ID: 1179361740

View in Genome Browser
Species Human (GRCh38)
Location 21:40715752-40715774
Sequence GAGGTAACTGTCACTCTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1179361737_1179361740 -2 Left 1179361737 21:40715731-40715753 CCCAAACATATTGTTAGGAATGA 0: 1
1: 0
2: 1
3: 26
4: 248
Right 1179361740 21:40715752-40715774 GAGGTAACTGTCACTCTTCAAGG 0: 1
1: 0
2: 1
3: 10
4: 123
1179361734_1179361740 16 Left 1179361734 21:40715713-40715735 CCAAGAAACTGACATTACCCCAA 0: 1
1: 0
2: 0
3: 17
4: 227
Right 1179361740 21:40715752-40715774 GAGGTAACTGTCACTCTTCAAGG 0: 1
1: 0
2: 1
3: 10
4: 123
1179361736_1179361740 -1 Left 1179361736 21:40715730-40715752 CCCCAAACATATTGTTAGGAATG 0: 1
1: 0
2: 0
3: 18
4: 204
Right 1179361740 21:40715752-40715774 GAGGTAACTGTCACTCTTCAAGG 0: 1
1: 0
2: 1
3: 10
4: 123
1179361738_1179361740 -3 Left 1179361738 21:40715732-40715754 CCAAACATATTGTTAGGAATGAG 0: 1
1: 0
2: 0
3: 8
4: 194
Right 1179361740 21:40715752-40715774 GAGGTAACTGTCACTCTTCAAGG 0: 1
1: 0
2: 1
3: 10
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1179361740 Original CRISPR GAGGTAACTGTCACTCTTCA AGG Intronic
900814741 1:4834842-4834864 GAGCTAACTGTCATCCCTCAGGG - Intergenic
906747990 1:48234948-48234970 GAGGCACCTGTGACACTTCAAGG + Intronic
909469224 1:76007898-76007920 GAAGTGACTTTCTCTCTTCACGG + Intergenic
911047095 1:93637638-93637660 GGGGTAACTTCCACTCTTCTGGG + Intronic
912237849 1:107871412-107871434 GATATGACTCTCACTCTTCAGGG - Intronic
915057891 1:153152638-153152660 CAGGAAACTGACACACTTCAGGG + Intergenic
915185031 1:154098297-154098319 GAGAGAACTGTGACTCTTCAGGG - Intronic
915584405 1:156836459-156836481 GAGGTAGCTGTCAATCACCAAGG - Intronic
916880200 1:169013274-169013296 CAGGTAGCTGTCGTTCTTCAAGG - Intergenic
918321359 1:183368279-183368301 GAGGACCCTGTCACTCTGCAGGG - Intronic
920370575 1:205477045-205477067 CAGGTCACTGTCACTCTGCAGGG + Intergenic
922972499 1:229754745-229754767 AAGGTCACTGTCCCTCTTCGAGG - Intergenic
923083056 1:230678408-230678430 GAGTTAGCTGCCACTCTTAATGG + Intronic
1065970111 10:30799347-30799369 GAGGTCACTGTCTGTCCTCAGGG + Intergenic
1068282734 10:54896638-54896660 AAAGTAAATGTCAATCTTCAAGG - Intronic
1071426951 10:85567207-85567229 GTGGTAAGTTTTACTCTTCAAGG - Intergenic
1075055455 10:119215102-119215124 AAGGTACCTGTTCCTCTTCAGGG + Intronic
1075983340 10:126760625-126760647 GAGGTAAGTGTGTCACTTCAAGG + Intergenic
1076487385 10:130833323-130833345 GAGGTGCCTGTCAGTCTTCAAGG - Intergenic
1078423537 11:11231370-11231392 CAGGGAACTGTTTCTCTTCAGGG + Intergenic
1082149702 11:48721394-48721416 GAGGTAAATGTTTCTATTCATGG + Intergenic
1082598650 11:55118968-55118990 GAGGTAAATGTTTCTATTCATGG + Intergenic
1083105082 11:60349502-60349524 GAGGTCATTGTTACTCTCCAAGG + Intronic
1083498555 11:63081250-63081272 GAGGTAAATGTCACAATTAAGGG - Intronic
1085242200 11:75067124-75067146 GAGGTAGATGTCATTCTTTAGGG - Intergenic
1086360365 11:86052420-86052442 AAGGAAACTTTCAGTCTTCAGGG - Intronic
1087624724 11:100583650-100583672 GAGGTAGGTGTCACTCTTGGTGG - Intergenic
1088813719 11:113407973-113407995 GAGGTAACTGCAAGTCTTCAAGG - Intergenic
1091266332 11:134274404-134274426 GGGGGAACTTTCACTCTCCAGGG + Intronic
1092992076 12:13912708-13912730 GAGGAAACTGAGACTCTTAAAGG - Intronic
1093270472 12:17054062-17054084 GAAGTAAATGTAAATCTTCATGG - Intergenic
1098701771 12:73637633-73637655 AAGATAACTGTAAGTCTTCAAGG - Intergenic
1102439603 12:112950996-112951018 GAGGTCCCTATCACTCTCCAAGG - Intronic
1102889198 12:116545070-116545092 GAGGTAACTGTCATATTTAAAGG + Intergenic
1105468857 13:20673437-20673459 GAGGCAGCTGTCAGTCTTCCTGG - Intronic
1105709481 13:22992795-22992817 AAGGGCACTGTCACTCATCAAGG - Intergenic
1107091860 13:36490068-36490090 GAGGTGACTCTCAGTCTTCTTGG + Intergenic
1112131207 13:96525445-96525467 GAGGTAACAGCCAATCTTCCTGG - Intronic
1112490579 13:99859511-99859533 GAGGAAAAGGTCACTCTTTAGGG + Intronic
1115732053 14:36281267-36281289 CAGGCAACTTTCATTCTTCAAGG + Intergenic
1116616777 14:47150056-47150078 GAGGTAACTCACACCCTTCTCGG - Intronic
1116653334 14:47622131-47622153 TAAGTAACTGTCACTCTTCTAGG - Intronic
1123105676 14:105840075-105840097 GAGGAAACCGCCACTCCTCAGGG + Intergenic
1125026276 15:35032932-35032954 GAGATGACTGTCACTTTGCAAGG - Intergenic
1125748562 15:42013467-42013489 GGGGTTTCTGTCACTCTTCCAGG - Intronic
1130095462 15:80852324-80852346 GATGTAAATGTTACACTTCAAGG - Intronic
1130950634 15:88584186-88584208 GGGGAAACTGTCACACTACATGG + Intergenic
1132502866 16:292342-292364 GAGGTAACTGTGACCCTTTCTGG + Intronic
1132817288 16:1837144-1837166 GAGGCAACTGTGGCCCTTCAGGG + Intronic
1135608120 16:23840340-23840362 GAGATAATTGTCACTCCCCAGGG - Intronic
1137795259 16:51212049-51212071 GACATCACTGTCACTCATCAGGG + Intergenic
1138002302 16:53294534-53294556 GAGGCAACTGTGGCTCTTCTAGG - Intronic
1138303923 16:55957091-55957113 GAAATAACTGTCACTCTTCAGGG + Intergenic
1139811902 16:69626422-69626444 GAGGTAACTGTAACTCCTTTGGG - Exonic
1143244309 17:5469553-5469575 CAAATAACAGTCACTCTTCAAGG + Intergenic
1143960749 17:10716492-10716514 CAGATAAAAGTCACTCTTCATGG + Intronic
1145165990 17:20613960-20613982 GAGGAAGCAGTCACTCTTCCAGG + Intergenic
1148579282 17:48732779-48732801 GAAGTGACTGACACTCTTTAGGG - Intergenic
1151341166 17:73471913-73471935 GAGGTAGCAGGCCCTCTTCAAGG - Intronic
1152053550 17:78002281-78002303 GAAGAATCTGTTACTCTTCAGGG - Intergenic
1152121458 17:78421395-78421417 GGAGTCACTGTCACCCTTCATGG + Intronic
1158290080 18:55931083-55931105 TAGGTAATTGTCATGCTTCATGG + Intergenic
1158300705 18:56048865-56048887 CTGATAACTGTCACTCATCATGG + Intergenic
1158813973 18:61072182-61072204 GTGTTAACTGTCAGTCTTAAAGG - Intergenic
1159209794 18:65303399-65303421 GAAGTAACTGTCTTTCCTCAAGG - Intergenic
1163556371 19:17995508-17995530 GAGTTAACTGTATATCTTCAGGG - Intronic
1163786594 19:19277892-19277914 GAGGTAGCTGTCACCCACCAGGG + Intronic
1165827704 19:38714611-38714633 GAGGTCACTGTGACTCTTGCAGG + Intronic
925083107 2:1085023-1085045 GAGGCCACTGTCGGTCTTCACGG + Intronic
926754465 2:16224151-16224173 GAGGTCTCTGTCATTCCTCAGGG - Intergenic
928762775 2:34604345-34604367 GAAGTTACTGTCCCTTTTCATGG + Intergenic
929191792 2:39147019-39147041 GAGGTGACTGTCATCCTACATGG + Intergenic
930487814 2:52030120-52030142 GAGCTTCCTGTCACTCTTCAAGG - Intergenic
938706496 2:133933449-133933471 AATAAAACTGTCACTCTTCATGG - Intergenic
942487432 2:176454167-176454189 GTGGTATCTGTCACTGTTCTAGG - Intergenic
942659740 2:178251734-178251756 GAGGTAACTGTCACTGTTATAGG - Intronic
946153402 2:217791219-217791241 GAGGTGACTGCCTCTCTGCATGG - Intergenic
946730705 2:222706709-222706731 GAGGTTAATGTAACTATTCAGGG - Intronic
1172498247 20:35404823-35404845 GAGGTAACTGTTTGACTTCATGG + Intronic
1174686551 20:52461553-52461575 GAGGCAATTGTCATTCTTCTCGG + Intergenic
1178824341 21:36003199-36003221 GAGGTATTTGTCAATCCTCATGG - Intronic
1179361740 21:40715752-40715774 GAGGTAACTGTCACTCTTCAAGG + Intronic
1180595165 22:16968235-16968257 GAGGTAAAGGTCACACTCCATGG - Intronic
949839883 3:8308101-8308123 ATGGTATCTGTCACTCTTTATGG + Intergenic
953394123 3:42553530-42553552 GAGAGAAATGACACTCTTCATGG - Intronic
953782460 3:45883805-45883827 GCTGCAACTCTCACTCTTCATGG - Intronic
956521125 3:70105477-70105499 GAGGGAGCAGTCACGCTTCAGGG - Intergenic
959712909 3:109402501-109402523 GAACTAACTGTAACTCTTTAAGG - Intergenic
962388688 3:134953827-134953849 GAGGTAACTGACAAGCTACACGG - Intronic
964192376 3:154018264-154018286 GGGGTCACTGTCACTCCTCATGG - Intergenic
966894182 3:184430115-184430137 GAGCTCACTGTCTCTCTTCTGGG + Intronic
975217176 4:71769249-71769271 GAGGTAACTTTGACTCAGCATGG - Intronic
979207623 4:118059195-118059217 GAGGTAACTGTGGCTCCTCCTGG + Intronic
983281236 4:165683041-165683063 GATGTAACGGTCACTGTGCAGGG + Intergenic
983377156 4:166944742-166944764 GAAGTTACTGTCACTCTGAAAGG - Intronic
984025730 4:174540668-174540690 GAGGGAACTGACACTCTGAAAGG - Intergenic
984652995 4:182289440-182289462 GAGGCCACTGGCACTCTGCAGGG + Intronic
990558356 5:56959102-56959124 GAAGTAATTGTCAGTCTTTACGG - Intronic
992644923 5:78803154-78803176 GAGGAAACTGACTCTCTCCATGG - Intronic
993290794 5:86067257-86067279 GTGGAAACTGCCAGTCTTCAGGG + Intergenic
1004839976 6:19571890-19571912 GATGTCACTGTCAGTGTTCAAGG + Intergenic
1005960902 6:30692416-30692438 GTGGTAAGTGTCTCTATTCATGG - Intergenic
1014324668 6:119977981-119978003 GAGGTAATGGACACTCTTCCCGG - Intergenic
1015203909 6:130613698-130613720 GATGTGTCCGTCACTCTTCATGG + Intergenic
1020143625 7:5626130-5626152 GAGGGAGCTGTCTCTCTCCAGGG + Intronic
1020378725 7:7517872-7517894 GAGCAATCAGTCACTCTTCAGGG - Intronic
1023517352 7:41015099-41015121 GAGGTAACTTTCCCTCTCCATGG + Intergenic
1024564197 7:50668099-50668121 GAGGTAAGTGTCCCTCATCTGGG - Intronic
1030112312 7:106037431-106037453 TAGGTAACTGGCACTATTCTAGG + Intergenic
1031479468 7:122260717-122260739 GAGTAATCTGTCACACTTCAGGG - Intergenic
1031521095 7:122766797-122766819 CAGGTAACTGTCACTCTGTTTGG + Intronic
1031950707 7:127888972-127888994 GAGGTAAATGTCACATATCAGGG - Intronic
1033841888 7:145385659-145385681 GAAGTAACTGTTACACCTCAGGG - Intergenic
1033864073 7:145666615-145666637 GAAATAATTGTCACTCTTCTTGG - Intergenic
1034022190 7:147657062-147657084 GAGCTAAATGTCTCACTTCAGGG - Intronic
1037843447 8:22261996-22262018 GAGGTAACTGGACCTCTTAAAGG - Intergenic
1038891047 8:31723960-31723982 GAGCTAAATGTCATTCTTCCTGG + Intronic
1042225210 8:66509916-66509938 AAGGCAACTGTCACTCTTCTAGG - Intronic
1046009410 8:108528211-108528233 GAGGTAGCTGTCTCTCTGAATGG - Intergenic
1053105851 9:35406892-35406914 GAGGGGACAGTCTCTCTTCAAGG - Intergenic
1053591682 9:39520976-39520998 TGGGTACCTGTCACTCTTCTAGG - Intergenic
1053849530 9:42276339-42276361 TGGGTACCTGTCACTCTTCTAGG - Intergenic
1054574626 9:66844313-66844335 TGGGTACCTGTCACTCTTCTAGG + Intergenic
1059541945 9:115139038-115139060 TAGTAAACTGTGACTCTTCAAGG + Intergenic
1061322839 9:129842264-129842286 GAGGTAACGGTCACTATGGAAGG - Intronic
1062025517 9:134338489-134338511 GAGGTCACTGCCACTCTTGCTGG + Intronic
1185496284 X:556689-556711 CAGGTAACCGTCTCTCTCCATGG + Intergenic
1190105109 X:47554941-47554963 GAGGTGTCTGTCACTGTCCATGG + Intergenic
1191269829 X:58450714-58450736 GAGGTAAATGTTGCTCTTTATGG + Intergenic
1191690460 X:63933414-63933436 GGGGCAACTGTGGCTCTTCACGG + Intergenic
1192639161 X:72846562-72846584 GTGATTACTGTCCCTCTTCAGGG - Intronic
1192642550 X:72874243-72874265 GTGATTACTGTCCCTCTTCAGGG + Intronic
1195259163 X:103115927-103115949 GAGGTGACTGTGAGTCTGCAGGG - Intergenic
1197454013 X:126654743-126654765 CAGGTATGTGTGACTCTTCAGGG - Intergenic
1200816841 Y:7542118-7542140 GAAGTAACTGGCATTCTTCTGGG - Intergenic