGTGTGGAGGTGGG + Intronic
1182689960 22:32152705-32152727 GGGCTGGAGTATGTGGAGGTGGG + Intronic
1183252581 22:36740765-36740787 GGACTTGAGCAGGTAGAAGAAGG + Intergenic
1183255965 22:36762403-36762425 GGGCTGCAGCAAGGTGAGGATGG + Intronic
1183317377 22:37144119-37144141 GGGCAGGAGGAGGATGAGGAGGG + Exonic
1183406035 22:37631107-37631129 GGGCTGGGGCAGGTGCAGGCTGG + Intronic
1183452944 22:37906538-37906560 GGGCCGGTGCCGGTGCAGGATGG - Exonic
1183622990 22:38985733-38985755 GGGGTGGGGCAGGGAGAGGAGGG - Intronic
1183629538 22:39024992-39025014 GGGGTGGGGCAGGGGGAGGAGGG - Intronic
1183632995 22:39044862-39044884 GGGGTGGGGCAGGGAGAGGAGGG - Intronic
1183638753 22:39080855-39080877 GGGGTGGGGCAGGGGGAGGAGGG - Intronic
1183769431 22:39911374-39911396 GGGCTGGGGGAGGTGATGGAGGG - Intronic
1183839755 22:40489199-40489221 GGGCTGAAGCAGGTGTTCGAGGG - Intronic
1183922602 22:41181430-41181452 GAGCTGAAGCAGGTGGATGCTGG - Intergenic
1183951674 22:41356174-41356196 GGCATGGGGCAGGTGGAGAAGGG - Intronic
1184067572 22:42129235-42129257 GGGTTGGAGTGGGTGGTGGATGG - Intronic
1184070305 22:42142930-42142952 GGGTTGGAGTGGGTGGCGGAGGG - Intergenic
1184156542 22:42671227-42671249 GGGTGGGAGCAGGGTGAGGATGG + Intergenic
1184191078 22:42894935-42894957 GGGCTGCAGCACCTGGAGGAAGG + Intronic
1184479267 22:44737508-44737530 GGGCTGGGGCAGGAGGAGCGTGG - Exonic
1184484334 22:44766914-44766936 GGGCTGCCGCAGGTGGAGTGAGG + Intronic
1184585020 22:45442093-45442115 GGGCTGGATGAGGTGGTGGGTGG - Intergenic
1184593312 22:45500042-45500064 GGGATGGAGCAGGTGGCCGCTGG - Intergenic
1184669877 22:46007012-46007034 GGGCTCTGGGAGGTGGAGGAGGG - Intergenic
1184825777 22:46949904-46949926 GGGCTGGAGCAGCCTGAGCAGGG + Intronic
1184859718 22:47166253-47166275 GGCCTGGAGCAGGCAGAGGAGGG + Intronic
1185075061 22:48678537-48678559 GAGCTGGAGCAGGAAGAGGTCGG + Intronic
1185089424 22:48757394-48757416 GGGAAGGAGGAGGAGGAGGAAGG + Intronic
1185089436 22:48757433-48757455 GGGAAGGAGGAGGAGGAGGAGGG + Intronic
1185118017 22:48949103-48949125 AGGCTGGAGTAGGGGGAGGCTGG - Intergenic
1185217845 22:49613304-49613326 GAGGTGGAGCAGGTGGAGGTGGG - Intronic
1185224214 22:49643878-49643900 GGGCTGCAGCAGGTGGAAATAGG - Intronic
1185394819 22:50581585-50581607 GGGCTGGGGCAGGAGTGGGAAGG + Intronic
949120065 3:374052-374074 GGGCTGGGGGAGGCGGAGGCAGG - Intronic
949128285 3:471916-471938 TGGCTGGAGCAGGAGCAAGAAGG - Intergenic
949960944 3:9311794-9311816 GGGTTGGAGGAGGTGGGGGTAGG + Intronic
950351421 3:12357359-12357381 GAGCTGGGGCAGGTGCACGAAGG - Intronic
950483633 3:13260096-13260118 GGGCTGGAGGAAGAGGGGGAAGG + Intergenic
950520492 3:13495113-13495135 TGGAAGGAGCAGGTGGAGGGAGG - Intronic
950723330 3:14900014-14900036 GGGCTGGAGGATGTGGAGCCTGG + Intronic
951271198 3:20626558-20626580 TGGCTGGAGCAGGAGGAAGAGGG + Intergenic
952254600 3:31684497-31684519 GGGCTGGGGCAGGGGAAGGGAGG + Intronic
952460618 3:33521880-33521902 GGGCTGGGGCTGGTGGAGGGGGG - Intronic
952844149 3:37672675-37672697 GGGCTAGAGCAGGTGGTTTAGGG + Intronic
952951917 3:38532562-38532584 GGGCTGGAGGAGGGAGAGGATGG - Intronic
952974604 3:38683025-38683047 GTGCTGGAGCCAGGGGAGGAGGG + Intergenic
953230622 3:41062004-41062026 GGGCGGGAGGAGGGAGAGGATGG - Intergenic
953510863 3:43537540-43537562 TGGATGGAGCAGGAGGTGGAAGG - Intronic
953548837 3:43884843-43884865 GGGCTGAGGCAGCGGGAGGAGGG + Intergenic
953605628 3:44411441-44411463 TGGCTGGAGCAGAGGGAGAATGG - Intergenic
953707890 3:45244990-45245012 GGGCTGGAGCAGGTCCAGGTGGG + Intergenic
954005625 3:47588232-47588254 GGCCAGGAGCAGGAGGCGGAGGG + Exonic
954146660 3:48637769-48637791 GGGGTGGAATAGGGGGAGGAAGG + Exonic
954163493 3:48738695-48738717 GGGCAGGAGCTAGAGGAGGATGG + Intronic
954613193 3:51956840-51956862 GGTCTGGAACAGGAGGAGAAAGG + Exonic
954622547 3:52004279-52004301 GGGCTGGAGAGGGTGAAGGTTGG + Intergenic
954701372 3:52452593-52452615 AGGCTGGAGCTGGAGGAGGCAGG + Intronic
954838443 3:53491787-53491809 GGGCTAGAGGAGGAGGAGGCTGG - Intergenic
954965430 3:54606355-54606377 GGGCTGGGGAAGGTAGAGGTAGG + Intronic
954992929 3:54856463-54856485 GGACAGGAGCAGGTGGGGGAGGG - Intronic
955008615 3:54992948-54992970 TGGCTGAAGCAGGAGGAAGAGGG + Intronic
955348901 3:58179977-58179999 GGGCAGGGAGAGGTGGAGGAGGG - Intergenic
955376788 3:58403737-58403759 GGGCTGGAGGATGTGGTGCAGGG + Intronic
955447855 3:59032731-59032753 GGGATGGAGCACCTGGGGGAAGG + Intronic
955555524 3:60133175-60133197 GGGCTGGTGCTGATGAAGGAGGG + Intronic
955753240 3:62203569-62203591 GAGCGGGAGCACGAGGAGGATGG + Exonic
955885709 3:63596293-63596315 GGGAAGGAGAAGGGGGAGGAGGG - Intronic
956103396 3:65791597-65791619 AGGCAGGAAGAGGTGGAGGATGG + Intronic
956111971 3:65878932-65878954 GGGCTGAATGATGTGGAGGAAGG - Intronic
956152879 3:66261587-66261609 GGGCTGGAGTTGGTGAAGGGTGG + Intronic
956225868 3:66957481-66957503 GGGCTGGAGCAGGAGGGAGTAGG - Intergenic
956244895 3:67171916-67171938 GGGCTGAAGCAGCTGGGGGCTGG + Intergenic
956592266 3:70927280-70927302 GGGTTGGAGTAGGAGGAGAAGGG - Intergenic
956619456 3:71206449-71206471 GGGCTGGAGAAGGTAGACAATGG + Intronic
956713648 3:72059776-72059798 GGCCTGCAGCAGGAGGAGCAGGG - Intergenic
957083105 3:75655567-75655589 GGGCTGGGGGAGGGGGAGGAGGG + Intergenic
957553079 3:81731718-81731740 TGGTTGGAGCAGGAGGAAGAGGG - Intronic
958154604 3:89740372-89740394 GGGGGGGAGGAGGAGGAGGAGGG + Intergenic
958506134 3:94979316-94979338 ATGGTGGAGCAGGTGGAAGAGGG - Intergenic
958929154 3:100190691-100190713 GGGAAGGAGCAGGAGGAGGTTGG + Intronic
959369285 3:105503756-105503778 GGGCTGTAGGAGGTGATGGAAGG - Intronic
959849610 3:111071581-111071603 GGGGAGGAGCATGTGTAGGAGGG + Intronic
960272352 3:115688973-115688995 GGGCTGGAGAATGGGGAAGAAGG - Intronic
960312401 3:116132420-116132442 GGGGTGGAGCAGTGGGAGGAAGG - Intronic
960542963 3:118881253-118881275 GGGCTGGAGCAGGTGGCTGGGGG - Intergenic
960725120 3:120662352-120662374 GGTCTGAACCAGGTGGAGGTAGG + Intronic
960914596 3:122682652-122682674 GGGCTGGGGCCGGTCAAGGATGG - Intronic
960951975 3:123005189-123005211 GGGTGGGGACAGGTGGAGGAAGG - Intronic
960965987 3:123105078-123105100 GAGGTGGAGAAGGGGGAGGAGGG + Intronic
961006693 3:123410315-123410337 GGGTTGGGGGAGGAGGAGGAGGG - Intronic
961039147 3:123664477-123664499 GGTGTGGAGCAGGGGCAGGATGG + Intronic
961167108 3:124770899-124770921 AGGCTGGTGCAGGGGGAGGGTGG - Intronic
961734471 3:128992933-128992955 GGGGTGGGGCAGGTGGAGAGAGG + Intronic
961754817 3:129121559-129121581 GGGCTGGAGCGGGCGGAGCTCGG - Exonic
961756349 3:129129282-129129304 CGAGTGGAGCAGGTGGAGGGGGG + Intronic
961816458 3:129553249-129553271 GTGGTGGAGCAGGGGCAGGAAGG - Intergenic
962268806 3:133963091-133963113 GGGCTGGGGGAGCTGGAGGAGGG - Intronic
962273953 3:133998397-133998419 GGGTGGGAGCAGGGGGAGGCAGG - Intronic
962435169 3:135359734-135359756 GGCCTGGAGGAGGTAGGGGAAGG - Intergenic
962444099 3:135449589-135449611 AGGATGGAGGAGGAGGAGGAGGG - Intergenic
962445254 3:135458042-135458064 GGGAGGGAGCAGGCGGAGAAGGG - Intergenic
962512389 3:136114815-136114837 GGGATAGAGCATGTGGGGGAAGG + Intronic
962581281 3:136800135-136800157 TGGCTGGAGTAGGAGCAGGACGG - Intergenic
962954650 3:140253231-140253253 GGGCAGGAGTAGGAGGAGGAAGG + Intronic
963121381 3:141779684-141779706 GGGCTGGAGGAGGAGAGGGATGG - Intronic
963235679 3:142953497-142953519 GCTCCGGAGCATGTGGAGGAGGG - Intronic
963247273 3:143074854-143074876 GGCTTGGAGCAGAGGGAGGATGG + Intergenic
963567458 3:146947100-146947122 GGGCTACAGAGGGTGGAGGATGG - Intergenic
963904508 3:150762818-150762840 GCGCTGGGGCCGGTGGAGGACGG + Exonic
963905605 3:150771289-150771311 GGGCTGGAGGAGGGAGAGGCTGG - Intergenic
964431082 3:156606366-156606388 CGGCTGGAAAAGGTGGAAGAAGG + Intergenic
965178737 3:165372316-165372338 AGACTGGAGGAGGAGGAGGATGG - Intergenic
965882158 3:173398447-173398469 GGGCAGGAGTCGGTGGAGAACGG - Exonic
966246052 3:177809021-177809043 GGGCGGGGGCGGGGGGAGGAGGG + Intergenic
966559211 3:181300141-181300163 GGGAAGGAGGAGGAGGAGGAGGG + Intergenic
966663502 3:182444022-182444044 GGGCGGGAGGAGGGTGAGGATGG + Intergenic
966887236 3:184383430-184383452 GGGCTGCAGAAGGTGGGGGAGGG + Intronic
966918182 3:184596213-184596235 GGGCTGAAGCAGGGACAGGAGGG - Intronic
967035736 3:185647220-185647242 GAGGTGGAGCAGGGGAAGGAGGG + Intronic
967052153 3:185794819-185794841 GGGCTAGAGAAGGGGGAGGATGG - Intronic
967066270 3:185919469-185919491 GAGGTGGAGGAGGAGGAGGATGG - Exonic
967765187 3:193271576-193271598 TGGTTGCAGCAGGTGGAGAAAGG + Intronic
967964919 3:194953506-194953528 GGGCTGGAGGAAGAGGAGGCAGG - Intergenic
968091013 3:195898196-195898218 CTGGTGGAGAAGGTGGAGGACGG - Intronic
968137114 3:196227630-196227652 GGGCAGGAGCAGGTGAGGGCGGG - Intronic
968348008 3:198027510-198027532 GGGCTGGGGGAGGAGGAAGAGGG - Intronic
968506024 4:971899-971921 GGGCTGCAGCAGGTGAAGGGCGG - Intronic
968579999 4:1385412-1385434 GGGCTGCAGCAGGGGGGGCACGG - Intronic
968607195 4:1541140-1541162 GGTCCGGAGCAGGTGGAAGGCGG - Intergenic
968648626 4:1751764-1751786 GGGATGGTGCGGGTGGAGGGAGG - Intergenic
968662222 4:1803402-1803424 GGGCGGGTGCAGGTGGAGGATGG - Intronic
968739500 4:2320138-2320160 GAGCTAGAGGAGGTGGGGGAGGG - Intronic
968889383 4:3359398-3359420 GGGGAGGAGAAGGGGGAGGAGGG - Intronic
969082129 4:4627081-4627103 GGGCTGGAGTTGGAGGAGAAAGG - Intergenic
969096440 4:4736117-4736139 GGGCTGGAGCTGCTGAGGGAGGG + Intergenic
969106698 4:4811856-4811878 GAGCTGGGGCAGGAGGAGGCTGG - Intergenic
969138747 4:5051484-5051506 GCGCGGGAGCAGGGGAAGGAGGG - Exonic
969297993 4:6280832-6280854 GGCCTGGGGTTGGTGGAGGAGGG + Intronic
969387622 4:6865786-6865808 GGGCTGGAGCAGGGGAGAGAGGG - Intronic
969442475 4:7225653-7225675 GGGCTGGAGCTGGTGCACGGGGG + Intronic
969454702 4:7294667-7294689 GGGGAGGAGGAGGAGGAGGAGGG - Intronic
969479768 4:7441669-7441691 GGGCTGGGGCAGGAGGTGGAGGG - Intronic
969479787 4:7441727-7441749 GGGCTGGGGGAGGGGGTGGAGGG - Intronic
969479800 4:7441756-7441778 GGGCTGGGGGAGGGGGTGGAGGG - Intronic
969479813 4:7441785-7441807 GGGCTGGGGGAGGGGGTGGAGGG - Intronic
969479826 4:7441814-7441836 GGGCTGGGGGAGGGGGTGGAGGG - Intronic
969479839 4:7441843-7441865 GGGCTGGGGGAGGGGGTGGAGGG - Intronic
969479852 4:7441872-7441894 GGGCTGGGGGAGGGGGTGGAGGG - Intronic
969479865 4:7441901-7441923 GGGCTGGGGGAGGGGGTGGAGGG - Intronic
969479878 4:7441930-7441952 GGGCTGGGGGAGGGGGTGGAGGG - Intronic
969479891 4:7441959-7441981 GGGCTGGGGGAGGGGGTGGAGGG - Intronic
969479912 4:7442017-7442039 GGGCTGGGGGAGGGGGTGGATGG - Intronic
969479936 4:7442075-7442097 GGGCTGAAGGAGGGGGTGGAGGG - Intronic
969479946 4:7442104-7442126 GGGCTGGGGGAGGGGGTGGAGGG - Intronic
969479959 4:7442133-7442155 GGGCTGGGGGAGGGGGTGGAGGG - Intronic
969479979 4:7442191-7442213 GGGCTGGGGGAGGGGGTGGATGG - Intronic
969479991 4:7442220-7442242 GGGCTGAAGGAGGGGGTGGAGGG - Intronic
969480001 4:7442249-7442271 GGGCTGGGGGAGGGGGTGGAGGG - Intronic
969480066 4:7442423-7442445 GGGCTGGGGGAGGGGGTGGAGGG - Intronic
969480091 4:7442481-7442503 GGGCTGGGGGAGGGGGTGGAGGG - Intronic
969480104 4:7442510-7442532 GGGCTGGGGGAGGGGGTGGAGGG - Intronic
969480135 4:7442597-7442619 GGGCTGGGGGAGGGGGTGGATGG - Intronic
969586461 4:8097005-8097027 GGGAGGGAGCAGGAGGAAGAAGG + Intronic
969657947 4:8508863-8508885 CGGCGGGAGGAGGAGGAGGAAGG - Intergenic
969673216 4:8601180-8601202 GTGCTGAAGCAGGTTGGGGAAGG - Exonic
969715629 4:8866918-8866940 GGGCTGGGCCAGGTGCAGGTGGG - Intronic
969781788 4:9409927-9409949 GGGCTGGTGCAGGTTCAGGGTGG - Intergenic
969966882 4:11005615-11005637 GGGCAAGAGCAGGTGCAGGTAGG - Intergenic
970204628 4:13643799-13643821 GGGCAGGAGGAGCAGGAGGAGGG - Intergenic
970231346 4:13914384-13914406 GGGCTGGTGCAGGGGCAGGCAGG - Intergenic
970337049 4:15058939-15058961 AGGATGGAGGTGGTGGAGGATGG - Intronic
970535703 4:17027891-17027913 TGGTTGGTGCAGGTGGAGCACGG + Intergenic
970689655 4:18607883-18607905 AGGCTGGAGAAGAGGGAGGACGG - Intergenic
971251486 4:24976366-24976388 GGGCTGGAGAAGGTGGAAATGGG + Intronic
971367563 4:25989727-25989749 GGGCTGGAGCAGCAATAGGAAGG + Intergenic
971418303 4:26453473-26453495 GGGCAGGAGCAGGGGCAGCAGGG + Intergenic
972387837 4:38585155-38585177 GGGCTGGAGCAGCTAGGTGAAGG - Intergenic
972418306 4:38863973-38863995 TGGCTGGAGCAGAGGGAGGATGG - Intergenic
972541575 4:40043701-40043723 CGGCAGGAGCAGGAGGAGGAGGG - Intergenic
972615477 4:40694156-40694178 GGGTTGGAGCAGCAGGAGGTGGG + Intergenic
974020359 4:56687569-56687591 GGGCAGGTGAATGTGGAGGAGGG + Intergenic
974370224 4:61007185-61007207 GGGCTGGAGCAGGAGGAACTGGG - Intergenic
974488529 4:62534408-62534430 GGGTTGGGGCAGTTGGTGGAAGG - Intergenic
974921122 4:68240454-68240476 TGGCTGGAGCAGGAGGTGCATGG - Intronic
974927327 4:68316376-68316398 GAGCTTGAGGAGGTGGAGCATGG + Exonic
975195033 4:71514329-71514351 TGGCTGCAGCAGGAGGAAGAGGG - Intronic
975488726 4:74965368-74965390 GGGCTAGAGCAGGTGGATTCCGG + Intronic
976692708 4:87885853-87885875 TGCGTGTAGCAGGTGGAGGAAGG + Intergenic
977183128 4:93902597-93902619 TGGCTGAAGCAGGAGGAAGAGGG - Intergenic
978405297 4:108372683-108372705 GGGCTGGAGAGGTTGGAGAAAGG - Intergenic
978760317 4:112350425-112350447 GGGATGGAGTAGGAGGAGGGAGG - Intronic
979193505 4:117892393-117892415 GGGATGGTGGTGGTGGAGGAGGG - Intergenic
980926315 4:139141654-139141676 GGGTTGTAGCTGCTGGAGGAAGG + Intronic
980995636 4:139777341-139777363 GATTTGGAGCAGGTAGAGGAGGG - Intronic
981018957 4:140005070-140005092 GTGCTGGTGAATGTGGAGGACGG + Intronic
981259930 4:142707574-142707596 TGGCTAGAGCAGGAGGAAGAGGG - Intronic
981426664 4:144611335-144611357 TGGCTGGAGCAGGAGGAAGTGGG - Intergenic
982727721 4:158922749-158922771 GGGCTGGAGGAAGGGGAGAATGG - Intronic
983716775 4:170791133-170791155 TGGCTGGAGCAGGAGGAAGGTGG - Intergenic
983809497 4:172042056-172042078 GGACTGGAGCAGCTGGAAGGTGG - Intronic
984172591 4:176378840-176378862 GGGCAGGAGCAGGTTAAGGTGGG - Intergenic
984786652 4:183573476-183573498 TGGCTGGAGAAGGAGGAAGAGGG + Intergenic
985031391 4:185794257-185794279 GAGATGGAGAAGGAGGAGGAGGG + Intronic
985549528 5:525907-525929 GGGTGGGTGCAGATGGAGGATGG + Intergenic
985630212 5:1009932-1009954 GAGCTGGAGGAGTTGGAGGAGGG + Intronic
985643644 5:1074978-1075000 AGGCGGGTGCAGGTGGAGGGAGG + Intronic
985797274 5:1972450-1972472 GAGCTGGAGCTTGTGGAGAATGG + Intergenic
986134086 5:4958287-4958309 GGACTGGGGCATGTAGAGGAAGG - Intergenic
986228801 5:5842673-5842695 TGGCTGGAGCCGATGGAGGAAGG + Intergenic
986581459 5:9270701-9270723 GGGTGGGGGCAGGGGGAGGAGGG + Intronic
986679695 5:10221702-10221724 CGTCTGGAGCATGTGAAGGATGG - Intergenic
986713120 5:10502328-10502350 GGCCGGGAGCAGGTGGAGGCGGG + Intergenic
986905049 5:12485906-12485928 GGGCTGGAGCAAGAGGAAGAGGG - Intergenic
986980596 5:13444014-13444036 AGGCTGGAGAAGGTGGTGAAAGG + Intergenic
987064994 5:14281302-14281324 TGGTTGGAGCAGGAGGAAGAGGG + Intronic
987102333 5:14602983-14603005 GGGCTGGGGTAGGAGGAGGATGG - Intronic
987862258 5:23503959-23503981 TGGCTGGAGCAGGAGGAAGAGGG - Intergenic
988322533 5:29717745-29717767 GGGCTGGGTCAGGGGGTGGATGG + Intergenic
988403432 5:30793115-30793137 TGCCTGGGGCAGATGGAGGAAGG + Intergenic
988608774 5:32705536-32705558 TGGCTAGAGCAGGAGGAAGAGGG + Intronic
988796772 5:34658446-34658468 GGGAGGGAGGGGGTGGAGGAAGG - Intronic
988989093 5:36651703-36651725 TGGCTGGAGGAGGTGGAGACTGG - Intronic
989008321 5:36840508-36840530 TGGCCGGAGCAGGAGGAAGAGGG + Intergenic
989193145 5:38690682-38690704 TGGCTGGAGCAGGAGGAAGGGGG + Intergenic
989195890 5:38715849-38715871 GGGCAGGAGCAGATGGACAATGG + Intergenic
989308547 5:39985849-39985871 GAGGTGGAGGAGGTGGAAGAGGG - Intergenic
990343506 5:54848830-54848852 TGACTGGAGCAGATGGAGGGAGG - Intergenic
990494942 5:56338023-56338045 GAGAAGGAGCAGGAGGAGGAGGG - Intergenic
991092587 5:62707248-62707270 GGGGAGGAGGAGTTGGAGGAAGG - Intergenic
991322800 5:65394316-65394338 GGACTGAAGCAGCTGGGGGATGG - Intronic
991448100 5:66722052-66722074 GGGGTGGGGCAGGTGGCAGAGGG - Intronic
992124197 5:73625078-73625100 GGGCTGGGGAAGGTGGCGGCTGG + Intergenic
992483782 5:77176502-77176524 GGGCATGAGCAGGAGGAGGGTGG + Intergenic
992658362 5:78932882-78932904 GGGCTTGAGCTGTTGGCGGAAGG - Intronic
992958569 5:81936047-81936069 GGGCTGGGGAAGGAGGAAGAGGG + Intergenic
992995458 5:82328396-82328418 GAGCTGGAAGAGGTGGGGGAGGG - Intronic
993387317 5:87275492-87275514 TGGCTGGAGCAGCTGGTAGATGG + Intronic
994046161 5:95312833-95312855 GGGAGGGAGGAAGTGGAGGAAGG + Intergenic
995069668 5:107904925-107904947 GGGGTGAAGCAGGAGGAGGAGGG + Intronic
995201177 5:109426595-109426617 GGGATGGAGCAGATGGAGAAGGG - Intergenic
995250254 5:109984814-109984836 GAGCAGGAGGAGGAGGAGGATGG + Intergenic
995404319 5:111777010-111777032 GAGGTGGAGGAGGAGGAGGAAGG + Intronic
995510073 5:112900517-112900539 GGGTTGGAGCAGGAGGGGTAGGG - Intronic
995854722 5:116578958-116578980 AGCCTGGAGTAGGTGGAGGAGGG - Intergenic
996595622 5:125199355-125199377 GGGGAGGAGAAGATGGAGGAGGG - Intergenic
997207897 5:132060720-132060742 GAGTTGGAGCAGGAGCAGGACGG - Exonic
997582466 5:135026476-135026498 GGACTGGAGCCGCTGGGGGAGGG + Intergenic
997588903 5:135061125-135061147 GGGCTGGGACAGGTAGAGGAGGG - Intronic
997784977 5:136701981-136702003 GGGCAGCAGCAGGTGGACGGCGG - Intergenic
998093671 5:139384927-139384949 GTCCTGGAACAGGTGAAGGATGG + Intergenic
998131108 5:139651394-139651416 GGGCTGGGGTGGGTGGGGGAAGG + Intronic
998141531 5:139702277-139702299 TGGCTGGAGCAGAAGGAGCAGGG - Intergenic
998157654 5:139795763-139795785 GAGCTGGAGGAGGAGGAGGAGGG - Intergenic
998528496 5:142863976-142863998 GGGGAGGGGCAGGTGGAGCAGGG - Intronic
998637434 5:143971664-143971686 CGGCTGGAGCAAGTGAATGATGG + Intergenic
999253289 5:150195273-150195295 GCTCAGGAGGAGGTGGAGGAAGG - Intronic
999721519 5:154402241-154402263 GGGCAGGAGCAGAGGGAGAAAGG - Intronic
1000203283 5:159032974-159032996 AGGGTGGAGAAGGTAGAGGAGGG - Intronic
1000781018 5:165481298-165481320 GGGGTGAAGGAGGTGGCGGATGG - Intergenic
1000816328 5:165927134-165927156 GAGCTGGAGCAGGGTGAGGGGGG - Intergenic
1001054122 5:168435344-168435366 AGGCTGGATCCAGTGGAGGAGGG - Intronic
1001079097 5:168653858-168653880 GGGGTGGAGTAGGATGAGGAAGG - Intergenic
1001158611 5:169294542-169294564 GGGTTGGAGCAAGTTTAGGATGG + Intronic
1001255087 5:170177160-170177182 GGGCTGGAGCAATGGGAGGCAGG + Intergenic
1001483962 5:172106548-172106570 GGGCTGGAATATGTGGTGGACGG - Intronic
1001582170 5:172806304-172806326 AGGCTGGATCAGGGGCAGGAAGG - Intergenic
1001697152 5:173679375-173679397 GGCCTGGAGCAGCTGGTGTAAGG + Intergenic
1001936595 5:175709893-175709915 GGCCTGGCGCAGGGGGAGGCTGG - Intergenic
1001994129 5:176141741-176141763 TGGCTGGAGCAGGAGGAGTGGGG - Intergenic
1002001657 5:176199599-176199621 GGGCAGGAGCAGGACGCGGAGGG + Intergenic
1002078435 5:176723511-176723533 GGACTGCAGCAGGGGGAGGCTGG - Intergenic
1002095254 5:176826986-176827008 GGGCTGGGGCAAGGGGAGAATGG - Intronic
1002434368 5:179221861-179221883 GGGCTGGAGCAGAGGGAAGGAGG - Intronic
1002435481 5:179228480-179228502 GGGCTATGGCAGGTGGAGCAGGG - Intronic
1002563472 5:180097659-180097681 GGGCCGGGGCAGGTGCAGGAGGG + Intergenic
1002576866 5:180178970-180178992 GGGCTGAAGCAGGATGAGGGAGG + Intronic
1002723732 5:181281661-181281683 GGGCTGGAGCAGTAAGAGGGCGG + Intergenic
1002723746 5:181281700-181281722 GGGCTGGAGCAGTAAGAGGGCGG + Intergenic
1002723771 5:181281778-181281800 GGGCTGGAGCAGTAAGAGGGCGG + Intergenic
1002723782 5:181281817-181281839 GGGCTGGAGCAGTAAGAGGGCGG + Intergenic
1002723794 5:181281857-181281879 GGGCTGGAGCAGTAAGAGGGCGG + Intergenic
1002872128 6:1176681-1176703 GGGCTGCAGCAGCTGAAGGGAGG - Intergenic
1003116416 6:3286649-3286671 GGGCAGGGGCAGGGGGAGGCGGG + Intronic
1003381853 6:5631667-5631689 TGGCTGGACCAAGTGGAGGTCGG + Intronic
1003501967 6:6710417-6710439 GGGGTGGGGCAGGGGGAGAAAGG + Intergenic
1003872770 6:10415083-10415105 GCGCAGGAGGAGGAGGAGGAGGG + Exonic
1003911015 6:10743775-10743797 AGGTTGGGGCAGGTGGGGGATGG + Intergenic
1004131660 6:12926535-12926557 AGGGTGGAGCAGGTGGAGCCTGG - Intronic
1004160198 6:13206039-13206061 GGGAGGGAGCCGGTGGTGGAGGG - Exonic
1004344551 6:14836645-14836667 GGCCTGGACCAGGGCGAGGATGG + Intergenic
1004457274 6:15802743-15802765 GAGCTGGCGCTGTTGGAGGAGGG + Intergenic
1004607312 6:17206492-17206514 GGGGTGGGGCAGGAGGAGGTGGG + Intergenic
1004620400 6:17326101-17326123 GGGCAGGAGCATGGGGTGGAAGG + Intergenic
1004627448 6:17390203-17390225 TGGCAGGAGCAAGGGGAGGAGGG - Intergenic
1004753299 6:18585362-18585384 AGTCAGGAGCAGGTGGGGGAGGG - Intergenic
1005083381 6:21980008-21980030 GGACTGGAGCAGTTGGGGAACGG + Intergenic
1005091506 6:22061692-22061714 GGGCAGGAGCAGATGGAGGAAGG - Intergenic
1005255382 6:23997276-23997298 GGGGTGGCAGAGGTGGAGGAGGG - Intergenic
1005335881 6:24795815-24795837 GGGCTGCTGCAGGTGGAGGTAGG + Intergenic
1005399568 6:25417624-25417646 GGGCTAGAGCACGAGGAGGCAGG + Intronic
1005556874 6:26994953-26994975 TGGCCGGAGCAGGGGGAAGAGGG + Intergenic
1005939049 6:30547167-30547189 TGGGTGGCGCAGGTGGAGCAGGG + Exonic
1006091646 6:31632105-31632127 GGGCTGGGGCTGGTGAAGGTGGG - Exonic
1006163612 6:32051914-32051936 GGGCTGGGGCAAGGGGAGAATGG + Intronic
1006164056 6:32054174-32054196 GGACTGGAGGTGGGGGAGGAAGG - Intronic
1006255941 6:32832400-32832422 GGGCTGCAGCAGATGCAGGATGG - Exonic
1006335784 6:33420012-33420034 GAGCAGGAGGAGGAGGAGGAGGG - Intergenic
1006369617 6:33635820-33635842 GGGCTGGAGCAGAGGGGTGAGGG + Intronic
1006384589 6:33723029-33723051 GGCCCGGAGCTGGTGCAGGATGG + Exonic
1006745231 6:36336977-36336999 GGGTGGTAACAGGTGGAGGAAGG - Intergenic
1007282205 6:40720979-40721001 TGGCTGGAGAGGGAGGAGGAGGG - Intergenic
1007307285 6:40917067-40917089 GAGCTGCAGGAGGTGGAGAAGGG + Intergenic
1007314980 6:40979818-40979840 GGGCTGAAGCAGGAGGAAGCTGG - Intergenic
1007357526 6:41332415-41332437 AGGCTGGAGCAGGGGGAGTATGG - Intergenic
1007393325 6:41562911-41562933 GTGCTGTGGCAAGTGGAGGATGG + Intronic
1007393345 6:41563032-41563054 GGGCTGGAGTAAGGGCAGGATGG - Intronic
1007432963 6:41786986-41787008 GAGGAGGAGCAGGTGGAGAAAGG - Exonic
1007509450 6:42364150-42364172 TGGCTGGAGGAAATGGAGGAAGG - Intronic
1007694995 6:43726249-43726271 GTGCTGGAGCAAGTGGAGAGGGG - Intergenic
1007833829 6:44659161-44659183 GGGCTGGGGGAGCTGGAGGGGGG - Intergenic
1008300552 6:49833509-49833531 GGGTTGGGGAAGGAGGAGGAAGG - Intergenic
1008670910 6:53768019-53768041 GGGCTGGAGTGGGCGGGGGAGGG - Intergenic
1010402767 6:75465935-75465957 TGGCTGGAGCAGGTGAATGAGGG - Intronic
1010642965 6:78353647-78353669 TGGCTGGAGCAGGTGGAAGAGGG + Intergenic
1010717280 6:79244274-79244296 CGGCTGGAGGAGGTGGAAAAGGG - Intergenic
1011196834 6:84789410-84789432 GGGTTGGAGGAGGTTGAGGGAGG + Intergenic
1012402146 6:98849544-98849566 GGGGTGGGGGAGATGGAGGAAGG - Intergenic
1012981006 6:105830891-105830913 GGGAAGGGGCAGCTGGAGGAGGG + Intergenic
1012981014 6:105830912-105830934 GGGAAGGGGCAGCTGGAGGAGGG + Intergenic
1012981022 6:105830933-105830955 GGGAAGGGGCAGCTGGAGGAGGG + Intergenic
1012981113 6:105831170-105831192 GGGAGGGGGCAGCTGGAGGAGGG + Intergenic
1012981121 6:105831191-105831213 GGGAAGGGGCAGCTGGAGGAGGG + Intergenic
1012981143 6:105831255-105831277 GGGAAGGGGCAGCTGGAGGAGGG + Intergenic
1013056582 6:106589167-106589189 GCGGTGGAGGAGGAGGAGGAGGG + Intronic
1013596024 6:111661908-111661930 GTGCTGGAGCAGGTGGAGCGAGG - Exonic
1013857466 6:114591411-114591433 GGGCTGGGGGAGCTGGAGCAGGG + Intergenic
1013984725 6:116176706-116176728 AGGCTTAAGCAGCTGGAGGAAGG - Intronic
1014078488 6:117264325-117264347 TGGCTGGGTCAGGTGGCGGAAGG - Intergenic
1014994528 6:128125376-128125398 TGGCAGGAGCAGGAGCAGGATGG - Intronic
1015218523 6:130777859-130777881 GAGGTGGAAGAGGTGGAGGAGGG + Intergenic
1015580815 6:134722749-134722771 GGTCGGGAGAATGTGGAGGAGGG + Intergenic
1015890016 6:137961012-137961034 TGGCTGGAGCAGGAGGAAGGTGG - Intergenic
1015923743 6:138290027-138290049 GGGCTGTGGCAGGTGGAGAGGGG + Intronic
1016473975 6:144406312-144406334 GAGATGGAGAAGGTGGAGCATGG - Intronic
1016786906 6:148020905-148020927 GGGCTGAAGCAGCTGGAAGCAGG + Intergenic
1017084852 6:150704513-150704535 AGGCTGAGGCAGGTGGAGTAAGG + Intronic
1018114899 6:160573812-160573834 GTTCTGGTGGAGGTGGAGGAGGG + Intronic
1018255708 6:161916901-161916923 AGGCTGGGGCAGGAGGAGAATGG - Intronic
1018291779 6:162298827-162298849 GGGCTGAGCCAGGTGGAGGAGGG + Intronic
1018471377 6:164101215-164101237 GGGGTCCTGCAGGTGGAGGAGGG - Intergenic
1018683178 6:166281731-166281753 GGGCTGGAGCGGATGGTGAAGGG + Intergenic
1018699692 6:166416617-166416639 GGGATGGAGCTGATGGTGGAGGG - Intronic
1018902548 6:168058748-168058770 CGGGTGGAGGAGGTGGACGAAGG + Intronic
1018908761 6:168089979-168090001 CAGCCTGAGCAGGTGGAGGATGG - Intergenic
1018911437 6:168102505-168102527 GGCCTGGGGCAGGGGGAGGAAGG - Intergenic
1019053502 6:169202550-169202572 TGGCTGGAGCAGGAGGAAGGAGG + Intergenic
1019273790 7:165173-165195 GGGAGGGAACAGGTGGAGGTGGG + Intergenic
1019303514 7:321651-321673 GGCCTGGGGCAGGTGGAGGAGGG - Intergenic
1019336250 7:484427-484449 GGCCCTGAGCAGGTGGAGGAGGG - Intergenic
1019428053 7:986652-986674 GGGCCGGTGCAGCTGGAGCAGGG - Exonic
1019494948 7:1333420-1333442 GGGGAGGAGAAGGGGGAGGAGGG - Intergenic
1019502886 7:1373999-1374021 TGGCTGGAACAGGAGGAAGAGGG + Intergenic
1019564623 7:1673275-1673297 GGGCCGGAGAGGGTGGTGGAGGG + Intergenic
1019587979 7:1815129-1815151 GGGCGGGGGCAGGGGGAGGAAGG - Intergenic
1019590229 7:1827196-1827218 GGGATGGAGAAGGTGGGAGAAGG + Intronic
1019626555 7:2018817-2018839 GGGCTGGAGGGGGCGGAGGGAGG - Intronic
1019718807 7:2555557-2555579 GGCCCGGAGGAGGCGGAGGACGG + Exonic
1019854118 7:3587000-3587022 GAGGTGGAGGAGGAGGAGGAAGG + Intronic
1019898764 7:4003244-4003266 GGTCTGGAGCAGGCAGGGGAGGG - Intronic
1020137287 7:5594314-5594336 CAGCGGGAGGAGGTGGAGGAAGG - Intronic
1020279353 7:6642563-6642585 GTGGTGGAGGAGGAGGAGGAGGG + Exonic
1020465828 7:8477684-8477706 GGGATGGTGCTGGGGGAGGATGG + Intronic
1020475921 7:8594388-8594410 TGCCTGGAACAGCTGGAGGAGGG + Intronic
1021055384 7:16041096-16041118 TGGCTGGAGCAGGAGAAAGAGGG - Intergenic
1021102778 7:16602842-16602864 GAGCTGGAGCAAGAGGAGGTGGG - Intronic
1021698993 7:23299548-23299570 GGGCTGGAGGAGCGGGCGGAGGG + Exonic
1021877125 7:25059554-25059576 TGGTCGGAGCAGGTGGCGGAGGG - Intergenic
1022026423 7:26452156-26452178 GGGCTGGAGCAGAGCGAGGTTGG - Intergenic
1022098043 7:27152965-27152987 GGGCTGGGGCAGCTGGATGCGGG - Intergenic
1022425736 7:30267077-30267099 GAGCTGGAGGAGGTGGGTGATGG + Intergenic
1023561100 7:41474148-41474170 GAGGTGGAGCAGATGTAGGAGGG - Intergenic
1023758780 7:43444679-43444701 GAGAAGGAGCAGGAGGAGGAGGG + Exonic
1023769755 7:43545818-43545840 GGGGTGGAGGAGGTGGAAGGGGG + Intronic
1023838620 7:44082779-44082801 GGGCTGGAGCGGGGCGGGGAGGG + Intergenic
1023878754 7:44306982-44307004 GGGTGTGAGCAGGAGGAGGAGGG + Intronic
1023878776 7:44307062-44307084 GGGTCTGAGCAGGGGGAGGAGGG + Intronic
1023878793 7:44307119-44307141 GGGTGTGAGCAGGGGGAGGAGGG + Intronic
1023878835 7:44307296-44307318 GGGTGTGAGCAGGCGGAGGAGGG + Intronic
1024311613 7:47974671-47974693 AGGAGGGAGCAGGGGGAGGAGGG + Intronic
1024674077 7:51622514-51622536 GGGCTGGAGGCTGTGGAGAAAGG + Intergenic
1025813223 7:64888590-64888612 GTGGTGGAGAAGGTGGAGGGCGG - Intronic
1025887763 7:65614474-65614496 GAGATGGAGGAGGAGGAGGAAGG - Intergenic
1026334599 7:69382988-69383010 TGGCTGGAGCAGGAGGAACAGGG - Intergenic
1026337997 7:69411284-69411306 ATGCTGGACCTGGTGGAGGAGGG - Intergenic
1027400361 7:77799452-77799474 GCGCTGGAGGAGGTGGAAGGAGG + Intronic
1027542987 7:79491812-79491834 GAGGTGGAAAAGGTGGAGGAAGG + Intergenic
1027681860 7:81232435-81232457 GGGCTGCAGCATCTGGATGAGGG + Intergenic
1027814704 7:82953695-82953717 GTGGTGGAGGAGGAGGAGGAGGG + Exonic
1028639630 7:93028626-93028648 GGGCTGAAGCAGGAGGAAGCTGG + Intergenic
1028964679 7:96789137-96789159 GGGCTGGAGCCTGGGGAGCATGG + Intergenic
1029244403 7:99188444-99188466 GTGCTGCAGGAGGTGAAGGAGGG + Exonic
1029537259 7:101163924-101163946 GGGCTGGCGCAGGTGGAGGCCGG - Exonic
1029657170 7:101934934-101934956 GGTGAGGAGCAGGAGGAGGAAGG + Intronic
1029659024 7:101946650-101946672 GGCCAGGAGCTGGTGGAGGGGGG + Intronic
1029923155 7:104287585-104287607 GGGGTGGAGTAGGAGGGGGAGGG - Intergenic
1029972161 7:104800424-104800446 GGGCAAGAGCAGTTAGAGGAAGG - Intronic
1030065484 7:105655863-105655885 GCCCTGCAGCAGGTGGGGGAGGG - Intronic
1030266595 7:107628447-107628469 GGACAGGAGCAGGAGGGGGATGG + Intronic
1030272190 7:107681917-107681939 GGGCGGGAGGAGGTGGGGGCAGG - Intronic
1030781856 7:113610699-113610721 GGGGAGGAGGAGGAGGAGGAGGG + Intergenic
1031443414 7:121821589-121821611 GAGCAAGAGCAGGTGGAGGCAGG - Intergenic
1031951608 7:127898416-127898438 GAGCAGGAGCAGGTGCAGAATGG - Intronic
1032438559 7:131922747-131922769 GGGCTGGAGTTGGTGGGGGTGGG - Intergenic
1032506212 7:132436486-132436508 GTGAAGGTGCAGGTGGAGGAAGG - Intronic
1033250853 7:139757685-139757707 GGGCTGGGGGAGGTTGAGAAGGG + Intronic
1033315021 7:140289961-140289983 GTGCTGGTGGAGGTGGAGAAGGG - Intergenic
1033890435 7:146006407-146006429 GAGAAGGAGCAGGGGGAGGATGG - Intergenic
1034023934 7:147676658-147676680 GGGCTGGGGTAGTTGGTGGATGG - Intronic
1034064734 7:148125394-148125416 GGGCGGGAGGAGGGAGAGGATGG - Intronic
1034158158 7:148972492-148972514 GGGCTGGAGAAGGCAGAGAAAGG - Intergenic
1034385651 7:150738402-150738424 GGGCTGGGGCAGATGGGTGAAGG + Intronic
1034393649 7:150803852-150803874 GGGCAGCAGCAGGTGGGGCAGGG + Intronic
1034487086 7:151372789-151372811 GGGCTGGAGCTGGGGGAGACTGG + Intronic
1034670594 7:152854746-152854768 GGGCGGGAGAAGGAGGAGGCTGG - Exonic
1034677664 7:152903182-152903204 GTGCTGGGTGAGGTGGAGGAAGG + Intergenic
1034945447 7:155259051-155259073 GGGAAGGAGGAGGAGGAGGAGGG - Intergenic
1035028907 7:155844748-155844770 GGGCTGGGGCATGGGGAGGACGG - Intergenic
1035187590 7:157138709-157138731 GCGCTGGAGCCTGGGGAGGACGG - Intergenic
1035263569 7:157676325-157676347 GGGCTGGGCCAGGTGGTGGGTGG - Intronic
1035406804 7:158604130-158604152 GGGATGGAGCAGGTGGGTGTGGG - Intergenic
1035416769 7:158695828-158695850 GGGCTGGAGGTGGTTGTGGAAGG - Intronic
1035760441 8:2064761-2064783 GGGATGGAGGAGAAGGAGGAGGG - Intronic
1036106972 8:5851640-5851662 GGGCAGGAGAAGGTGAGGGATGG + Intergenic
1036404081 8:8439254-8439276 GGGCTGGAGTCGGAGGAGAATGG + Intergenic
1036647773 8:10622906-10622928 GCCCTGGAGCAGCTGGAAGATGG - Exonic
1036726372 8:11224451-11224473 TGGCTGAAGCAGGAGGAAGAGGG + Intergenic
1037013408 8:13873404-13873426 GAGGTGGAAGAGGTGGAGGAGGG + Intergenic
1037300276 8:17444106-17444128 GGGCGGGAGGAAGAGGAGGAAGG - Intergenic
1037603961 8:20422099-20422121 GGGCTGGAGGAGGTGGAGGGAGG - Intergenic
1037674335 8:21041184-21041206 GGGCTGGAGGAGTTGGAGGTCGG - Intergenic
1037802695 8:22044039-22044061 GGGCTGGAGCAAAAGGGGGAAGG - Intronic
1037908597 8:22729779-22729801 GGGGAGGACCTGGTGGAGGAGGG + Intronic
1037927547 8:22855938-22855960 AGGCTGAGGCAGGAGGAGGATGG + Intronic
1037941714 8:22956468-22956490 TGGCTGGACCAGGAGGAGGAGGG - Intronic
1038058041 8:23880597-23880619 TGGCTGGAGCAGGAGCAAGAGGG + Intergenic
1038067116 8:23974750-23974772 AGGATGGGGCAGGAGGAGGAAGG + Intergenic
1038533357 8:28336592-28336614 GGGCTGGACCAGGTGGTAGAGGG + Intronic
1038675961 8:29623135-29623157 GGAATGGGGCAGGGGGAGGATGG + Intergenic
1038761111 8:30384768-30384790 GGGCGGGAGCCAGGGGAGGAAGG - Exonic
1039466620 8:37789241-37789263 GGGGAGGAACAGGAGGAGGAAGG + Intronic
1040079772 8:43274918-43274940 GAGGAGGAGCAGGAGGAGGAGGG - Intergenic
1040483819 8:47851777-47851799 GGGCTGCCACAGGAGGAGGACGG + Intronic
1040988126 8:53318551-53318573 GGGCTGGAGGAGGTGGTGTCTGG - Intergenic
1041006652 8:53502703-53502725 GGGTTGGAGCAGTGGGAGGTGGG - Intergenic
1041107862 8:54459189-54459211 CGGCTGAAGCGGGTGGAGGGCGG + Exonic
1041124438 8:54621246-54621268 CGCCTGGAGGAGCTGGAGGACGG + Exonic
1041170886 8:55141259-55141281 GGGCTGGAGGCAGAGGAGGAGGG - Intronic
1041256373 8:55982859-55982881 GGGCTGGAGCGGCTGCAGGAGGG - Intronic
1041372052 8:57172099-57172121 GGCCTGGAGCTGCTGGAGGATGG - Intergenic
1041401355 8:57448729-57448751 GGGGAGGAGGAGGGGGAGGAGGG - Intergenic
1041401373 8:57448768-57448790 GAGCAGGAGGAGGAGGAGGAGGG - Intergenic
1041943866 8:63420402-63420424 GGGCTGAAGCAGTTCAAGGAGGG + Intergenic
1042312076 8:67388798-67388820 TGGCAGGAGCAGGAGGAGGAGGG - Intergenic
1043149386 8:76694673-76694695 GGGCGGGAGCAGGGGGCGGAGGG - Intronic
1043502767 8:80873735-80873757 GGGCGGGAGCAGGCGGCGGAGGG - Intronic
1044619111 8:94171991-94172013 GGGAGGGAGGAGGGGGAGGAGGG - Intronic
1044923864 8:97193075-97193097 TGGCTGGAGCAAGTGCAGCATGG - Intergenic
1045679779 8:104646291-104646313 TGGCTGGAGCAGGAGGAAGGAGG - Intronic
1046131781 8:109975062-109975084 GGGTGTGAGCAGGTGGGGGAGGG + Exonic
1046199446 8:110903754-110903776 GGGGTGTAGGAGGTGGGGGATGG + Intergenic
1047216915 8:122883322-122883344 GGGATGGAGGAGATGGAGGTGGG + Intronic
1047220586 8:122915343-122915365 GGGAGGGAGCAGCTGCAGGATGG - Intronic
1047254802 8:123207048-123207070 GGGAGGGAGGAGGTGGAGGAAGG - Intronic
1047292185 8:123540787-123540809 GGGCTGGAGCGGGCTGAGGAGGG - Intronic
1047347464 8:124042078-124042100 GTGTTGTGGCAGGTGGAGGAGGG - Intronic
1047624343 8:126640794-126640816 GGGCAGGGGCAGGTAGAGGAAGG - Intergenic
1047742018 8:127814196-127814218 GGGCTGGAGAAGGAGGATGGAGG - Intergenic
1047778435 8:128092365-128092387 GGGCTGGATCAGTCAGAGGAAGG - Intergenic
1048158352 8:131985834-131985856 GTAATGCAGCAGGTGGAGGATGG + Intronic
1048424685 8:134312165-134312187 GGGGTGTAGCAGGTGAGGGAGGG - Intergenic
1048586182 8:135776179-135776201 GGGCTGGAGTTGGGGGATGAAGG + Intergenic
1048679919 8:136829881-136829903 GGGTTTTAGCAGGAGGAGGAGGG + Intergenic
1048861448 8:138727175-138727197 GTGCTGGAGCTGAGGGAGGAGGG - Intronic
1048916166 8:139185050-139185072 TGGCTAGAGGAGGAGGAGGAAGG - Intergenic
1049203304 8:141352062-141352084 GGGCGGGCCCAGGTGCAGGAGGG - Intergenic
1049256857 8:141618829-141618851 GTGCAGGAGCTGGTGGGGGAAGG - Intergenic
1049287148 8:141782011-141782033 TGGGTGGAGCAGGTGGACGGTGG + Intergenic
1049351653 8:142167847-142167869 GGGCAGGTGCAGAGGGAGGAAGG - Intergenic
1049573380 8:143379740-143379762 TGGTCGGAGCAGGTGGAGGCTGG + Intronic
1049608489 8:143541135-143541157 GGGCTGCAGAGGGTGGAGGCAGG - Intronic
1049642916 8:143723440-143723462 AGGTTGGAGGAGGCGGAGGAGGG + Intergenic
1049796782 8:144500621-144500643 GGGCGGGAGCAGGTGGGAGGGGG + Intronic
1049798661 8:144507759-144507781 GGGCTGGGGCTGGAGGAGGCAGG + Intergenic
1049889429 9:54840-54862 TGGCTGGAACAGAAGGAGGAGGG - Intergenic
1050529171 9:6573212-6573234 AGGCTGAGGCAGGTGGAGGCAGG + Intronic
1050697444 9:8294610-8294632 TGGCTAGAGCAGGAGGAAGAAGG - Intergenic
1050915936 9:11132743-11132765 TGGCTGGAGCAGGAGGAAGAGGG - Intergenic
1050977764 9:11963732-11963754 GGGATGGGGAAGGTGGAGGTAGG - Intergenic
1051873406 9:21765384-21765406 AGGGTGGAGAAGGAGGAGGAAGG + Intergenic
1052250275 9:26390095-26390117 GAGCTGAAGCACTTGGAGGAAGG - Intergenic
1052298344 9:26924482-26924504 GGGTTGGAGGAGATGGACGAAGG - Intronic
1052305680 9:27006663-27006685 GGGAAGGAGGAGGAGGAGGAAGG + Intronic
1052523901 9:29587378-29587400 GGGTTGGAGGTGGTGGTGGAGGG + Intergenic
1052855044 9:33401923-33401945 GGGCTGGAGCTGGGGCTGGAGGG - Intronic
1052935361 9:34088552-34088574 GGGCAGGAAAAGGGGGAGGAAGG + Intronic
1052988351 9:34503861-34503883 GGTATAAAGCAGGTGGAGGAAGG + Intronic
1052988873 9:34506919-34506941 GGCCTGGAGCCACTGGAGGAGGG + Intronic
1053001505 9:34579294-34579316 GGGAGGGAGGAGGGGGAGGAGGG - Intronic
1053136041 9:35650719-35650741 GGGCAGGGGCTGGTGGGGGAGGG - Intronic
1053185738 9:36014623-36014645 TGGCTGGAGTAGGAGGAAGAGGG - Intergenic
1053459060 9:38254408-38254430 GGGCTGGAGCAGGGGGTGGGGGG + Intergenic
1053683062 9:40498264-40498286 GGGCTGGAGCTGGGGCTGGAGGG - Intergenic
1053800056 9:41758431-41758453 GGGCTGAAGTTGGAGGAGGAGGG + Intergenic
1053933045 9:43126580-43126602 GGGCTGGAGCTGGGGCTGGAGGG - Intergenic
1054145130 9:61556404-61556426 GGGCTGAAGTTGGAGGAGGAGGG - Intergenic
1054188486 9:61970583-61970605 GGGCTGAAGTTGGAGGAGGAGGG + Intergenic
1054280652 9:63126664-63126686 GGGCTGGAGCTGGGGCTGGAGGG + Intergenic
1054296162 9:63333762-63333784 GGGCTGGAGCTGGGGCTGGAGGG - Intergenic
1054394178 9:64638267-64638289 GGGCTGGAGCTGGGGCTGGAGGG - Intergenic
1054428828 9:65143466-65143488 GGGCTGGAGCTGGGGCTGGAGGG - Intergenic
1054456478 9:65434000-65434022 TGGGTGGGGCAGGTGGAGGTGGG - Intergenic
1054464831 9:65487361-65487383 GGGCTGAAGTTGGAGGAGGAGGG - Intergenic
1054501551 9:65878069-65878091 GGGCTGGAGCTGGGGCTGGAGGG + Intronic
1054650038 9:67618034-67618056 GGGCTGAAGTTGGAGGAGGAGGG - Intergenic
1054857249 9:69914348-69914370 TGGCTGGAGCAGGAGGCAGAAGG - Intergenic
1056491760 9:87115363-87115385 AGGCAGCAGCAAGTGGAGGATGG - Intergenic
1056558900 9:87712452-87712474 GGGCTGGTGCTGGGTGAGGACGG + Intergenic
1056575209 9:87851295-87851317 GGGCTGGCGCTGGGTGAGGATGG - Intergenic
1056950372 9:91036578-91036600 GTGATGGGGCAGGAGGAGGAGGG - Intergenic
1056963353 9:91145736-91145758 GGCCTGGGGCAGGAGGAAGATGG + Intergenic
1056968382 9:91183006-91183028 TGGCTGGTGCAGGAGCAGGAGGG - Intergenic
1057129299 9:92642060-92642082 GGGTGGGAGCAGGTGGAGAGAGG - Intronic
1057180766 9:93028868-93028890 AGGCTGGAGCAGGTGTAGCCTGG - Intronic
1057181560 9:93033410-93033432 GAGAAGGAGCAGGAGGAGGAGGG - Intronic
1057487776 9:95499480-95499502 GGGCGGGAGAAGGGGCAGGAGGG + Intronic
1057621378 9:96639036-96639058 GAGCAGGAGGAGGAGGAGGAGGG + Intergenic
1057847502 9:98536883-98536905 AGGATGGAGAAGGTGGAGGGAGG - Intronic
1057904679 9:98974674-98974696 GGGCTGGACCAGTAGGATGAGGG - Intronic
1058374106 9:104303946-104303968 TGGCTGGAGCAGGAGGAAGAGGG - Intergenic
1058896685 9:109406395-109406417 GGGCTGGAGCAGGCGCAGCTTGG + Intronic
1059338551 9:113584071-113584093 GAGGTGGAGGAGGGGGAGGAAGG + Exonic
1059425150 9:114216317-114216339 GAGCTCGGGCATGTGGAGGAAGG + Intronic
1059460814 9:114428805-114428827 GGGCTGATGGGGGTGGAGGACGG - Intronic
1059698149 9:116748353-116748375 AGGCTGGAGCTGGAGCAGGAGGG - Intronic
1059777701 9:117492505-117492527 GAGCTGGAGTAGGGGAAGGAGGG - Intergenic
1059837152 9:118168882-118168904 GAATTGGAGGAGGTGGAGGAAGG + Intergenic
1060395652 9:123314508-123314530 GGGCTGGAGTATGTGGACTAGGG - Intergenic
1060549362 9:124477795-124477817 GGGGCGGGGCAGGTGGGGGAGGG - Intronic
1060557903 9:124518687-124518709 GGGCTGGGGTAGGGGGAGGCAGG + Exonic
1060706464 9:125806277-125806299 TGGCTGGAGCAGAGGGAGGGAGG + Intronic
1060734051 9:126055121-126055143 GGCCTGGGGAAGGTGGACGAGGG + Intergenic
1060952028 9:127610067-127610089 GTGCTGAAGCAGATGGAGAAGGG - Intergenic
1060968932 9:127727054-127727076 CAGCTGGAGCAGATGGTGGAGGG + Exonic
1060970358 9:127734320-127734342 GGGGTGGGGGAAGTGGAGGACGG + Exonic
1061037903 9:128123672-128123694 GGGCTGGGGCTGGCGGGGGAAGG - Intronic
1061371790 9:130201538-130201560 GGGCTGGGCCTGGGGGAGGAGGG + Intronic
1061413038 9:130431330-130431352 GGGGTGGGGCAGGTGGGGGATGG - Intronic
1061761508 9:132855052-132855074 AGGGTGCAGCGGGTGGAGGAAGG - Intronic
1061832823 9:133306609-133306631 GGGCTGGTTCAGGTGCAGCAGGG - Intergenic
1061967639 9:134025263-134025285 GGGCTGGAGGAGGAGGAGGGAGG - Intergenic
1062042532 9:134410696-134410718 TGGCTGGAGCTGGGGGGGGAAGG + Intronic
1062079843 9:134618055-134618077 GCGGTGGAGTAGTTGGAGGAAGG - Intergenic
1062253694 9:135611005-135611027 GGGCTGCACCAGGTGGTGCATGG - Intergenic
1062325113 9:136009222-136009244 GGGGTGGAGCAGGGGCAGGTAGG - Exonic
1062376262 9:136263181-136263203 GGGGTGGGGCAGATGGAGGGAGG - Intergenic
1062385311 9:136307019-136307041 GGGCTGGGGCGGGGGGAGAAAGG + Intergenic
1062400727 9:136371532-136371554 GGGCAGGGACAGGTGGAGGCTGG + Intronic
1062411089 9:136424875-136424897 GGGCCGGAGCCGGAGGACGATGG + Intergenic
1062453706 9:136626194-136626216 CAGCTGGAGCGGGTGCAGGAGGG + Intergenic
1062481965 9:136756712-136756734 GGCCTGGAGCAGGATGAGGCGGG + Intronic
1062497808 9:136839820-136839842 GGGCTGGGGCTGGAGGAGGCCGG + Exonic
1062585490 9:137247602-137247624 GGGCTGCAGGAGGGGGAGAATGG - Intronic
1062703108 9:137918404-137918426 GGGCTGTGGAAGGTGGAGAAGGG + Intronic
1062737126 9:138143694-138143716 GGCCTGGAGGAGGAGCAGGAAGG + Intergenic
1203654535 Un_KI270752v1:10104-10126 GGGCTGGGGCGGGTGGGGGGGGG + Intergenic
1185449555 X:275213-275235 GAGAAGGAGCAGGGGGAGGAAGG + Intergenic
1185550700 X:980899-980921 GGGATGGAGGAGGAGGAGGAGGG + Intergenic
1185550828 X:981304-981326 AGGATGGAGGAGGAGGAGGAGGG + Intergenic
1185550860 X:981405-981427 GGGATGGAGGAGGAGGAGGAGGG + Intergenic
1186108229 X:6228029-6228051 GGGCTGGAGATGGTGAAGGCAGG - Intronic
1186127462 X:6429435-6429457 GAGCTGGAGAATGGGGAGGAGGG + Intergenic
1186360170 X:8832731-8832753 GGGCTGGGGCAAGTGGGGGATGG + Intergenic
1186455725 X:9708436-9708458 GGGCTGATCCAGGTGGAAGATGG - Intronic
1186636910 X:11416126-11416148 GTGCTGCCGCAGGTGGGGGAGGG - Intronic
1186853215 X:13600959-13600981 GGGCTGGAGGAGGGGGAGTGAGG - Intronic
1187357984 X:18596325-18596347 GGGGTGGAGGTGGGGGAGGAGGG + Intronic
1187462278 X:19498303-19498325 GGAGTGGTGCAGGTGGGGGAGGG + Intronic
1187526767 X:20061423-20061445 GGGCAGGAGCAGGTGGCAGAAGG + Intronic
1187592976 X:20739281-20739303 GGGCTGGACCCAGTGAAGGAGGG - Intergenic
1187965746 X:24609737-24609759 GGGGTGAAGAAGGTGGAGAAAGG + Intronic
1188934488 X:36157085-36157107 GGGGTGGAACAGGTGAAGAAGGG - Intergenic
1189137354 X:38562573-38562595 GGGGAGGAGGAGGAGGAGGAGGG + Intronic
1189378336 X:40483277-40483299 TGGCCAGAGCAGGAGGAGGAAGG + Intergenic
1189656344 X:43248786-43248808 CGGCTGGAGCAGGAGGAAGAGGG - Intergenic
1189763399 X:44344812-44344834 GAGCTGGAGTAGATGGAGGAGGG - Intergenic
1189862987 X:45292263-45292285 GGGCTGATGGAGGGGGAGGATGG + Intergenic
1190304220 X:49073193-49073215 GGGATGGAGAATCTGGAGGAAGG - Intronic
1190580480 X:51888961-51888983 GGGATGGGGGCGGTGGAGGAGGG + Intronic
1190901090 X:54673598-54673620 TGGCTGGAGAAGGAGGAAGAGGG - Intergenic
1191128053 X:56978905-56978927 GGGCTGGAGTGGCTGGAGGCTGG - Intronic
1191662005 X:63661132-63661154 GGGCTGGAGCAGAAAGAAGAAGG - Intronic
1191811485 X:65193992-65194014 TGGCTGGAGCAAGAGGAAGAAGG + Intergenic
1192175059 X:68880280-68880302 GTGGTGGGGCAGGTGGGGGATGG - Intergenic
1192193930 X:69016208-69016230 GGTCTGGGGCAGGAGGAGGAGGG + Intergenic
1192199877 X:69060138-69060160 AGGCTGAAGCAGTTGGGGGAAGG + Intergenic
1192206218 X:69098195-69098217 GGACAGGAGGAGGTGGGGGATGG - Intergenic
1192550412 X:72049058-72049080 GAGCAGGAGGAGGAGGAGGAGGG + Intergenic
1192564387 X:72151497-72151519 GCACAGGAGCAGGTGGAGGGGGG + Intergenic
1192786753 X:74343793-74343815 TGGCTGGAGCAGGAGGAAGAGGG - Intergenic
1193900279 X:87167877-87167899 GAGCTGGAGCAGCTGGATGCAGG + Intergenic
1193965132 X:87975805-87975827 GGGCTGGAGCAGTTGCATGCAGG - Intergenic
1195304310 X:103564295-103564317 AGGCTGGAGAAGGTAGTGGAAGG + Intergenic
1195470075 X:105220480-105220502 GGGCGGGAGAAGATGGATGAGGG - Intronic
1195534768 X:105998773-105998795 GGGTGGGAGGAGGCGGAGGATGG + Intergenic
1195653411 X:107311247-107311269 GGGCTGGAGGAAGTGGGGAAAGG + Intergenic
1195923578 X:110004118-110004140 GGGGTTGAGCAGGTAGATGACGG - Exonic
1197713430 X:129688485-129688507 GGGCTGGAGCAGCTGGGGACAGG + Intergenic
1197773598 X:130106205-130106227 GGTCAGCAGCAGCTGGAGGAGGG - Intronic
1197782482 X:130171848-130171870 GCGCTGGAGGAGGAGGAGGGGGG + Exonic
1197975646 X:132163307-132163329 TGGCTGGAGCAGCTGGATGCAGG - Intergenic
1198084455 X:133269111-133269133 GGCTGGGAGCAGGAGGAGGAGGG - Intergenic
1198665867 X:139022133-139022155 GGACAGGAGCAAGAGGAGGAAGG + Intronic
1198694747 X:139324231-139324253 CTGCTGCAGCAGGTGGGGGAGGG - Intergenic
1199286384 X:146059169-146059191 TGGCTGGAGCATGGGGAAGAGGG + Intergenic
1199484641 X:148334495-148334517 GAGGTGGAGCAGGTAGGGGATGG - Intergenic
1199518011 X:148700538-148700560 GGAGTGGAGCTTGTGGAGGATGG - Intronic
1199716017 X:150507860-150507882 GGGCAGGGGCAGATGGAGGCTGG - Intronic
1199737446 X:150696883-150696905 AAGTGGGAGCAGGTGGAGGAAGG + Intronic
1199744894 X:150766227-150766249 GGGCGGGGGGAGGGGGAGGAGGG + Intergenic
1199861916 X:151808669-151808691 GGGTTGGAGGATGTGGAAGAGGG + Intergenic
1199942148 X:152637673-152637695 GGGCTGGGGGAGGGGGAGGAGGG - Intergenic
1200072443 X:153535879-153535901 GGGCTTGCCCAGGTGGGGGAGGG - Intronic
1200101928 X:153692619-153692641 GGGGTTGAGCAGGTGGAGAGTGG - Intronic
1200102414 X:153694638-153694660 GGGCTGGGGGAGGTGGGGCAGGG + Intronic
1200155003 X:153970553-153970575 GGGAGGGAGCAGATGGAGGGAGG + Intronic
1200234966 X:154463784-154463806 TAGCTGGAGAAAGTGGAGGAGGG - Intronic
1200257919 X:154594767-154594789 GTTCTGCAGCAGCTGGAGGAAGG - Intergenic
1201228900 Y:11844875-11844897 GGGCTGAAGCAGGAGGAAGCTGG + Intergenic
1201229741 Y:11852644-11852666 TGGAGGGAGCATGTGGAGGAAGG + Intergenic
1201291570 Y:12425343-12425365 GGGCTGGAGAAGGTGGGGCATGG + Intergenic
1202088496 Y:21163704-21163726 GAGCAGGTGCAGATGGAGGAAGG + Intergenic
1202138327 Y:21691629-21691651 TGGCTGGAGCAGGCTGTGGAAGG - Intergenic